Design Results for ALPL

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-2 Minimal dG for amplicon folding-2
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 6 To Exon 7 (Pair 1)
Forward (858,21)TGTAAGGACATCGCCTACCAGAmplicon SizecDNA: 127 bpgenomic: 4,014
Reverse (984,22)TGGCTTTCTCGTCACTCTCATANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.504 kcal/mol
Forward Dimers-1.821 kcal/mol
Reverse Loops2.482 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-1.506 kcal/mol
Amplicon Folding-0.825 kcal/mol outside primersite
Amplicon SequenceTGTAAGGACATCGCCTACCAGCTCATGCATAACATCAGGGACATTGACGTGATCATGGGG
GGTGGCCGGAAATACATGTACCCCAAGAATAAAACTGATGTGGAGTATGAGAGTGACGAG
AAAGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127501 (ALPL)127693 - 819
NM_001177520 (ALPL)127577 - 703
NM_000478 (ALPL)127858 - 984
Exon 6 To Exon 7 (Pair 2)
Forward (858,21)TGTAAGGACATCGCCTACCAGAmplicon SizecDNA: 124 bpgenomic: 4,011
Reverse (981,22)CTTTCTCGTCACTCTCATACTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.504 kcal/mol
Forward Dimers-1.821 kcal/mol
Reverse Loops3.202 kcal/mol in 3' area
Reverse Dimers0.132 kcal/mol in 3' area
Forward-Reverse Dimers-0.717 kcal/mol
Amplicon Folding-0.825 kcal/mol outside primersite
Amplicon SequenceTGTAAGGACATCGCCTACCAGCTCATGCATAACATCAGGGACATTGACGTGATCATGGGG
GGTGGCCGGAAATACATGTACCCCAAGAATAAAACTGATGTGGAGTATGAGAGTGACGAG
AAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127501 (ALPL)124693 - 816
NM_001177520 (ALPL)124577 - 700
NM_000478 (ALPL)124858 - 981
Exon 6 To Exon 7 (Pair 3)
Forward (858,21)TGTAAGGACATCGCCTACCAGAmplicon SizecDNA: 123 bpgenomic: 4,010
Reverse (980,22)TTTCTCGTCACTCTCATACTCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.504 kcal/mol
Forward Dimers-1.821 kcal/mol
Reverse Loops3.202 kcal/mol in 3' area
Reverse Dimers0.132 kcal/mol
Forward-Reverse Dimers-0.717 kcal/mol
Amplicon Folding-0.825 kcal/mol outside primersite
Amplicon SequenceTGTAAGGACATCGCCTACCAGCTCATGCATAACATCAGGGACATTGACGTGATCATGGGG
GGTGGCCGGAAATACATGTACCCCAAGAATAAAACTGATGTGGAGTATGAGAGTGACGAG
AAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127501 (ALPL)123693 - 815
NM_001177520 (ALPL)123577 - 699
NM_000478 (ALPL)123858 - 980
Exon 6 To Exon 7 (Pair 4)
Forward (860,21)TAAGGACATCGCCTACCAGCTAmplicon SizecDNA: 122 bpgenomic: 4,009
Reverse (981,22)CTTTCTCGTCACTCTCATACTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.504 kcal/mol
Forward Dimers-1.821 kcal/mol
Reverse Loops3.202 kcal/mol in 3' area
Reverse Dimers0.132 kcal/mol in 3' area
Forward-Reverse Dimers-0.717 kcal/mol
Amplicon Folding-0.825 kcal/mol outside primersite
Amplicon SequenceTAAGGACATCGCCTACCAGCTCATGCATAACATCAGGGACATTGACGTGATCATGGGGGG
TGGCCGGAAATACATGTACCCCAAGAATAAAACTGATGTGGAGTATGAGAGTGACGAGAA
AG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127501 (ALPL)122695 - 816
NM_001177520 (ALPL)122579 - 700
NM_000478 (ALPL)122860 - 981
Exon 6 To Exon 7 (Pair 5)
Forward (858,21)TGTAAGGACATCGCCTACCAGAmplicon SizecDNA: 125 bpgenomic: 4,012
Reverse (982,22)GCTTTCTCGTCACTCTCATACTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.504 kcal/mol
Forward Dimers-1.821 kcal/mol
Reverse Loops3.202 kcal/mol in 3' area
Reverse Dimers0.132 kcal/mol in 3' area
Forward-Reverse Dimers-0.717 kcal/mol
Amplicon Folding-0.825 kcal/mol outside primersite
Amplicon SequenceTGTAAGGACATCGCCTACCAGCTCATGCATAACATCAGGGACATTGACGTGATCATGGGG
GGTGGCCGGAAATACATGTACCCCAAGAATAAAACTGATGTGGAGTATGAGAGTGACGAG
AAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127501 (ALPL)125693 - 817
NM_001177520 (ALPL)125577 - 701
NM_000478 (ALPL)125858 - 982
Exon 6 To Exon 7 (Pair 6)
Forward (860,21)TAAGGACATCGCCTACCAGCTAmplicon SizecDNA: 121 bpgenomic: 4,008
Reverse (980,22)TTTCTCGTCACTCTCATACTCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.504 kcal/mol
Forward Dimers-1.821 kcal/mol
Reverse Loops3.202 kcal/mol in 3' area
Reverse Dimers0.132 kcal/mol
Forward-Reverse Dimers-0.717 kcal/mol
Amplicon Folding-0.825 kcal/mol outside primersite
Amplicon SequenceTAAGGACATCGCCTACCAGCTCATGCATAACATCAGGGACATTGACGTGATCATGGGGGG
TGGCCGGAAATACATGTACCCCAAGAATAAAACTGATGTGGAGTATGAGAGTGACGAGAA
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127501 (ALPL)121695 - 815
NM_000478 (ALPL)121860 - 980
NM_001177520 (ALPL)121579 - 699
 

See below for some more details.

Program Output:

Loading ...