Design Results for ABCA4

(Canis Lupus Familiaris, Broad CanFam3.1/canFam3)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 35 To Exon 37 (Pair 1)
Forward (4996,21)ATCACTGTCATAAGCCAGCCCAmplicon SizecDNA: 299 bpgenomic: 5,626
Reverse (5294,23)GCTTTCTTCTGAAACCCAACAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.769 kcal/mol in 3' area
Forward Dimers-0.826 kcal/mol
Reverse Loops1.416 kcal/mol
Reverse Dimers0.133 kcal/mol in 3' area
Forward-Reverse Dimers-1.707 kcal/mol
Amplicon Folding-2.727 kcal/mol outside primersite
Amplicon SequenceATCACTGTCATAAGCCAGCCCCTGAACCTGACCAAGGAGCAGCTCTCAGAGATCACAGTG
CTGACCGCTTCAGTGGATGCTGTGGTTGCCATCTGTGTGATTTTCGCCATGTCCTTTGTC
CCAGCCAGCTTTGTCCTTTATTTGATCCAGGAGAGGGTAAACAAAGCCAAGCACCTCCAG
TTTGTCAGCGGAGTGAGTCCCACTACCTATTGGCTGACCAACTTCCTCTGGGACATTATG
AATTATGCTGTGAGCGCTGCACTGGTGGTGGGGATCTTTGTTGGGTTTCAGAAGAAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)2994996 - 5294
Exon 35 To Exon 37 (Pair 2)
Forward (4995,21)CATCACTGTCATAAGCCAGCCAmplicon SizecDNA: 300 bpgenomic: 5,627
Reverse (5294,23)GCTTTCTTCTGAAACCCAACAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.769 kcal/mol in 3' area
Forward Dimers-0.826 kcal/mol
Reverse Loops1.416 kcal/mol
Reverse Dimers0.133 kcal/mol in 3' area
Forward-Reverse Dimers-1.707 kcal/mol
Amplicon Folding-2.727 kcal/mol outside primersite
Amplicon SequenceCATCACTGTCATAAGCCAGCCCCTGAACCTGACCAAGGAGCAGCTCTCAGAGATCACAGT
GCTGACCGCTTCAGTGGATGCTGTGGTTGCCATCTGTGTGATTTTCGCCATGTCCTTTGT
CCCAGCCAGCTTTGTCCTTTATTTGATCCAGGAGAGGGTAAACAAAGCCAAGCACCTCCA
GTTTGTCAGCGGAGTGAGTCCCACTACCTATTGGCTGACCAACTTCCTCTGGGACATTAT
GAATTATGCTGTGAGCGCTGCACTGGTGGTGGGGATCTTTGTTGGGTTTCAGAAGAAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)3004995 - 5294
Exon 36 To Exon 37 (Pair 1)
Forward (5073,21)TGCTGTGGTTGCCATCTGTGTAmplicon SizecDNA: 222 bpgenomic: 3,926
Reverse (5294,23)GCTTTCTTCTGAAACCCAACAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.427 kcal/mol
Forward Dimers-0.414 kcal/mol
Reverse Loops1.416 kcal/mol
Reverse Dimers0.133 kcal/mol in 3' area
Forward-Reverse Dimers-2.011 kcal/mol
Amplicon Folding-1.654 kcal/mol outside primersite
Amplicon SequenceTGCTGTGGTTGCCATCTGTGTGATTTTCGCCATGTCCTTTGTCCCAGCCAGCTTTGTCCT
TTATTTGATCCAGGAGAGGGTAAACAAAGCCAAGCACCTCCAGTTTGTCAGCGGAGTGAG
TCCCACTACCTATTGGCTGACCAACTTCCTCTGGGACATTATGAATTATGCTGTGAGCGC
TGCACTGGTGGTGGGGATCTTTGTTGGGTTTCAGAAGAAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)2225073 - 5294
Exon 36 To Exon 37 (Pair 2)
Forward (5072,21)ATGCTGTGGTTGCCATCTGTGAmplicon SizecDNA: 223 bpgenomic: 3,927
Reverse (5294,23)GCTTTCTTCTGAAACCCAACAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.427 kcal/mol
Forward Dimers-0.414 kcal/mol
Reverse Loops1.416 kcal/mol
Reverse Dimers0.133 kcal/mol in 3' area
Forward-Reverse Dimers-2.011 kcal/mol
Amplicon Folding-1.654 kcal/mol outside primersite
Amplicon SequenceATGCTGTGGTTGCCATCTGTGTGATTTTCGCCATGTCCTTTGTCCCAGCCAGCTTTGTCC
TTTATTTGATCCAGGAGAGGGTAAACAAAGCCAAGCACCTCCAGTTTGTCAGCGGAGTGA
GTCCCACTACCTATTGGCTGACCAACTTCCTCTGGGACATTATGAATTATGCTGTGAGCG
CTGCACTGGTGGTGGGGATCTTTGTTGGGTTTCAGAAGAAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)2235072 - 5294
Exon 36 To Exon 37 (Pair 3)
Forward (5058,20)GACCGCTTCAGTGGATGCTGAmplicon SizecDNA: 237 bpgenomic: 3,941
Reverse (5294,23)GCTTTCTTCTGAAACCCAACAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.014 kcal/mol
Forward Dimers-2.409 kcal/mol
Reverse Loops1.416 kcal/mol
Reverse Dimers0.133 kcal/mol in 3' area
Forward-Reverse Dimers-1.334 kcal/mol
Amplicon Folding-1.654 kcal/mol outside primersite
Amplicon SequenceGACCGCTTCAGTGGATGCTGTGGTTGCCATCTGTGTGATTTTCGCCATGTCCTTTGTCCC
AGCCAGCTTTGTCCTTTATTTGATCCAGGAGAGGGTAAACAAAGCCAAGCACCTCCAGTT
TGTCAGCGGAGTGAGTCCCACTACCTATTGGCTGACCAACTTCCTCTGGGACATTATGAA
TTATGCTGTGAGCGCTGCACTGGTGGTGGGGATCTTTGTTGGGTTTCAGAAGAAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)2375058 - 5294
Exon 36 To Exon 37 (Pair 4)
Forward (5071,21)GATGCTGTGGTTGCCATCTGTAmplicon SizecDNA: 224 bpgenomic: 3,928
Reverse (5294,23)GCTTTCTTCTGAAACCCAACAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.427 kcal/mol
Forward Dimers-0.414 kcal/mol
Reverse Loops1.416 kcal/mol
Reverse Dimers0.133 kcal/mol in 3' area
Forward-Reverse Dimers-2.011 kcal/mol
Amplicon Folding-1.654 kcal/mol outside primersite
Amplicon SequenceGATGCTGTGGTTGCCATCTGTGTGATTTTCGCCATGTCCTTTGTCCCAGCCAGCTTTGTC
CTTTATTTGATCCAGGAGAGGGTAAACAAAGCCAAGCACCTCCAGTTTGTCAGCGGAGTG
AGTCCCACTACCTATTGGCTGACCAACTTCCTCTGGGACATTATGAATTATGCTGTGAGC
GCTGCACTGGTGGTGGGGATCTTTGTTGGGTTTCAGAAGAAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)2245071 - 5294
Exon 36 To Exon 37 (Pair 5)
Forward (5077,22)GTGGTTGCCATCTGTGTGATTTAmplicon SizecDNA: 218 bpgenomic: 3,922
Reverse (5294,23)GCTTTCTTCTGAAACCCAACAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.77 kcal/mol in 3' area
Forward Dimers-0.414 kcal/mol
Reverse Loops1.416 kcal/mol
Reverse Dimers0.133 kcal/mol in 3' area
Forward-Reverse Dimers-2.011 kcal/mol
Amplicon Folding-1.654 kcal/mol outside primersite
Amplicon SequenceGTGGTTGCCATCTGTGTGATTTTCGCCATGTCCTTTGTCCCAGCCAGCTTTGTCCTTTAT
TTGATCCAGGAGAGGGTAAACAAAGCCAAGCACCTCCAGTTTGTCAGCGGAGTGAGTCCC
ACTACCTATTGGCTGACCAACTTCCTCTGGGACATTATGAATTATGCTGTGAGCGCTGCA
CTGGTGGTGGGGATCTTTGTTGGGTTTCAGAAGAAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)2185077 - 5294
Exon 36 To Exon 37 (Pair 6)
Forward (5060,20)CCGCTTCAGTGGATGCTGTGAmplicon SizecDNA: 235 bpgenomic: 3,939
Reverse (5294,23)GCTTTCTTCTGAAACCCAACAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.557 kcal/mol
Forward Dimers-1.866 kcal/mol
Reverse Loops1.416 kcal/mol
Reverse Dimers0.133 kcal/mol in 3' area
Forward-Reverse Dimers-1.334 kcal/mol
Amplicon Folding-1.654 kcal/mol outside primersite
Amplicon SequenceCCGCTTCAGTGGATGCTGTGGTTGCCATCTGTGTGATTTTCGCCATGTCCTTTGTCCCAG
CCAGCTTTGTCCTTTATTTGATCCAGGAGAGGGTAAACAAAGCCAAGCACCTCCAGTTTG
TCAGCGGAGTGAGTCCCACTACCTATTGGCTGACCAACTTCCTCTGGGACATTATGAATT
ATGCTGTGAGCGCTGCACTGGTGGTGGGGATCTTTGTTGGGTTTCAGAAGAAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)2355060 - 5294
Exon 36 To Exon 37 (Pair 7)
Forward (5075,21)CTGTGGTTGCCATCTGTGTGAAmplicon SizecDNA: 220 bpgenomic: 3,924
Reverse (5294,23)GCTTTCTTCTGAAACCCAACAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.427 kcal/mol
Forward Dimers-0.414 kcal/mol
Reverse Loops1.416 kcal/mol
Reverse Dimers0.133 kcal/mol in 3' area
Forward-Reverse Dimers-2.011 kcal/mol
Amplicon Folding-1.654 kcal/mol outside primersite
Amplicon SequenceCTGTGGTTGCCATCTGTGTGATTTTCGCCATGTCCTTTGTCCCAGCCAGCTTTGTCCTTT
ATTTGATCCAGGAGAGGGTAAACAAAGCCAAGCACCTCCAGTTTGTCAGCGGAGTGAGTC
CCACTACCTATTGGCTGACCAACTTCCTCTGGGACATTATGAATTATGCTGTGAGCGCTG
CACTGGTGGTGGGGATCTTTGTTGGGTTTCAGAAGAAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)2205075 - 5294
Exon 36 To Exon 37 (Pair 8)
Forward (5076,22)TGTGGTTGCCATCTGTGTGATTAmplicon SizecDNA: 219 bpgenomic: 3,923
Reverse (5294,23)GCTTTCTTCTGAAACCCAACAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.77 kcal/mol in 3' area
