Design Results for ALPL

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 4 (Pair 1)
Forward (297,22)CTTACTAACTCCTTAGTGCCAGAmplicon SizecDNA: 201 bpgenomic: 7,035
Reverse (497,20)GTTGTGGTGGAGCTGACCCTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.721 kcal/mol
Forward Dimers-0.979 kcal/mol
Reverse Loops1.691 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.923 kcal/mol
Amplicon Folding-2.332 kcal/mol outside primersite
Amplicon SequenceCTTACTAACTCCTTAGTGCCAGAGAAAGAGAAAGACCCCAAGTACTGGCGAGACCAAGCG
CAAGAGACACTGAAATATGCCCTGGAGCTTCAGAAGCTCAACACCAACGTGGCTAAGAAT
GTCATCATGTTCCTGGGAGATGGGATGGGTGTCTCCACAGTGACGGCTGCCCGCATCCTC
AAGGGTCAGCTCCACCACAAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000478 (ALPL)201297 - 497
Exon 2 To Exon 4 (Pair 2)
Forward (297,22)CTTACTAACTCCTTAGTGCCAGAmplicon SizecDNA: 198 bpgenomic: 7,032
Reverse (494,20)GTGGTGGAGCTGACCCTTGANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.721 kcal/mol
Forward Dimers-0.979 kcal/mol
Reverse Loops1.691 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.923 kcal/mol
Amplicon Folding-2.332 kcal/mol outside primersite
Amplicon SequenceCTTACTAACTCCTTAGTGCCAGAGAAAGAGAAAGACCCCAAGTACTGGCGAGACCAAGCG
CAAGAGACACTGAAATATGCCCTGGAGCTTCAGAAGCTCAACACCAACGTGGCTAAGAAT
GTCATCATGTTCCTGGGAGATGGGATGGGTGTCTCCACAGTGACGGCTGCCCGCATCCTC
AAGGGTCAGCTCCACCAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000478 (ALPL)198297 - 494
Exon 2 To Exon 4 (Pair 3)
Forward (297,22)CTTACTAACTCCTTAGTGCCAGAmplicon SizecDNA: 199 bpgenomic: 7,033
Reverse (495,20)TGTGGTGGAGCTGACCCTTGNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.721 kcal/mol
Forward Dimers-0.979 kcal/mol
Reverse Loops1.691 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.923 kcal/mol
Amplicon Folding-2.332 kcal/mol outside primersite
Amplicon SequenceCTTACTAACTCCTTAGTGCCAGAGAAAGAGAAAGACCCCAAGTACTGGCGAGACCAAGCG
CAAGAGACACTGAAATATGCCCTGGAGCTTCAGAAGCTCAACACCAACGTGGCTAAGAAT
GTCATCATGTTCCTGGGAGATGGGATGGGTGTCTCCACAGTGACGGCTGCCCGCATCCTC
AAGGGTCAGCTCCACCACA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000478 (ALPL)199297 - 495
Exon 2 To Exon 4 (Pair 4)
Forward (297,22)CTTACTAACTCCTTAGTGCCAGAmplicon SizecDNA: 197 bpgenomic: 7,031
Reverse (493,20)TGGTGGAGCTGACCCTTGAGNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.721 kcal/mol
Forward Dimers-0.979 kcal/mol
Reverse Loops1.691 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.923 kcal/mol
Amplicon Folding-2.332 kcal/mol outside primersite
Amplicon SequenceCTTACTAACTCCTTAGTGCCAGAGAAAGAGAAAGACCCCAAGTACTGGCGAGACCAAGCG
CAAGAGACACTGAAATATGCCCTGGAGCTTCAGAAGCTCAACACCAACGTGGCTAAGAAT
GTCATCATGTTCCTGGGAGATGGGATGGGTGTCTCCACAGTGACGGCTGCCCGCATCCTC
AAGGGTCAGCTCCACCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000478 (ALPL)197297 - 493
Exon 6 To Exon 7 (Pair 1)
Forward (860,21)TAAGGACATCGCCTACCAGCTAmplicon SizecDNA: 78 bpgenomic: 3,965
Reverse (937,21)TACATGTATTTCCGGCCACCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.504 kcal/mol
Forward Dimers-1.821 kcal/mol
Reverse Loops1.914 kcal/mol in 3' area
Reverse Dimers-2.91 kcal/mol
Forward-Reverse Dimers-2.248 kcal/mol
Amplicon Folding0.334 kcal/mol outside primersite
