Design Results for ADNP2

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 3 (Pair 12)
Forward (481,22)TTGACAACATCAGAAAGGTGCGAmplicon SizecDNA: 117 bpgenomic: 15,569
Reverse (597,23)AGTATTTCTCTCCTGGATCAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.229 kcal/mol in 3' area
Forward Dimers-0.268 kcal/mol
Reverse Loops1.659 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-1.8 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGCTTG
ACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)117481 - 597
Exon 2 To Exon 4 (Pair 22)
Forward (481,22)TTGACAACATCAGAAAGGTGCGAmplicon SizecDNA: 287 bpgenomic: 18,158
Reverse (767,23)CAGCTCTTGGTCAATTTCATCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.229 kcal/mol in 3' area
Forward Dimers-0.268 kcal/mol
Reverse Loops1.919 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.686 kcal/mol
Amplicon Folding-1.706 kcal/mol outside primersite
Amplicon SequenceTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGCTTG
ACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATACTTTC
ATAACACATCATGGGGTGATGTTTCTCTCTGGGAACCTTCTGGAAAGAAAGTGAGATATC
GAACAAAGCCATACTGTTGTGGCCTCTGTAAATACTCTACAAAGGTGCTTACTTCATTCA
AGAATCATTTACATCGTTACCATGAAGATGAAATTGACCAAGAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)287481 - 767
Exon 2 To Exon 4 (Pair 20)
Forward (476,24)AAATCTTGACAACATCAGAAAGGTAmplicon SizecDNA: 201 bpgenomic: 18,072
Reverse (676,23)CAGTATGGCTTTGTTCGATATCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.255 kcal/mol
Forward Dimers-0.517 kcal/mol
Reverse Loops1.07 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.502 kcal/mol
Amplicon Folding-1.634 kcal/mol outside primersite
Amplicon SequenceAAATCTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGG
GCTTGACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATA
CTTTCATAACACATCATGGGGTGATGTTTCTCTCTGGGAACCTTCTGGAAAGAAAGTGAG
ATATCGAACAAAGCCATACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)201476 - 676
Exon 2 To Exon 4 (Pair 21)
Forward (480,22)CTTGACAACATCAGAAAGGTGCAmplicon SizecDNA: 286 bpgenomic: 18,157
Reverse (765,23)GCTCTTGGTCAATTTCATCTTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.229 kcal/mol in 3' area
Forward Dimers-0.268 kcal/mol
Reverse Loops1.919 kcal/mol
Reverse Dimers-0.884 kcal/mol
Forward-Reverse Dimers-1.686 kcal/mol
Amplicon Folding-1.706 kcal/mol outside primersite
Amplicon SequenceCTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGCTT
GACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATACTTT
CATAACACATCATGGGGTGATGTTTCTCTCTGGGAACCTTCTGGAAAGAAAGTGAGATAT
CGAACAAAGCCATACTGTTGTGGCCTCTGTAAATACTCTACAAAGGTGCTTACTTCATTC
AAGAATCATTTACATCGTTACCATGAAGATGAAATTGACCAAGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)286480 - 765
Exon 2 To Exon 4 (Pair 19)
Forward (481,22)TTGACAACATCAGAAAGGTGCGAmplicon SizecDNA: 285 bpgenomic: 18,156
Reverse (765,23)GCTCTTGGTCAATTTCATCTTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.229 kcal/mol in 3' area
Forward Dimers-0.268 kcal/mol
Reverse Loops1.919 kcal/mol
Reverse Dimers-0.884 kcal/mol
Forward-Reverse Dimers-1.686 kcal/mol
Amplicon Folding-1.706 kcal/mol outside primersite
Amplicon SequenceTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGCTTG
ACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATACTTTC
ATAACACATCATGGGGTGATGTTTCTCTCTGGGAACCTTCTGGAAAGAAAGTGAGATATC
GAACAAAGCCATACTGTTGTGGCCTCTGTAAATACTCTACAAAGGTGCTTACTTCATTCA
AGAATCATTTACATCGTTACCATGAAGATGAAATTGACCAAGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)285481 - 765
Exon 2 To Exon 4 (Pair 18)
Forward (480,22)CTTGACAACATCAGAAAGGTGCAmplicon SizecDNA: 289 bpgenomic: 18,160
Reverse (768,22)CCAGCTCTTGGTCAATTTCATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.229 kcal/mol in 3' area
Forward Dimers-0.268 kcal/mol
Reverse Loops0.971 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.686 kcal/mol