Forward Dimers-0.414 kcal/mol
Reverse Loops1.416 kcal/mol
Reverse Dimers0.133 kcal/mol in 3' area
Forward-Reverse Dimers-2.011 kcal/mol
Amplicon Folding-1.654 kcal/mol outside primersite
Amplicon SequenceTGTGGTTGCCATCTGTGTGATTTTCGCCATGTCCTTTGTCCCAGCCAGCTTTGTCCTTTA
TTTGATCCAGGAGAGGGTAAACAAAGCCAAGCACCTCCAGTTTGTCAGCGGAGTGAGTCC
CACTACCTATTGGCTGACCAACTTCCTCTGGGACATTATGAATTATGCTGTGAGCGCTGC
ACTGGTGGTGGGGATCTTTGTTGGGTTTCAGAAGAAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)2195076 - 5294
Exon 38 To Exon 39 (Pair 1)
Forward (5416,22)GCCTTGTCATGTGCTAATCTGTAmplicon SizecDNA: 116 bpgenomic: 3,120
Reverse (5531,21)AGCTTCCTTAGCATGGCGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.258 kcal/mol
Forward Dimers-0.252 kcal/mol
Reverse Loops0.254 kcal/mol
Reverse Dimers-1.822 kcal/mol
Forward-Reverse Dimers-2.073 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceGCCTTGTCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTG
GAATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1165416 - 5531
Exon 38 To Exon 39 (Pair 2)
Forward (5375,22)CAGCATCCTTCCTGTTTGATGTAmplicon SizecDNA: 156 bpgenomic: 3,160
Reverse (5530,21)GCTTCCTTAGCATGGCGTTGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.459 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.581 kcal/mol
Reverse Dimers-1.106 kcal/mol
Forward-Reverse Dimers-1.809 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTGCTAATC
TGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGAATAACT
GGACACTGCTCAGATTCAACGCCATGCTAAGGAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1565375 - 5530
Exon 38 To Exon 39 (Pair 3)
Forward (5366,21)TGATGTACCCAGCATCCTTCCAmplicon SizecDNA: 162 bpgenomic: 3,166
Reverse (5527,22)TCCTTAGCATGGCGTTGAATCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.31 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-1.043 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceTGATGTACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCAT
GTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTG
AGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1625366 - 5527
Exon 38 To Exon 39 (Pair 4)
Forward (5453,21)GCAGTGCCATCACCTTCATCTAmplicon SizecDNA: 112 bpgenomic: 3,116
Reverse (5564,19)CGGCCCAGGCAGAAGTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.042 kcal/mol
Forward Dimers-2.432 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-2.28 kcal/mol
Forward-Reverse Dimers-2.627 kcal/mol
Amplicon Folding0.289 kcal/mol outside primersite
Amplicon SequenceGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGAATAACTGGACACTGCTCAGATTCA
ACGCCATGCTAAGGAAGCTGCTCATTATCTTCCCACACTTCTGCCTGGGCCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1125453 - 5564
Exon 38 To Exon 39 (Pair 5)
Forward (5372,21)ACCCAGCATCCTTCCTGTTTGAmplicon SizecDNA: 156 bpgenomic: 3,160
Reverse (5527,22)TCCTTAGCATGGCGTTGAATCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.459 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-1.043 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTGCTA
ATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGAATA
ACTGGACACTGCTCAGATTCAACGCCATGCTAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1565372 - 5527
Exon 38 To Exon 39 (Pair 6)
Forward (5418,23)CTTGTCATGTGCTAATCTGTTCAAmplicon SizecDNA: 136 bpgenomic: 3,140
Reverse (5553,22)GAAGTGTGGGAAGATAATGAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.19 kcal/mol in 3' area
Forward Dimers-0.252 kcal/mol
Reverse Loops3.394 kcal/mol
Reverse Dimers-0.046 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceCTTGTCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGA
ATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGCTCAT
TATCTTCCCACACTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)-45885418 - 829
Exon 38 To Exon 39 (Pair 7)
Forward (5408,21)CCTATGTGGCCTTGTCATGTGAmplicon SizecDNA: 120 bpgenomic: 3,124
Reverse (5527,22)TCCTTAGCATGGCGTTGAATCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.42 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-1.598 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceCCTATGTGGCCTTGTCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCT
TCATCTTGGAATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1205408 - 5527
Exon 38 To Exon 39 (Pair 8)
Forward (5366,21)TGATGTACCCAGCATCCTTCCAmplicon SizecDNA: 165 bpgenomic: 3,169
Reverse (5530,21)GCTTCCTTAGCATGGCGTTGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.31 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.581 kcal/mol
Reverse Dimers-1.106 kcal/mol
Forward-Reverse Dimers-1.809 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceTGATGTACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCAT
GTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTG
AGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1655366 - 5530
Exon 38 To Exon 39 (Pair 9)
Forward (5420,23)TGTCATGTGCTAATCTGTTCATCAmplicon SizecDNA: 111 bpgenomic: 3,115
Reverse (5530,21)GCTTCCTTAGCATGGCGTTGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.976 kcal/mol in 3' area
Forward Dimers-0.252 kcal/mol
Reverse Loops0.581 kcal/mol
Reverse Dimers-1.106 kcal/mol
Forward-Reverse Dimers-2.073 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceTGTCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAAT
TATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1115420 - 5530
Exon 38 To Exon 39 (Pair 10)
Forward (5416,22)GCCTTGTCATGTGCTAATCTGTAmplicon SizecDNA: 114 bpgenomic: 3,118
Reverse (5529,22)CTTCCTTAGCATGGCGTTGAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.258 kcal/mol
Forward Dimers-0.252 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-2.073 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceGCCTTGTCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTG
GAATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1145416 - 5529
Exon 38 To Exon 39 (Pair 11)
Forward (5373,21)CCCAGCATCCTTCCTGTTTGAAmplicon SizecDNA: 155 bpgenomic: 3,159
Reverse (5527,22)TCCTTAGCATGGCGTTGAATCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.459 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-1.043 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceCCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTGCTAA
TCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGAATAA
CTGGACACTGCTCAGATTCAACGCCATGCTAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1555373 - 5527
Exon 38 To Exon 39 (Pair 12)
Forward (5418,23)CTTGTCATGTGCTAATCTGTTCAAmplicon SizecDNA: 111 bpgenomic: 3,115
Reverse (5528,22)TTCCTTAGCATGGCGTTGAATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.19 kcal/mol in 3' area
Forward Dimers-0.252 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-2.073 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceCTTGTCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGA
ATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1115418 - 5528
Exon 38 To Exon 39 (Pair 13)
Forward (5420,23)TGTCATGTGCTAATCTGTTCATCAmplicon SizecDNA: 114 bpgenomic: 3,118