Amplicon SequenceTAAGGACATCGCCTACCAGCTCATGCATAACATCAGGGACATTGACGTGATCATGGGGGG
TGGCCGGAAATACATGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127501 (ALPL)78695 - 772
NM_001177520 (ALPL)78579 - 656
NM_000478 (ALPL)78860 - 937
Exon 6 To Exon 7 (Pair 2)
Forward (860,21)TAAGGACATCGCCTACCAGCTAmplicon SizecDNA: 121 bpgenomic: 4,008
Reverse (980,22)TTTCTCGTCACTCTCATACTCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.504 kcal/mol
Forward Dimers-1.821 kcal/mol
Reverse Loops3.202 kcal/mol in 3' area
Reverse Dimers0.132 kcal/mol
Forward-Reverse Dimers-0.717 kcal/mol
Amplicon Folding-0.825 kcal/mol outside primersite
Amplicon SequenceTAAGGACATCGCCTACCAGCTCATGCATAACATCAGGGACATTGACGTGATCATGGGGGG
TGGCCGGAAATACATGTACCCCAAGAATAAAACTGATGTGGAGTATGAGAGTGACGAGAA
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127501 (ALPL)121695 - 815
NM_001177520 (ALPL)121579 - 699
NM_000478 (ALPL)121860 - 980
Exon 6 To Exon 7 (Pair 3)
Forward (858,21)TGTAAGGACATCGCCTACCAGAmplicon SizecDNA: 80 bpgenomic: 3,967
Reverse (937,21)TACATGTATTTCCGGCCACCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.504 kcal/mol
Forward Dimers-1.821 kcal/mol
Reverse Loops1.914 kcal/mol in 3' area
Reverse Dimers-2.91 kcal/mol
Forward-Reverse Dimers-2.248 kcal/mol
Amplicon Folding0.334 kcal/mol outside primersite
Amplicon SequenceTGTAAGGACATCGCCTACCAGCTCATGCATAACATCAGGGACATTGACGTGATCATGGGG
GGTGGCCGGAAATACATGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127501 (ALPL)80693 - 772
NM_001177520 (ALPL)80577 - 656
NM_000478 (ALPL)80858 - 937
Exon 6 To Exon 7 (Pair 4)
Forward (860,21)TAAGGACATCGCCTACCAGCTAmplicon SizecDNA: 80 bpgenomic: 3,967
Reverse (939,21)GGTACATGTATTTCCGGCCACNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.504 kcal/mol
Forward Dimers-1.821 kcal/mol
Reverse Loops2.35 kcal/mol
Reverse Dimers-2.91 kcal/mol
Forward-Reverse Dimers-2.248 kcal/mol
Amplicon Folding0.334 kcal/mol outside primersite
Amplicon SequenceTAAGGACATCGCCTACCAGCTCATGCATAACATCAGGGACATTGACGTGATCATGGGGGG
TGGCCGGAAATACATGTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)80860 - 939
NM_001127501 (ALPL)80695 - 774
NM_001177520 (ALPL)80579 - 658
Exon 6 To Exon 7 (Pair 5)
Forward (858,21)TGTAAGGACATCGCCTACCAGAmplicon SizecDNA: 83 bpgenomic: 3,970
Reverse (940,21)GGGTACATGTATTTCCGGCCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.504 kcal/mol
Forward Dimers-1.821 kcal/mol
Reverse Loops2.086 kcal/mol in 3' area
Reverse Dimers-2.91 kcal/mol
Forward-Reverse Dimers-2.248 kcal/mol
Amplicon Folding0.334 kcal/mol outside primersite
Amplicon SequenceTGTAAGGACATCGCCTACCAGCTCATGCATAACATCAGGGACATTGACGTGATCATGGGG
GGTGGCCGGAAATACATGTACCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)83858 - 940
NM_001127501 (ALPL)83693 - 775
NM_001177520 (ALPL)83577 - 659
Exon 6 To Exon 7 (Pair 6)
Forward (860,21)TAAGGACATCGCCTACCAGCTAmplicon SizecDNA: 81 bpgenomic: 3,968
Reverse (940,21)GGGTACATGTATTTCCGGCCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.504 kcal/mol
Forward Dimers-1.821 kcal/mol
Reverse Loops2.086 kcal/mol in 3' area
Reverse Dimers-2.91 kcal/mol
Forward-Reverse Dimers-2.248 kcal/mol