Amplicon Folding-1.706 kcal/mol outside primersite
Amplicon SequenceCTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGCTT
GACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATACTTT
CATAACACATCATGGGGTGATGTTTCTCTCTGGGAACCTTCTGGAAAGAAAGTGAGATAT
CGAACAAAGCCATACTGTTGTGGCCTCTGTAAATACTCTACAAAGGTGCTTACTTCATTC
AAGAATCATTTACATCGTTACCATGAAGATGAAATTGACCAAGAGCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)289480 - 768
Exon 2 To Exon 4 (Pair 17)
Forward (476,24)AAATCTTGACAACATCAGAAAGGTAmplicon SizecDNA: 287 bpgenomic: 18,158
Reverse (762,23)CTTGGTCAATTTCATCTTCATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.255 kcal/mol
Forward Dimers-0.517 kcal/mol
Reverse Loops1.863 kcal/mol in 3' area
Reverse Dimers-0.884 kcal/mol
Forward-Reverse Dimers-1.686 kcal/mol
Amplicon Folding-1.706 kcal/mol outside primersite
Amplicon SequenceAAATCTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGG
GCTTGACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATA
CTTTCATAACACATCATGGGGTGATGTTTCTCTCTGGGAACCTTCTGGAAAGAAAGTGAG
ATATCGAACAAAGCCATACTGTTGTGGCCTCTGTAAATACTCTACAAAGGTGCTTACTTC
ATTCAAGAATCATTTACATCGTTACCATGAAGATGAAATTGACCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)287476 - 762
Exon 2 To Exon 4 (Pair 16)
Forward (480,22)CTTGACAACATCAGAAAGGTGCAmplicon SizecDNA: 288 bpgenomic: 18,159
Reverse (767,23)CAGCTCTTGGTCAATTTCATCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.229 kcal/mol in 3' area
Forward Dimers-0.268 kcal/mol
Reverse Loops1.919 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.686 kcal/mol
Amplicon Folding-1.706 kcal/mol outside primersite
Amplicon SequenceCTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGCTT
GACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATACTTT
CATAACACATCATGGGGTGATGTTTCTCTCTGGGAACCTTCTGGAAAGAAAGTGAGATAT
CGAACAAAGCCATACTGTTGTGGCCTCTGTAAATACTCTACAAAGGTGCTTACTTCATTC
AAGAATCATTTACATCGTTACCATGAAGATGAAATTGACCAAGAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)288480 - 767
Exon 2 To Exon 3 (Pair 11)
Forward (480,22)CTTGACAACATCAGAAAGGTGCAmplicon SizecDNA: 115 bpgenomic: 15,567
Reverse (594,22)ATTTCTCTCCTGGATCAAAGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.229 kcal/mol in 3' area
Forward Dimers-0.268 kcal/mol
Reverse Loops1.9 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-1.8 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceCTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGCTT
GACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)115480 - 594
Exon 2 To Exon 3 (Pair 10)
Forward (481,22)TTGACAACATCAGAAAGGTGCGAmplicon SizecDNA: 113 bpgenomic: 15,565
Reverse (593,22)TTTCTCTCCTGGATCAAAGCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.229 kcal/mol in 3' area
Forward Dimers-0.268 kcal/mol
Reverse Loops1.9 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-1.499 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGCTTG
ACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)113481 - 593
Exon 2 To Exon 4 (Pair 15)
Forward (478,23)ATCTTGACAACATCAGAAAGGTGAmplicon SizecDNA: 290 bpgenomic: 18,161
Reverse (767,23)CAGCTCTTGGTCAATTTCATCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.255 kcal/mol
Forward Dimers-0.517 kcal/mol
Reverse Loops1.919 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.686 kcal/mol
Amplicon Folding-1.706 kcal/mol outside primersite
Amplicon SequenceATCTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGC
TTGACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATACT
TTCATAACACATCATGGGGTGATGTTTCTCTCTGGGAACCTTCTGGAAAGAAAGTGAGAT
ATCGAACAAAGCCATACTGTTGTGGCCTCTGTAAATACTCTACAAAGGTGCTTACTTCAT
TCAAGAATCATTTACATCGTTACCATGAAGATGAAATTGACCAAGAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 14)
Forward (478,23)ATCTTGACAACATCAGAAAGGTGAmplicon SizecDNA: 288 bpgenomic: 18,159
Reverse (765,23)GCTCTTGGTCAATTTCATCTTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.255 kcal/mol
Forward Dimers-0.517 kcal/mol