Reverse (5533,20)GCAGCTTCCTTAGCATGGCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.976 kcal/mol in 3' area
Forward Dimers-0.252 kcal/mol
Reverse Loops0.254 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.073 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceTGTCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAAT
TATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1145420 - 5533
Exon 38 To Exon 39 (Pair 14)
Forward (5376,22)AGCATCCTTCCTGTTTGATGTCAmplicon SizecDNA: 153 bpgenomic: 3,157
Reverse (5528,22)TTCCTTAGCATGGCGTTGAATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.417 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-1.043 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTGCTAATCT
GTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGAATAACTG
GACACTGCTCAGATTCAACGCCATGCTAAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1535376 - 5528
Exon 38 To Exon 39 (Pair 15)
Forward (5367,21)GATGTACCCAGCATCCTTCCTAmplicon SizecDNA: 191 bpgenomic: 3,195
Reverse (5557,22)GGCAGAAGTGTGGGAAGATAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.31 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.912 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-2.936 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceGATGTACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATG
TGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGA
GAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGCTCATTATCTTCCC
ACACTTCTGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)-45365367 - 830
Exon 38 To Exon 39 (Pair 16)
Forward (5463,24)CACCTTCATCTTGGAATTATTTGAAmplicon SizecDNA: 103 bpgenomic: 3,107
Reverse (5565,19)CCGGCCCAGGCAGAAGTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.936 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-2.28 kcal/mol
Forward-Reverse Dimers-1.844 kcal/mol
Amplicon Folding0.289 kcal/mol outside primersite
Amplicon SequenceCACCTTCATCTTGGAATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCT
AAGGAAGCTGCTCATTATCTTCCCACACTTCTGCCTGGGCCGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1035463 - 5565
Exon 38 To Exon 39 (Pair 17)
Forward (5414,22)TGGCCTTGTCATGTGCTAATCTAmplicon SizecDNA: 117 bpgenomic: 3,121
Reverse (5530,21)GCTTCCTTAGCATGGCGTTGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.803 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops0.581 kcal/mol
Reverse Dimers-1.106 kcal/mol
Forward-Reverse Dimers-2.073 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceTGGCCTTGTCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCT
TGGAATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1175414 - 5530
Exon 38 To Exon 39 (Pair 18)
Forward (5368,21)ATGTACCCAGCATCCTTCCTGAmplicon SizecDNA: 164 bpgenomic: 3,168
Reverse (5531,21)AGCTTCCTTAGCATGGCGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.873 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.254 kcal/mol
Reverse Dimers-1.822 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceATGTACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGT
GCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAG
AATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1645368 - 5531
Exon 38 To Exon 39 (Pair 19)
Forward (5420,23)TGTCATGTGCTAATCTGTTCATCAmplicon SizecDNA: 108 bpgenomic: 3,112
Reverse (5527,22)TCCTTAGCATGGCGTTGAATCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.976 kcal/mol in 3' area
Forward Dimers-0.252 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-2.073 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceTGTCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAAT
TATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1085420 - 5527
Exon 38 To Exon 39 (Pair 20)
Forward (5370,21)GTACCCAGCATCCTTCCTGTTAmplicon SizecDNA: 163 bpgenomic: 3,167
Reverse (5532,21)CAGCTTCCTTAGCATGGCGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.459 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.254 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceGTACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTGC
TAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGAA
TAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1635370 - 5532
Exon 38 To Exon 39 (Pair 21)
Forward (5424,22)ATGTGCTAATCTGTTCATCGGGAmplicon SizecDNA: 105 bpgenomic: 3,109
Reverse (5528,22)TTCCTTAGCATGGCGTTGAATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.19 kcal/mol
Forward Dimers-0.136 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-2.073 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATT
TGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1055424 - 5528
Exon 38 To Exon 39 (Pair 22)
Forward (5464,24)ACCTTCATCTTGGAATTATTTGAGAmplicon SizecDNA: 102 bpgenomic: 3,106
Reverse (5565,19)CCGGCCCAGGCAGAAGTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.936 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-2.28 kcal/mol
Forward-Reverse Dimers-1.844 kcal/mol
Amplicon Folding0.289 kcal/mol outside primersite
Amplicon SequenceACCTTCATCTTGGAATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTA
AGGAAGCTGCTCATTATCTTCCCACACTTCTGCCTGGGCCGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1025464 - 5565
Exon 38 To Exon 39 (Pair 23)
Forward (5426,22)GTGCTAATCTGTTCATCGGGATAmplicon SizecDNA: 106 bpgenomic: 3,110
Reverse (5531,21)AGCTTCCTTAGCATGGCGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol in 3' area
Forward Dimers-0.136 kcal/mol
Reverse Loops0.254 kcal/mol
Reverse Dimers-1.822 kcal/mol
Forward-Reverse Dimers-2.073 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTG
AGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1065426 - 5531
Exon 38 To Exon 39 (Pair 24)
Forward (5412,22)TGTGGCCTTGTCATGTGCTAATAmplicon SizecDNA: 146 bpgenomic: 3,150
Reverse (5557,22)GGCAGAAGTGTGGGAAGATAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.803 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops1.912 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.749 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceTGTGGCCTTGTCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCAT
CTTGGAATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCT
GCTCATTATCTTCCCACACTTCTGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)-45815412 - 830
Exon 38 To Exon 39 (Pair 25)
Forward (5370,21)GTACCCAGCATCCTTCCTGTTAmplicon SizecDNA: 190 bpgenomic: 3,194
Reverse (5559,21)CAGGCAGAAGTGTGGGAAGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.459 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.912 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-2.936 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceGTACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTGC
TAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGAA
TAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGCTCATTATCTTCCCACA
CTTCTGCCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)-45395370 - 830
Exon 38 To Exon 39 (Pair 26)
Forward (5453,21)GCAGTGCCATCACCTTCATCTAmplicon SizecDNA: 111 bpgenomic: 3,115