Amplicon Folding0.334 kcal/mol outside primersite
Amplicon SequenceTAAGGACATCGCCTACCAGCTCATGCATAACATCAGGGACATTGACGTGATCATGGGGGG
TGGCCGGAAATACATGTACCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)81860 - 940
NM_001127501 (ALPL)81695 - 775
NM_001177520 (ALPL)81579 - 659
Exon 6 To Exon 7 (Pair 7)
Forward (860,21)TAAGGACATCGCCTACCAGCTAmplicon SizecDNA: 128 bpgenomic: 4,015
Reverse (987,20)CCCTGGCTTTCTCGTCACTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.504 kcal/mol
Forward Dimers-1.821 kcal/mol
Reverse Loops2.482 kcal/mol in 3' area
Reverse Dimers-0.404 kcal/mol
Forward-Reverse Dimers-2.072 kcal/mol
Amplicon Folding-0.825 kcal/mol outside primersite
Amplicon SequenceTAAGGACATCGCCTACCAGCTCATGCATAACATCAGGGACATTGACGTGATCATGGGGGG
TGGCCGGAAATACATGTACCCCAAGAATAAAACTGATGTGGAGTATGAGAGTGACGAGAA
AGCCAGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)128860 - 987
NM_001127501 (ALPL)128695 - 822
NM_001177520 (ALPL)128579 - 706
Exon 6 To Exon 7 (Pair 8)
Forward (858,21)TGTAAGGACATCGCCTACCAGAmplicon SizecDNA: 125 bpgenomic: 4,012
Reverse (982,22)GCTTTCTCGTCACTCTCATACTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.504 kcal/mol
Forward Dimers-1.821 kcal/mol
Reverse Loops3.202 kcal/mol in 3' area
Reverse Dimers0.132 kcal/mol in 3' area
Forward-Reverse Dimers-0.717 kcal/mol
Amplicon Folding-0.825 kcal/mol outside primersite
Amplicon SequenceTGTAAGGACATCGCCTACCAGCTCATGCATAACATCAGGGACATTGACGTGATCATGGGG
GGTGGCCGGAAATACATGTACCCCAAGAATAAAACTGATGTGGAGTATGAGAGTGACGAG
AAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)125858 - 982
NM_001127501 (ALPL)125693 - 817
NM_001177520 (ALPL)125577 - 701
Exon 6 To Exon 7 (Pair 9)
Forward (860,21)TAAGGACATCGCCTACCAGCTAmplicon SizecDNA: 79 bpgenomic: 3,966
Reverse (938,21)GTACATGTATTTCCGGCCACCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.504 kcal/mol
Forward Dimers-1.821 kcal/mol
Reverse Loops2.35 kcal/mol
Reverse Dimers-2.91 kcal/mol
Forward-Reverse Dimers-2.248 kcal/mol
Amplicon Folding0.334 kcal/mol outside primersite
Amplicon SequenceTAAGGACATCGCCTACCAGCTCATGCATAACATCAGGGACATTGACGTGATCATGGGGGG
TGGCCGGAAATACATGTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)79860 - 938
NM_001127501 (ALPL)79695 - 773
NM_001177520 (ALPL)79579 - 657
Exon 6 To Exon 7 (Pair 10)
Forward (858,21)TGTAAGGACATCGCCTACCAGAmplicon SizecDNA: 130 bpgenomic: 4,017
Reverse (987,20)CCCTGGCTTTCTCGTCACTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.504 kcal/mol
Forward Dimers-1.821 kcal/mol
Reverse Loops2.482 kcal/mol in 3' area
Reverse Dimers-0.404 kcal/mol
Forward-Reverse Dimers-2.072 kcal/mol
Amplicon Folding-0.825 kcal/mol outside primersite
Amplicon SequenceTGTAAGGACATCGCCTACCAGCTCATGCATAACATCAGGGACATTGACGTGATCATGGGG
GGTGGCCGGAAATACATGTACCCCAAGAATAAAACTGATGTGGAGTATGAGAGTGACGAG
AAAGCCAGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)130858 - 987
NM_001127501 (ALPL)130693 - 822
NM_001177520 (ALPL)130577 - 706
Exon 6 To Exon 7 (Pair 11)
Forward (858,21)TGTAAGGACATCGCCTACCAGAmplicon SizecDNA: 127 bpgenomic: 4,014
Reverse (984,22)TGGCTTTCTCGTCACTCTCATANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.504 kcal/mol
Forward Dimers-1.821 kcal/mol