Reverse Loops1.919 kcal/mol
Reverse Dimers-0.884 kcal/mol
Forward-Reverse Dimers-1.686 kcal/mol
Amplicon Folding-1.706 kcal/mol outside primersite
Amplicon SequenceATCTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGC
TTGACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATACT
TTCATAACACATCATGGGGTGATGTTTCTCTCTGGGAACCTTCTGGAAAGAAAGTGAGAT
ATCGAACAAAGCCATACTGTTGTGGCCTCTGTAAATACTCTACAAAGGTGCTTACTTCAT
TCAAGAATCATTTACATCGTTACCATGAAGATGAAATTGACCAAGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)288478 - 765
Exon 2 To Exon 4 (Pair 13)
Forward (476,24)AAATCTTGACAACATCAGAAAGGTAmplicon SizecDNA: 292 bpgenomic: 18,163
Reverse (767,23)CAGCTCTTGGTCAATTTCATCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.255 kcal/mol
Forward Dimers-0.517 kcal/mol
Reverse Loops1.919 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.686 kcal/mol
Amplicon Folding-1.706 kcal/mol outside primersite
Amplicon SequenceAAATCTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGG
GCTTGACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATA
CTTTCATAACACATCATGGGGTGATGTTTCTCTCTGGGAACCTTCTGGAAAGAAAGTGAG
ATATCGAACAAAGCCATACTGTTGTGGCCTCTGTAAATACTCTACAAAGGTGCTTACTTC
ATTCAAGAATCATTTACATCGTTACCATGAAGATGAAATTGACCAAGAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)292476 - 767
Exon 2 To Exon 4 (Pair 12)
Forward (476,24)AAATCTTGACAACATCAGAAAGGTAmplicon SizecDNA: 202 bpgenomic: 18,073
Reverse (677,23)ACAGTATGGCTTTGTTCGATATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.255 kcal/mol
Forward Dimers-0.517 kcal/mol
Reverse Loops1.063 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.502 kcal/mol
Amplicon Folding-1.634 kcal/mol outside primersite
Amplicon SequenceAAATCTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGG
GCTTGACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATA
CTTTCATAACACATCATGGGGTGATGTTTCTCTCTGGGAACCTTCTGGAAAGAAAGTGAG
ATATCGAACAAAGCCATACTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)202476 - 677
Exon 2 To Exon 3 (Pair 9)
Forward (481,22)TTGACAACATCAGAAAGGTGCGAmplicon SizecDNA: 126 bpgenomic: 15,578
Reverse (606,24)TGTTATGAAAGTATTTCTCTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.229 kcal/mol in 3' area
Forward Dimers-0.268 kcal/mol
Reverse Loops0.58 kcal/mol
Reverse Dimers0.069 kcal/mol
Forward-Reverse Dimers-1.8 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGCTTG
ACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATACTTTC
ATAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)126481 - 606
Exon 2 To Exon 4 (Pair 11)
Forward (476,24)AAATCTTGACAACATCAGAAAGGTAmplicon SizecDNA: 293 bpgenomic: 18,164
Reverse (768,22)CCAGCTCTTGGTCAATTTCATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.255 kcal/mol
Forward Dimers-0.517 kcal/mol
Reverse Loops0.971 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.686 kcal/mol
Amplicon Folding-1.706 kcal/mol outside primersite
Amplicon SequenceAAATCTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGG
GCTTGACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATA
CTTTCATAACACATCATGGGGTGATGTTTCTCTCTGGGAACCTTCTGGAAAGAAAGTGAG
ATATCGAACAAAGCCATACTGTTGTGGCCTCTGTAAATACTCTACAAAGGTGCTTACTTC
ATTCAAGAATCATTTACATCGTTACCATGAAGATGAAATTGACCAAGAGCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)293476 - 768
Exon 2 To Exon 4 (Pair 10)
Forward (481,22)TTGACAACATCAGAAAGGTGCGAmplicon SizecDNA: 288 bpgenomic: 18,159
Reverse (768,22)CCAGCTCTTGGTCAATTTCATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.229 kcal/mol in 3' area
Forward Dimers-0.268 kcal/mol
Reverse Loops0.971 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.686 kcal/mol
Amplicon Folding-1.706 kcal/mol outside primersite
Amplicon SequenceTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGCTTG
ACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATACTTTC
ATAACACATCATGGGGTGATGTTTCTCTCTGGGAACCTTCTGGAAAGAAAGTGAGATATC