Reverse (5563,19)GGCCCAGGCAGAAGTGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.042 kcal/mol
Forward Dimers-2.432 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-2.28 kcal/mol
Forward-Reverse Dimers-2.627 kcal/mol
Amplicon Folding0.289 kcal/mol outside primersite
Amplicon SequenceGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGAATAACTGGACACTGCTCAGATTCA
ACGCCATGCTAAGGAAGCTGCTCATTATCTTCCCACACTTCTGCCTGGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1115453 - 5563
Exon 38 To Exon 39 (Pair 27)
Forward (5375,22)CAGCATCCTTCCTGTTTGATGTAmplicon SizecDNA: 191 bpgenomic: 3,195
Reverse (5565,19)CCGGCCCAGGCAGAAGTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.459 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-2.28 kcal/mol
Forward-Reverse Dimers-1.642 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTGCTAATC
TGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGAATAACT
GGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGCTCATTATCTTCCCACACTTCT
GCCTGGGCCGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1915375 - 5565
Exon 38 To Exon 39 (Pair 28)
Forward (5369,21)TGTACCCAGCATCCTTCCTGTAmplicon SizecDNA: 163 bpgenomic: 3,167
Reverse (5531,21)AGCTTCCTTAGCATGGCGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.459 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.254 kcal/mol
Reverse Dimers-1.822 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceTGTACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTG
CTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGA
ATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1635369 - 5531
Exon 38 To Exon 39 (Pair 29)
Forward (5370,21)GTACCCAGCATCCTTCCTGTTAmplicon SizecDNA: 158 bpgenomic: 3,162
Reverse (5527,22)TCCTTAGCATGGCGTTGAATCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.459 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-1.043 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceGTACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTGC
TAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGAA
TAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1585370 - 5527
Exon 38 To Exon 39 (Pair 30)
Forward (5424,22)ATGTGCTAATCTGTTCATCGGGAmplicon SizecDNA: 110 bpgenomic: 3,114
Reverse (5533,20)GCAGCTTCCTTAGCATGGCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.19 kcal/mol
Forward Dimers-0.136 kcal/mol
Reverse Loops0.254 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.073 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATT
TGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1105424 - 5533
Exon 38 To Exon 39 (Pair 31)
Forward (5369,21)TGTACCCAGCATCCTTCCTGTAmplicon SizecDNA: 160 bpgenomic: 3,164
Reverse (5528,22)TTCCTTAGCATGGCGTTGAATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.459 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-1.043 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceTGTACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTG
CTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGA
ATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1605369 - 5528
Exon 38 To Exon 39 (Pair 32)
Forward (5423,22)CATGTGCTAATCTGTTCATCGGAmplicon SizecDNA: 141 bpgenomic: 3,145
Reverse (5563,19)GGCCCAGGCAGAAGTGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.976 kcal/mol in 3' area
Forward Dimers-0.136 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-2.28 kcal/mol
Forward-Reverse Dimers-1.403 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTAT
TTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGCTCATTATCT
TCCCACACTTCTGCCTGGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1415423 - 5563
Exon 38 To Exon 39 (Pair 33)
Forward (5426,22)GTGCTAATCTGTTCATCGGGATAmplicon SizecDNA: 107 bpgenomic: 3,111
Reverse (5532,21)CAGCTTCCTTAGCATGGCGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol in 3' area
Forward Dimers-0.136 kcal/mol
Reverse Loops0.254 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.073 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTG
AGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1075426 - 5532
Exon 38 To Exon 39 (Pair 34)
Forward (5369,21)TGTACCCAGCATCCTTCCTGTAmplicon SizecDNA: 189 bpgenomic: 3,193
Reverse (5557,22)GGCAGAAGTGTGGGAAGATAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.459 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.912 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-2.936 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceTGTACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTG
CTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGA
ATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGCTCATTATCTTCCCAC
ACTTCTGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)-45385369 - 830
Exon 38 To Exon 39 (Pair 35)
Forward (5426,22)GTGCTAATCTGTTCATCGGGATAmplicon SizecDNA: 102 bpgenomic: 3,106
Reverse (5527,22)TCCTTAGCATGGCGTTGAATCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol in 3' area
Forward Dimers-0.136 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-2.073 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTG
AGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1025426 - 5527
Exon 38 To Exon 39 (Pair 36)
Forward (5465,24)CCTTCATCTTGGAATTATTTGAGAAmplicon SizecDNA: 96 bpgenomic: 3,100
Reverse (5560,20)CCAGGCAGAAGTGTGGGAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.772 kcal/mol
Forward Dimers-0.936 kcal/mol
Reverse Loops1.144 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.302 kcal/mol
Amplicon Folding0.289 kcal/mol outside primersite
Amplicon SequenceCCTTCATCTTGGAATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAA
GGAAGCTGCTCATTATCTTCCCACACTTCTGCCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)-46345465 - 830
Exon 38 To Exon 39 (Pair 37)
Forward (5366,21)TGATGTACCCAGCATCCTTCCAmplicon SizecDNA: 168 bpgenomic: 3,172
Reverse (5533,20)GCAGCTTCCTTAGCATGGCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.31 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.254 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceTGATGTACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCAT
GTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTG
AGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1685366 - 5533
Exon 38 To Exon 39 (Pair 38)
Forward (5375,22)CAGCATCCTTCCTGTTTGATGTAmplicon SizecDNA: 159 bpgenomic: 3,163
Reverse (5533,20)GCAGCTTCCTTAGCATGGCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.459 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.254 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTGCTAATC
TGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGAATAACT
GGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1595375 - 5533
Exon 38 To Exon 39 (Pair 39)
Forward (5373,21)CCCAGCATCCTTCCTGTTTGAAmplicon SizecDNA: 161 bpgenomic: 3,165
Reverse (5533,20)GCAGCTTCCTTAGCATGGCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.459 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.254 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceCCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTGCTAA
TCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGAATAA
CTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1615373 - 5533
Exon 38 To Exon 39 (Pair 40)
Forward (5373,21)CCCAGCATCCTTCCTGTTTGAAmplicon SizecDNA: 158 bpgenomic: 3,162
Reverse (5530,21)GCTTCCTTAGCATGGCGTTGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.459 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.581 kcal/mol
Reverse Dimers-1.106 kcal/mol
Forward-Reverse Dimers-1.809 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceCCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTGCTAA
TCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGAATAA
CTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1585373 - 5530
Exon 38 To Exon 39 (Pair 41)
Forward (5464,24)ACCTTCATCTTGGAATTATTTGAGAmplicon SizecDNA: 97 bpgenomic: 3,101
Reverse (5560,20)CCAGGCAGAAGTGTGGGAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.936 kcal/mol
Reverse Loops1.144 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.844 kcal/mol
Amplicon Folding0.289 kcal/mol outside primersite
Amplicon SequenceACCTTCATCTTGGAATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTA
AGGAAGCTGCTCATTATCTTCCCACACTTCTGCCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)-46335464 - 830
Exon 38 To Exon 39 (Pair 42)
Forward (5372,21)ACCCAGCATCCTTCCTGTTTGAmplicon SizecDNA: 187 bpgenomic: 3,191
Reverse (5558,22)AGGCAGAAGTGTGGGAAGATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.459 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.912 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-2.936 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTGCTA
ATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGAATA
ACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGCTCATTATCTTCCCACACT
TCTGCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)-45415372 - 830
Exon 38 To Exon 39 (Pair 43)
Forward (5376,22)AGCATCCTTCCTGTTTGATGTCAmplicon SizecDNA: 189 bpgenomic: 3,193
Reverse (5564,19)CGGCCCAGGCAGAAGTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.417 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-2.28 kcal/mol
Forward-Reverse Dimers-1.642 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTGCTAATCT
GTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGAATAACTG
GACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGCTCATTATCTTCCCACACTTCTG
CCTGGGCCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1895376 - 5564
Exon 38 To Exon 39 (Pair 44)
Forward (5462,24)TCACCTTCATCTTGGAATTATTTGAmplicon SizecDNA: 99 bpgenomic: 3,103
Reverse (5560,20)CCAGGCAGAAGTGTGGGAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.936 kcal/mol
Reverse Loops1.144 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.844 kcal/mol
Amplicon Folding0.289 kcal/mol outside primersite
Amplicon SequenceTCACCTTCATCTTGGAATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGC
TAAGGAAGCTGCTCATTATCTTCCCACACTTCTGCCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)-46315462 - 830
Exon 38 To Exon 39 (Pair 45)
Forward (5372,21)ACCCAGCATCCTTCCTGTTTGAmplicon SizecDNA: 188 bpgenomic: 3,192
Reverse (5559,21)CAGGCAGAAGTGTGGGAAGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.459 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.912 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-2.936 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTGCTA
ATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGAATA
ACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGCTCATTATCTTCCCACACT
TCTGCCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)-45415372 - 830
Exon 38 To Exon 39 (Pair 46)
Forward (5367,21)GATGTACCCAGCATCCTTCCTAmplicon SizecDNA: 163 bpgenomic: 3,167
Reverse (5529,22)CTTCCTTAGCATGGCGTTGAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.31 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-1.043 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceGATGTACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATG
TGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGA
GAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1635367 - 5529
Exon 38 To Exon 39 (Pair 47)
Forward (5416,22)GCCTTGTCATGTGCTAATCTGTAmplicon SizecDNA: 143 bpgenomic: 3,147
Reverse (5558,22)AGGCAGAAGTGTGGGAAGATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.258 kcal/mol
Forward Dimers-0.252 kcal/mol
Reverse Loops1.912 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-2.675 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceGCCTTGTCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTG
GAATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGCTC
ATTATCTTCCCACACTTCTGCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)-45855416 - 830
Exon 38 To Exon 39 (Pair 48)
Forward (5411,22)ATGTGGCCTTGTCATGTGCTAAAmplicon SizecDNA: 148 bpgenomic: 3,152
Reverse (5558,22)AGGCAGAAGTGTGGGAAGATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.803 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops1.912 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-2.966 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceATGTGGCCTTGTCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCA
TCTTGGAATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGC
TGCTCATTATCTTCCCACACTTCTGCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)-45805411 - 830
Exon 38 To Exon 39 (Pair 49)
Forward (5418,23)CTTGTCATGTGCTAATCTGTTCAAmplicon SizecDNA: 112 bpgenomic: 3,116
Reverse (5529,22)CTTCCTTAGCATGGCGTTGAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.19 kcal/mol in 3' area
Forward Dimers-0.252 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-2.073 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceCTTGTCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGA
ATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1125418 - 5529
Exon 38 To Exon 39 (Pair 50)
Forward (5463,24)CACCTTCATCTTGGAATTATTTGAAmplicon SizecDNA: 98 bpgenomic: 3,102
Reverse (5560,20)CCAGGCAGAAGTGTGGGAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.936 kcal/mol
Reverse Loops1.144 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.844 kcal/mol
Amplicon Folding0.289 kcal/mol outside primersite
Amplicon SequenceCACCTTCATCTTGGAATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCT
AAGGAAGCTGCTCATTATCTTCCCACACTTCTGCCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)-46325463 - 830
Exon 38 To Exon 39 (Pair 51)
Forward (5375,22)CAGCATCCTTCCTGTTTGATGTAmplicon SizecDNA: 183 bpgenomic: 3,187
Reverse (5557,22)GGCAGAAGTGTGGGAAGATAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.459 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.912 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-2.674 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTGCTAATC
TGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGAATAACT
GGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGCTCATTATCTTCCCACACTTCT
GCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)-45445375 - 830
Exon 38 To Exon 39 (Pair 52)
Forward (5416,22)GCCTTGTCATGTGCTAATCTGTAmplicon SizecDNA: 117 bpgenomic: 3,121
Reverse (5532,21)CAGCTTCCTTAGCATGGCGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.258 kcal/mol
Forward Dimers-0.252 kcal/mol
Reverse Loops0.254 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.073 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceGCCTTGTCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTG
GAATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1175416 - 5532
Exon 38 To Exon 39 (Pair 53)
Forward (5426,22)GTGCTAATCTGTTCATCGGGATAmplicon SizecDNA: 128 bpgenomic: 3,132
Reverse (5553,22)GAAGTGTGGGAAGATAATGAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol in 3' area
Forward Dimers-0.136 kcal/mol
Reverse Loops3.394 kcal/mol
Reverse Dimers-0.046 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTG
AGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGCTCATTATCTTCC
CACACTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)-45965426 - 829
Exon 38 To Exon 39 (Pair 54)
Forward (5366,21)TGATGTACCCAGCATCCTTCCAmplicon SizecDNA: 193 bpgenomic: 3,197
Reverse (5558,22)AGGCAGAAGTGTGGGAAGATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.31 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.912 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-2.936 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceTGATGTACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCAT
GTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTG
AGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGCTCATTATCTTCC
CACACTTCTGCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)-45355366 - 830
Exon 38 To Exon 39 (Pair 55)
Forward (5375,22)CAGCATCCTTCCTGTTTGATGTAmplicon SizecDNA: 153 bpgenomic: 3,157
Reverse (5527,22)TCCTTAGCATGGCGTTGAATCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.459 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-1.043 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTGCTAATC
TGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGAATAACT
GGACACTGCTCAGATTCAACGCCATGCTAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1535375 - 5527
Exon 38 To Exon 39 (Pair 56)
Forward (5368,21)ATGTACCCAGCATCCTTCCTGAmplicon SizecDNA: 160 bpgenomic: 3,164
Reverse (5527,22)TCCTTAGCATGGCGTTGAATCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.873 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-1.043 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceATGTACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGT
GCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAG
AATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1605368 - 5527
Exon 38 To Exon 39 (Pair 57)
Forward (5423,22)CATGTGCTAATCTGTTCATCGGAmplicon SizecDNA: 138 bpgenomic: 3,142
Reverse (5560,20)CCAGGCAGAAGTGTGGGAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.976 kcal/mol in 3' area
Forward Dimers-0.136 kcal/mol
Reverse Loops1.144 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.403 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTAT
TTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGCTCATTATCT
TCCCACACTTCTGCCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)-45925423 - 830
Exon 38 To Exon 39 (Pair 58)
Forward (5420,23)TGTCATGTGCTAATCTGTTCATCAmplicon SizecDNA: 113 bpgenomic: 3,117
Reverse (5532,21)CAGCTTCCTTAGCATGGCGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.976 kcal/mol in 3' area
Forward Dimers-0.252 kcal/mol
Reverse Loops0.254 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.073 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceTGTCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAAT
TATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1135420 - 5532
Exon 38 To Exon 39 (Pair 59)
Forward (5376,22)AGCATCCTTCCTGTTTGATGTCAmplicon SizecDNA: 178 bpgenomic: 3,182
Reverse (5553,22)GAAGTGTGGGAAGATAATGAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.417 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops3.394 kcal/mol
Reverse Dimers-0.046 kcal/mol
Forward-Reverse Dimers-2.674 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTGCTAATCT
GTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGAATAACTG
GACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGCTCATTATCTTCCCACACTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)-45465376 - 829
Exon 38 To Exon 39 (Pair 60)
Forward (5368,21)ATGTACCCAGCATCCTTCCTGAmplicon SizecDNA: 191 bpgenomic: 3,195
Reverse (5558,22)AGGCAGAAGTGTGGGAAGATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.873 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.912 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-2.936 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceATGTACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGT
GCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAG
AATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGCTCATTATCTTCCCA
CACTTCTGCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)-45375368 - 830
Exon 38 To Exon 39 (Pair 61)
Forward (5368,21)ATGTACCCAGCATCCTTCCTGAmplicon SizecDNA: 190 bpgenomic: 3,194
Reverse (5557,22)GGCAGAAGTGTGGGAAGATAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.873 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.912 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-2.936 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceATGTACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGT
GCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAG
AATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGCTCATTATCTTCCCA
CACTTCTGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)-45375368 - 830
Exon 38 To Exon 39 (Pair 62)
Forward (5416,22)GCCTTGTCATGTGCTAATCTGTAmplicon SizecDNA: 113 bpgenomic: 3,117
Reverse (5528,22)TTCCTTAGCATGGCGTTGAATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.258 kcal/mol
Forward Dimers-0.252 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-2.073 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceGCCTTGTCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTG
GAATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1135416 - 5528
Exon 38 To Exon 39 (Pair 63)
Forward (5369,21)TGTACCCAGCATCCTTCCTGTAmplicon SizecDNA: 164 bpgenomic: 3,168
Reverse (5532,21)CAGCTTCCTTAGCATGGCGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.459 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.254 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceTGTACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTG
CTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGA
ATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1645369 - 5532
Exon 38 To Exon 39 (Pair 64)
Forward (5424,22)ATGTGCTAATCTGTTCATCGGGAmplicon SizecDNA: 130 bpgenomic: 3,134
Reverse (5553,22)GAAGTGTGGGAAGATAATGAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.19 kcal/mol
Forward Dimers-0.136 kcal/mol
Reverse Loops3.394 kcal/mol