Reverse Loops2.482 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-1.506 kcal/mol
Amplicon Folding-0.825 kcal/mol outside primersite
Amplicon SequenceTGTAAGGACATCGCCTACCAGCTCATGCATAACATCAGGGACATTGACGTGATCATGGGG
GGTGGCCGGAAATACATGTACCCCAAGAATAAAACTGATGTGGAGTATGAGAGTGACGAG
AAAGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)127858 - 984
NM_001127501 (ALPL)127693 - 819
NM_001177520 (ALPL)127577 - 703
Exon 6 To Exon 7 (Pair 12)
Forward (858,21)TGTAAGGACATCGCCTACCAGAmplicon SizecDNA: 124 bpgenomic: 4,011
Reverse (981,22)CTTTCTCGTCACTCTCATACTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.504 kcal/mol
Forward Dimers-1.821 kcal/mol
Reverse Loops3.202 kcal/mol in 3' area
Reverse Dimers0.132 kcal/mol in 3' area
Forward-Reverse Dimers-0.717 kcal/mol
Amplicon Folding-0.825 kcal/mol outside primersite
Amplicon SequenceTGTAAGGACATCGCCTACCAGCTCATGCATAACATCAGGGACATTGACGTGATCATGGGG
GGTGGCCGGAAATACATGTACCCCAAGAATAAAACTGATGTGGAGTATGAGAGTGACGAG
AAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)124858 - 981
NM_001127501 (ALPL)124693 - 816
NM_001177520 (ALPL)124577 - 700
Exon 6 To Exon 7 (Pair 13)
Forward (858,21)TGTAAGGACATCGCCTACCAGAmplicon SizecDNA: 82 bpgenomic: 3,969
Reverse (939,21)GGTACATGTATTTCCGGCCACNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.504 kcal/mol
Forward Dimers-1.821 kcal/mol
Reverse Loops2.35 kcal/mol
Reverse Dimers-2.91 kcal/mol
Forward-Reverse Dimers-2.248 kcal/mol
Amplicon Folding0.334 kcal/mol outside primersite
Amplicon SequenceTGTAAGGACATCGCCTACCAGCTCATGCATAACATCAGGGACATTGACGTGATCATGGGG
GGTGGCCGGAAATACATGTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)82858 - 939
NM_001127501 (ALPL)82693 - 774
NM_001177520 (ALPL)82577 - 658
Exon 6 To Exon 7 (Pair 14)
Forward (858,21)TGTAAGGACATCGCCTACCAGAmplicon SizecDNA: 123 bpgenomic: 4,010
Reverse (980,22)TTTCTCGTCACTCTCATACTCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.504 kcal/mol
Forward Dimers-1.821 kcal/mol
Reverse Loops3.202 kcal/mol in 3' area
Reverse Dimers0.132 kcal/mol
Forward-Reverse Dimers-0.717 kcal/mol
Amplicon Folding-0.825 kcal/mol outside primersite
Amplicon SequenceTGTAAGGACATCGCCTACCAGCTCATGCATAACATCAGGGACATTGACGTGATCATGGGG
GGTGGCCGGAAATACATGTACCCCAAGAATAAAACTGATGTGGAGTATGAGAGTGACGAG
AAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)123858 - 980
NM_001127501 (ALPL)123693 - 815
NM_001177520 (ALPL)123577 - 699
Exon 6 To Exon 7 (Pair 15)
Forward (860,21)TAAGGACATCGCCTACCAGCTAmplicon SizecDNA: 122 bpgenomic: 4,009
Reverse (981,22)CTTTCTCGTCACTCTCATACTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.504 kcal/mol
Forward Dimers-1.821 kcal/mol
Reverse Loops3.202 kcal/mol in 3' area
Reverse Dimers0.132 kcal/mol in 3' area
Forward-Reverse Dimers-0.717 kcal/mol
Amplicon Folding-0.825 kcal/mol outside primersite
Amplicon SequenceTAAGGACATCGCCTACCAGCTCATGCATAACATCAGGGACATTGACGTGATCATGGGGGG
TGGCCGGAAATACATGTACCCCAAGAATAAAACTGATGTGGAGTATGAGAGTGACGAGAA
AG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)122860 - 981
NM_001127501 (ALPL)122695 - 816
NM_001177520 (ALPL)122579 - 700
Exon 6 To Exon 7 (Pair 16)
Forward (858,21)TGTAAGGACATCGCCTACCAGAmplicon SizecDNA: 81 bpgenomic: 3,968