GAACAAAGCCATACTGTTGTGGCCTCTGTAAATACTCTACAAAGGTGCTTACTTCATTCA
AGAATCATTTACATCGTTACCATGAAGATGAAATTGACCAAGAGCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)288481 - 768
Exon 2 To Exon 4 (Pair 9)
Forward (480,22)CTTGACAACATCAGAAAGGTGCAmplicon SizecDNA: 287 bpgenomic: 18,158
Reverse (766,23)AGCTCTTGGTCAATTTCATCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.229 kcal/mol in 3' area
Forward Dimers-0.268 kcal/mol
Reverse Loops1.919 kcal/mol in 3' area
Reverse Dimers-1.83 kcal/mol
Forward-Reverse Dimers-1.686 kcal/mol
Amplicon Folding-1.706 kcal/mol outside primersite
Amplicon SequenceCTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGCTT
GACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATACTTT
CATAACACATCATGGGGTGATGTTTCTCTCTGGGAACCTTCTGGAAAGAAAGTGAGATAT
CGAACAAAGCCATACTGTTGTGGCCTCTGTAAATACTCTACAAAGGTGCTTACTTCATTC
AAGAATCATTTACATCGTTACCATGAAGATGAAATTGACCAAGAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)287480 - 766
Exon 2 To Exon 4 (Pair 8)
Forward (480,22)CTTGACAACATCAGAAAGGTGCAmplicon SizecDNA: 283 bpgenomic: 18,154
Reverse (762,23)CTTGGTCAATTTCATCTTCATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.229 kcal/mol in 3' area
Forward Dimers-0.268 kcal/mol
Reverse Loops1.863 kcal/mol in 3' area
Reverse Dimers-0.884 kcal/mol
Forward-Reverse Dimers-1.686 kcal/mol
Amplicon Folding-1.706 kcal/mol outside primersite
Amplicon SequenceCTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGCTT
GACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATACTTT
CATAACACATCATGGGGTGATGTTTCTCTCTGGGAACCTTCTGGAAAGAAAGTGAGATAT
CGAACAAAGCCATACTGTTGTGGCCTCTGTAAATACTCTACAAAGGTGCTTACTTCATTC
AAGAATCATTTACATCGTTACCATGAAGATGAAATTGACCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)283480 - 762
Exon 2 To Exon 3 (Pair 8)
Forward (480,22)CTTGACAACATCAGAAAGGTGCAmplicon SizecDNA: 127 bpgenomic: 15,579
Reverse (606,24)TGTTATGAAAGTATTTCTCTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.229 kcal/mol in 3' area
Forward Dimers-0.268 kcal/mol
Reverse Loops0.58 kcal/mol
Reverse Dimers0.069 kcal/mol
Forward-Reverse Dimers-1.8 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceCTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGCTT
GACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATACTTT
CATAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)127480 - 606
Exon 2 To Exon 3 (Pair 7)
Forward (480,22)CTTGACAACATCAGAAAGGTGCAmplicon SizecDNA: 120 bpgenomic: 15,572
Reverse (599,24)AAAGTATTTCTCTCCTGGATCAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.229 kcal/mol in 3' area
Forward Dimers-0.268 kcal/mol
Reverse Loops1.051 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-1.8 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceCTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGCTT
GACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATACTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)120480 - 599
Exon 2 To Exon 4 (Pair 7)
Forward (478,23)ATCTTGACAACATCAGAAAGGTGAmplicon SizecDNA: 285 bpgenomic: 18,156
Reverse (762,23)CTTGGTCAATTTCATCTTCATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.255 kcal/mol
Forward Dimers-0.517 kcal/mol
Reverse Loops1.863 kcal/mol in 3' area
Reverse Dimers-0.884 kcal/mol
Forward-Reverse Dimers-1.686 kcal/mol
Amplicon Folding-1.706 kcal/mol outside primersite
Amplicon SequenceATCTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGC
TTGACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATACT
TTCATAACACATCATGGGGTGATGTTTCTCTCTGGGAACCTTCTGGAAAGAAAGTGAGAT
ATCGAACAAAGCCATACTGTTGTGGCCTCTGTAAATACTCTACAAAGGTGCTTACTTCAT
TCAAGAATCATTTACATCGTTACCATGAAGATGAAATTGACCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)285478 - 762
Exon 2 To Exon 4 (Pair 6)
Forward (481,22)TTGACAACATCAGAAAGGTGCGAmplicon SizecDNA: 286 bpgenomic: 18,157
Reverse (766,23)AGCTCTTGGTCAATTTCATCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.229 kcal/mol in 3' area