Reverse Dimers-0.046 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATT
TGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGCTCATTATCTT
CCCACACTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)-45945424 - 829
Exon 38 To Exon 39 (Pair 65)
Forward (5462,24)TCACCTTCATCTTGGAATTATTTGAmplicon SizecDNA: 103 bpgenomic: 3,107
Reverse (5564,19)CGGCCCAGGCAGAAGTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.936 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-2.28 kcal/mol
Forward-Reverse Dimers-1.844 kcal/mol
Amplicon Folding0.289 kcal/mol outside primersite
Amplicon SequenceTCACCTTCATCTTGGAATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGC
TAAGGAAGCTGCTCATTATCTTCCCACACTTCTGCCTGGGCCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1035462 - 5564
Exon 38 To Exon 39 (Pair 66)
Forward (5414,22)TGGCCTTGTCATGTGCTAATCTAmplicon SizecDNA: 120 bpgenomic: 3,124
Reverse (5533,20)GCAGCTTCCTTAGCATGGCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.803 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops0.254 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.073 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceTGGCCTTGTCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCT
TGGAATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1205414 - 5533
Exon 38 To Exon 39 (Pair 67)
Forward (5375,22)CAGCATCCTTCCTGTTTGATGTAmplicon SizecDNA: 190 bpgenomic: 3,194
Reverse (5564,19)CGGCCCAGGCAGAAGTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.459 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-2.28 kcal/mol
Forward-Reverse Dimers-1.642 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTGCTAATC
TGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGAATAACT
GGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGCTCATTATCTTCCCACACTTCT
GCCTGGGCCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1905375 - 5564
Exon 38 To Exon 39 (Pair 68)
Forward (5367,21)GATGTACCCAGCATCCTTCCTAmplicon SizecDNA: 161 bpgenomic: 3,165
Reverse (5527,22)TCCTTAGCATGGCGTTGAATCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.31 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-1.043 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceGATGTACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATG
TGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGA
GAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1615367 - 5527
Exon 38 To Exon 39 (Pair 69)
Forward (5410,22)TATGTGGCCTTGTCATGTGCTAAmplicon SizecDNA: 149 bpgenomic: 3,153
Reverse (5558,22)AGGCAGAAGTGTGGGAAGATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.803 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops1.912 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-2.966 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceTATGTGGCCTTGTCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTC
ATCTTGGAATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAG
CTGCTCATTATCTTCCCACACTTCTGCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)-45795410 - 830
Exon 38 To Exon 39 (Pair 70)
Forward (5372,21)ACCCAGCATCCTTCCTGTTTGAmplicon SizecDNA: 161 bpgenomic: 3,165
Reverse (5532,21)CAGCTTCCTTAGCATGGCGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.459 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.254 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTGCTA
ATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGAATA
ACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1615372 - 5532
Exon 38 To Exon 39 (Pair 71)
Forward (5414,22)TGGCCTTGTCATGTGCTAATCTAmplicon SizecDNA: 116 bpgenomic: 3,120
Reverse (5529,22)CTTCCTTAGCATGGCGTTGAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.803 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-2.073 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceTGGCCTTGTCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCT
TGGAATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1165414 - 5529
Exon 38 To Exon 39 (Pair 72)
Forward (5376,22)AGCATCCTTCCTGTTTGATGTCAmplicon SizecDNA: 157 bpgenomic: 3,161
Reverse (5532,21)CAGCTTCCTTAGCATGGCGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.417 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.254 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-1.662 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTGCTAATCT
GTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGAATAACTG
GACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1575376 - 5532
Exon 38 To Exon 39 (Pair 73)
Forward (5409,21)CTATGTGGCCTTGTCATGTGCAmplicon SizecDNA: 121 bpgenomic: 3,125
Reverse (5529,22)CTTCCTTAGCATGGCGTTGAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.803 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-1.598 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceCTATGTGGCCTTGTCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTT
CATCTTGGAATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAA
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1215409 - 5529
Exon 38 To Exon 39 (Pair 74)
Forward (5366,21)TGATGTACCCAGCATCCTTCCAmplicon SizecDNA: 163 bpgenomic: 3,167
Reverse (5528,22)TTCCTTAGCATGGCGTTGAATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.31 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-1.043 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceTGATGTACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCAT
GTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTG
AGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1635366 - 5528
Exon 38 To Exon 39 (Pair 75)
Forward (5418,23)CTTGTCATGTGCTAATCTGTTCAAmplicon SizecDNA: 113 bpgenomic: 3,117
Reverse (5530,21)GCTTCCTTAGCATGGCGTTGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.19 kcal/mol in 3' area
Forward Dimers-0.252 kcal/mol
Reverse Loops0.581 kcal/mol
Reverse Dimers-1.106 kcal/mol
Forward-Reverse Dimers-2.073 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceCTTGTCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGA
ATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1135418 - 5530
Exon 38 To Exon 39 (Pair 76)
Forward (5409,21)CTATGTGGCCTTGTCATGTGCAmplicon SizecDNA: 122 bpgenomic: 3,126
Reverse (5530,21)GCTTCCTTAGCATGGCGTTGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.803 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops0.581 kcal/mol
Reverse Dimers-1.106 kcal/mol
Forward-Reverse Dimers-1.598 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceCTATGTGGCCTTGTCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTT
CATCTTGGAATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAA
GC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1225409 - 5530
Exon 38 To Exon 39 (Pair 77)
Forward (5372,21)ACCCAGCATCCTTCCTGTTTGAmplicon SizecDNA: 157 bpgenomic: 3,161
Reverse (5528,22)TTCCTTAGCATGGCGTTGAATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.459 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-1.043 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTGCTA
ATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGAATA
ACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1575372 - 5528
Exon 38 To Exon 39 (Pair 78)
Forward (5423,22)CATGTGCTAATCTGTTCATCGGAmplicon SizecDNA: 106 bpgenomic: 3,110
Reverse (5528,22)TTCCTTAGCATGGCGTTGAATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.976 kcal/mol in 3' area
Forward Dimers-0.136 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-2.073 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTAT
TTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1065423 - 5528
Exon 38 To Exon 39 (Pair 79)
Forward (5370,21)GTACCCAGCATCCTTCCTGTTAmplicon SizecDNA: 162 bpgenomic: 3,166
Reverse (5531,21)AGCTTCCTTAGCATGGCGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.459 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.254 kcal/mol
Reverse Dimers-1.822 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceGTACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTGC
TAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGAA
TAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1625370 - 5531
Exon 38 To Exon 39 (Pair 80)
Forward (5418,23)CTTGTCATGTGCTAATCTGTTCAAmplicon SizecDNA: 114 bpgenomic: 3,118
Reverse (5531,21)AGCTTCCTTAGCATGGCGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.19 kcal/mol in 3' area
Forward Dimers-0.252 kcal/mol
Reverse Loops0.254 kcal/mol
Reverse Dimers-1.822 kcal/mol
Forward-Reverse Dimers-2.073 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceCTTGTCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGA
ATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1145418 - 5531
Exon 38 To Exon 39 (Pair 81)
Forward (5367,21)GATGTACCCAGCATCCTTCCTAmplicon SizecDNA: 165 bpgenomic: 3,169
Reverse (5531,21)AGCTTCCTTAGCATGGCGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.31 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.254 kcal/mol
Reverse Dimers-1.822 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceGATGTACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATG
TGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGA
GAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1655367 - 5531
Exon 38 To Exon 39 (Pair 82)
Forward (5423,22)CATGTGCTAATCTGTTCATCGGAmplicon SizecDNA: 105 bpgenomic: 3,109
Reverse (5527,22)TCCTTAGCATGGCGTTGAATCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.976 kcal/mol in 3' area
Forward Dimers-0.136 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-2.073 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTAT
TTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1055423 - 5527
Exon 38 To Exon 39 (Pair 83)
Forward (5423,22)CATGTGCTAATCTGTTCATCGGAmplicon SizecDNA: 111 bpgenomic: 3,115
Reverse (5533,20)GCAGCTTCCTTAGCATGGCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.976 kcal/mol in 3' area
Forward Dimers-0.136 kcal/mol
Reverse Loops0.254 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.073 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTAT
TTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1115423 - 5533
Exon 38 To Exon 39 (Pair 84)
Forward (5426,22)GTGCTAATCTGTTCATCGGGATAmplicon SizecDNA: 108 bpgenomic: 3,112
Reverse (5533,20)GCAGCTTCCTTAGCATGGCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol in 3' area
Forward Dimers-0.136 kcal/mol
Reverse Loops0.254 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.073 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTG
AGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1085426 - 5533
Exon 38 To Exon 39 (Pair 85)
Forward (5370,21)GTACCCAGCATCCTTCCTGTTAmplicon SizecDNA: 160 bpgenomic: 3,164
Reverse (5529,22)CTTCCTTAGCATGGCGTTGAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.459 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-1.043 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceGTACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTGC
TAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGAA
TAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1605370 - 5529
Exon 38 To Exon 39 (Pair 86)
Forward (5376,22)AGCATCCTTCCTGTTTGATGTCAmplicon SizecDNA: 152 bpgenomic: 3,156
Reverse (5527,22)TCCTTAGCATGGCGTTGAATCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.417 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-1.043 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGTGCTAATCT
GTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAGAATAACTG
GACACTGCTCAGATTCAACGCCATGCTAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1525376 - 5527
Exon 38 To Exon 39 (Pair 87)
Forward (5410,22)TATGTGGCCTTGTCATGTGCTAAmplicon SizecDNA: 148 bpgenomic: 3,152
Reverse (5557,22)GGCAGAAGTGTGGGAAGATAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.803 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops1.912 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.749 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceTATGTGGCCTTGTCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTC
ATCTTGGAATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAG
CTGCTCATTATCTTCCCACACTTCTGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)-45795410 - 830
Exon 38 To Exon 39 (Pair 88)
Forward (5420,23)TGTCATGTGCTAATCTGTTCATCAmplicon SizecDNA: 109 bpgenomic: 3,113
Reverse (5528,22)TTCCTTAGCATGGCGTTGAATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.976 kcal/mol in 3' area
Forward Dimers-0.252 kcal/mol
Reverse Loops1.797 kcal/mol
Reverse Dimers-0.691 kcal/mol
Forward-Reverse Dimers-2.073 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceTGTCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAAT
TATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1095420 - 5528
Exon 38 To Exon 39 (Pair 89)
Forward (5368,21)ATGTACCCAGCATCCTTCCTGAmplicon SizecDNA: 165 bpgenomic: 3,169
Reverse (5532,21)CAGCTTCCTTAGCATGGCGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.873 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.254 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-2.82 kcal/mol outside primersite
Amplicon SequenceATGTACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCCTTGTCATGT
GCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCTTCATCTTGGAATTATTTGAG
AATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGAAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)1655368 - 5532
Exon 38 To Exon 39 (Pair 90)
Forward (5408,21)CCTATGTGGCCTTGTCATGTGAmplicon SizecDNA: 150 bpgenomic: 3,154
Reverse (5557,22)GGCAGAAGTGTGGGAAGATAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.42 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops1.912 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.749 kcal/mol
Amplicon Folding-0.788 kcal/mol outside primersite
Amplicon SequenceCCTATGTGGCCTTGTCATGTGCTAATCTGTTCATCGGGATCAACAGCAGTGCCATCACCT
TCATCTTGGAATTATTTGAGAATAACTGGACACTGCTCAGATTCAACGCCATGCTAAGGA
AGCTGCTCATTATCTTCCCACACTTCTGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003360 (ABCA4)-45775408 - 830
 

See below for some more details.

Program Output:

Loading ...