Forward Dimers-0.268 kcal/mol
Reverse Loops1.919 kcal/mol in 3' area
Reverse Dimers-1.83 kcal/mol
Forward-Reverse Dimers-1.686 kcal/mol
Amplicon Folding-1.706 kcal/mol outside primersite
Amplicon SequenceTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGCTTG
ACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATACTTTC
ATAACACATCATGGGGTGATGTTTCTCTCTGGGAACCTTCTGGAAAGAAAGTGAGATATC
GAACAAAGCCATACTGTTGTGGCCTCTGTAAATACTCTACAAAGGTGCTTACTTCATTCA
AGAATCATTTACATCGTTACCATGAAGATGAAATTGACCAAGAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)286481 - 766
Exon 2 To Exon 3 (Pair 6)
Forward (480,22)CTTGACAACATCAGAAAGGTGCAmplicon SizecDNA: 114 bpgenomic: 15,566
Reverse (593,22)TTTCTCTCCTGGATCAAAGCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.229 kcal/mol in 3' area
Forward Dimers-0.268 kcal/mol
Reverse Loops1.9 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-1.499 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceCTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGCTT
GACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)114480 - 593
Exon 2 To Exon 4 (Pair 5)
Forward (476,24)AAATCTTGACAACATCAGAAAGGTAmplicon SizecDNA: 291 bpgenomic: 18,162
Reverse (766,23)AGCTCTTGGTCAATTTCATCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.255 kcal/mol
Forward Dimers-0.517 kcal/mol
Reverse Loops1.919 kcal/mol in 3' area
Reverse Dimers-1.83 kcal/mol
Forward-Reverse Dimers-1.686 kcal/mol
Amplicon Folding-1.706 kcal/mol outside primersite
Amplicon SequenceAAATCTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGG
GCTTGACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATA
CTTTCATAACACATCATGGGGTGATGTTTCTCTCTGGGAACCTTCTGGAAAGAAAGTGAG
ATATCGAACAAAGCCATACTGTTGTGGCCTCTGTAAATACTCTACAAAGGTGCTTACTTC
ATTCAAGAATCATTTACATCGTTACCATGAAGATGAAATTGACCAAGAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)291476 - 766
Exon 2 To Exon 3 (Pair 5)
Forward (481,22)TTGACAACATCAGAAAGGTGCGAmplicon SizecDNA: 119 bpgenomic: 15,571
Reverse (599,24)AAAGTATTTCTCTCCTGGATCAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.229 kcal/mol in 3' area
Forward Dimers-0.268 kcal/mol
Reverse Loops1.051 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-1.8 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGCTTG
ACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATACTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)119481 - 599
Exon 2 To Exon 4 (Pair 4)
Forward (478,23)ATCTTGACAACATCAGAAAGGTGAmplicon SizecDNA: 291 bpgenomic: 18,162
Reverse (768,22)CCAGCTCTTGGTCAATTTCATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.255 kcal/mol
Forward Dimers-0.517 kcal/mol
Reverse Loops0.971 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.686 kcal/mol
Amplicon Folding-1.706 kcal/mol outside primersite
Amplicon SequenceATCTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGC
TTGACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATACT
TTCATAACACATCATGGGGTGATGTTTCTCTCTGGGAACCTTCTGGAAAGAAAGTGAGAT
ATCGAACAAAGCCATACTGTTGTGGCCTCTGTAAATACTCTACAAAGGTGCTTACTTCAT
TCAAGAATCATTTACATCGTTACCATGAAGATGAAATTGACCAAGAGCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)291478 - 768
Exon 2 To Exon 4 (Pair 3)
Forward (476,24)AAATCTTGACAACATCAGAAAGGTAmplicon SizecDNA: 290 bpgenomic: 18,161
Reverse (765,23)GCTCTTGGTCAATTTCATCTTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.255 kcal/mol
Forward Dimers-0.517 kcal/mol
Reverse Loops1.919 kcal/mol
Reverse Dimers-0.884 kcal/mol
Forward-Reverse Dimers-1.686 kcal/mol
Amplicon Folding-1.706 kcal/mol outside primersite
Amplicon SequenceAAATCTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGG
GCTTGACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATA
CTTTCATAACACATCATGGGGTGATGTTTCTCTCTGGGAACCTTCTGGAAAGAAAGTGAG
ATATCGAACAAAGCCATACTGTTGTGGCCTCTGTAAATACTCTACAAAGGTGCTTACTTC
ATTCAAGAATCATTTACATCGTTACCATGAAGATGAAATTGACCAAGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)290476 - 765
Exon 2 To Exon 3 (Pair 3)
Forward (480,22)CTTGACAACATCAGAAAGGTGCAmplicon SizecDNA: 118 bpgenomic: 15,570
Reverse (597,23)AGTATTTCTCTCCTGGATCAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.229 kcal/mol in 3' area
Forward Dimers-0.268 kcal/mol
Reverse Loops1.659 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-1.8 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceCTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGCTT
GACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)118480 - 597
Exon 2 To Exon 3 (Pair 4)
Forward (481,22)TTGACAACATCAGAAAGGTGCGAmplicon SizecDNA: 127 bpgenomic: 15,579
Reverse (607,24)GTGTTATGAAAGTATTTCTCTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.229 kcal/mol in 3' area
Forward Dimers-0.268 kcal/mol
Reverse Loops0.58 kcal/mol
Reverse Dimers0.069 kcal/mol
Forward-Reverse Dimers-1.8 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGCTTG
ACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATACTTTC
ATAACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)127481 - 607
Exon 2 To Exon 4 (Pair 2)
Forward (481,22)TTGACAACATCAGAAAGGTGCGAmplicon SizecDNA: 282 bpgenomic: 18,153
Reverse (762,23)CTTGGTCAATTTCATCTTCATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.229 kcal/mol in 3' area
Forward Dimers-0.268 kcal/mol
Reverse Loops1.863 kcal/mol in 3' area
Reverse Dimers-0.884 kcal/mol
Forward-Reverse Dimers-1.686 kcal/mol
Amplicon Folding-1.706 kcal/mol outside primersite
Amplicon SequenceTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGCTTG
ACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATACTTTC
ATAACACATCATGGGGTGATGTTTCTCTCTGGGAACCTTCTGGAAAGAAAGTGAGATATC
GAACAAAGCCATACTGTTGTGGCCTCTGTAAATACTCTACAAAGGTGCTTACTTCATTCA
AGAATCATTTACATCGTTACCATGAAGATGAAATTGACCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)282481 - 762
Exon 2 To Exon 4 (Pair 1)
Forward (478,23)ATCTTGACAACATCAGAAAGGTGAmplicon SizecDNA: 289 bpgenomic: 18,160
Reverse (766,23)AGCTCTTGGTCAATTTCATCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.255 kcal/mol
Forward Dimers-0.517 kcal/mol
Reverse Loops1.919 kcal/mol in 3' area
Reverse Dimers-1.83 kcal/mol
Forward-Reverse Dimers-1.686 kcal/mol
Amplicon Folding-1.706 kcal/mol outside primersite
Amplicon SequenceATCTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGC
TTGACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATACT
TTCATAACACATCATGGGGTGATGTTTCTCTCTGGGAACCTTCTGGAAAGAAAGTGAGAT
ATCGAACAAAGCCATACTGTTGTGGCCTCTGTAAATACTCTACAAAGGTGCTTACTTCAT
TCAAGAATCATTTACATCGTTACCATGAAGATGAAATTGACCAAGAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)289478 - 766
Exon 2 To Exon 3 (Pair 1)
Forward (480,22)CTTGACAACATCAGAAAGGTGCAmplicon SizecDNA: 128 bpgenomic: 15,580
Reverse (607,24)GTGTTATGAAAGTATTTCTCTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.229 kcal/mol in 3' area
Forward Dimers-0.268 kcal/mol
Reverse Loops0.58 kcal/mol
Reverse Dimers0.069 kcal/mol
Forward-Reverse Dimers-1.8 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceCTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGCTT
GACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAATACTTT
CATAACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)128480 - 607
Exon 2 To Exon 3 (Pair 2)
Forward (481,22)TTGACAACATCAGAAAGGTGCGAmplicon SizecDNA: 114 bpgenomic: 15,566
Reverse (594,22)ATTTCTCTCCTGGATCAAAGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.229 kcal/mol in 3' area
Forward Dimers-0.268 kcal/mol
Reverse Loops1.9 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-1.8 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceTTGACAACATCAGAAAGGTGCGAAAAAAGGTGAAAGGTATTCTTGTGGATATTGGGCTTG
ACAGCTGCAAGGAGTTACTGAAGGACCTTAAAGGCTTTGATCCAGGAGAGAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014913 (ADNP2)114481 - 594
 

See below for some more details.

Program Output:

Loading ...