Reverse (938,21)GTACATGTATTTCCGGCCACCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.504 kcal/mol
Forward Dimers-1.821 kcal/mol
Reverse Loops2.35 kcal/mol
Reverse Dimers-2.91 kcal/mol
Forward-Reverse Dimers-2.248 kcal/mol
Amplicon Folding0.334 kcal/mol outside primersite
Amplicon SequenceTGTAAGGACATCGCCTACCAGCTCATGCATAACATCAGGGACATTGACGTGATCATGGGG
GGTGGCCGGAAATACATGTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)81858 - 938
NM_001127501 (ALPL)81693 - 773
NM_001177520 (ALPL)81577 - 657
Exon 7 To Exon 9 (Pair 1)
Forward (1019,21)CACCTGGAAGAGCTTCAAACCAmplicon SizecDNA: 158 bpgenomic: 5,505
Reverse (1176,20)GGTCCGTCACGTTGTTCCTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.373 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceCACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGA
ACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGA
CATGCAGTACGAGCTGAACAGGAACAACGTGACGGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127501 (ALPL)158854 - 1011
NM_001177520 (ALPL)158738 - 895
NM_000478 (ALPL)1581019 - 1176
Exon 7 To Exon 9 (Pair 2)
Forward (1024,22)GGAAGAGCTTCAAACCGAGATAAmplicon SizecDNA: 154 bpgenomic: 5,501
Reverse (1177,20)GGGTCCGTCACGTTGTTCCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.228 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.58 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGAACTCC
TGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGACATGC
AGTACGAGCTGAACAGGAACAACGTGACGGACCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127501 (ALPL)154859 - 1012
NM_001177520 (ALPL)154743 - 896
NM_000478 (ALPL)1541024 - 1177
Exon 7 To Exon 9 (Pair 3)
Forward (1016,22)TGACACCTGGAAGAGCTTCAAAAmplicon SizecDNA: 189 bpgenomic: 5,536
Reverse (1204,19)GCCACCACCACCATCTCGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops0.951 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.622 kcal/mol
Amplicon Folding-2.8 kcal/mol outside primersite
Amplicon SequenceTGACACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCAC
GGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGG
GGACATGCAGTACGAGCTGAACAGGAACAACGTGACGGACCCGTCACTCTCCGAGATGGT
GGTGGTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1891016 - 1204
NM_001127501 (ALPL)189851 - 1039
NM_001177520 (ALPL)189735 - 923
Exon 7 To Exon 9 (Pair 4)
Forward (1012,21)TCGTTGACACCTGGAAGAGCTAmplicon SizecDNA: 160 bpgenomic: 5,507
Reverse (1171,21)GTCACGTTGTTCCTGTTCAGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol in 3' area
Forward Dimers-2.268 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.713 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceTCGTTGACACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACC
GCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGC
CAGGGGACATGCAGTACGAGCTGAACAGGAACAACGTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1601012 - 1171
NM_001127501 (ALPL)160847 - 1006
NM_001177520 (ALPL)160731 - 890
Exon 7 To Exon 9 (Pair 5)
Forward (1025,22)GAAGAGCTTCAAACCGAGATACAmplicon SizecDNA: 149 bpgenomic: 5,496
Reverse (1173,21)CCGTCACGTTGTTCCTGTTCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.004 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGAACTCCT
GACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGACATGCA
GTACGAGCTGAACAGGAACAACGTGACGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1491025 - 1173
NM_001127501 (ALPL)149860 - 1008
NM_001177520 (ALPL)149744 - 892
Exon 7 To Exon 9 (Pair 6)
Forward (1016,22)TGACACCTGGAAGAGCTTCAAAAmplicon SizecDNA: 161 bpgenomic: 5,508
Reverse (1176,20)GGTCCGTCACGTTGTTCCTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.373 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceTGACACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCAC
GGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGG
GGACATGCAGTACGAGCTGAACAGGAACAACGTGACGGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1611016 - 1176
NM_001127501 (ALPL)161851 - 1011
NM_001177520 (ALPL)161735 - 895
Exon 7 To Exon 9 (Pair 7)
Forward (1019,21)CACCTGGAAGAGCTTCAAACCAmplicon SizecDNA: 159 bpgenomic: 5,506
Reverse (1177,20)GGGTCCGTCACGTTGTTCCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.664 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceCACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGA
ACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGA
CATGCAGTACGAGCTGAACAGGAACAACGTGACGGACCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1591019 - 1177
NM_001127501 (ALPL)159854 - 1012
NM_001177520 (ALPL)159738 - 896
Exon 7 To Exon 9 (Pair 8)
Forward (1012,21)TCGTTGACACCTGGAAGAGCTAmplicon SizecDNA: 161 bpgenomic: 5,508
Reverse (1172,21)CGTCACGTTGTTCCTGTTCAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol in 3' area
Forward Dimers-2.268 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.713 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceTCGTTGACACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACC
GCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGC
CAGGGGACATGCAGTACGAGCTGAACAGGAACAACGTGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1611012 - 1172
NM_001127501 (ALPL)161847 - 1007
NM_001177520 (ALPL)161731 - 891
Exon 7 To Exon 9 (Pair 9)
Forward (1023,22)TGGAAGAGCTTCAAACCGAGATAmplicon SizecDNA: 155 bpgenomic: 5,502
Reverse (1177,20)GGGTCCGTCACGTTGTTCCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.228 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.58 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGAACTC
CTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGACATG
CAGTACGAGCTGAACAGGAACAACGTGACGGACCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1551023 - 1177
NM_001127501 (ALPL)155858 - 1012
NM_001177520 (ALPL)155742 - 896
Exon 7 To Exon 9 (Pair 10)
Forward (1025,22)GAAGAGCTTCAAACCGAGATACAmplicon SizecDNA: 150 bpgenomic: 5,497
Reverse (1174,21)TCCGTCACGTTGTTCCTGTTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.004 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGAACTCCT
GACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGACATGCA
GTACGAGCTGAACAGGAACAACGTGACGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1501025 - 1174
NM_001127501 (ALPL)150860 - 1009
NM_001177520 (ALPL)150744 - 893
Exon 7 To Exon 9 (Pair 11)
Forward (1016,22)TGACACCTGGAAGAGCTTCAAAAmplicon SizecDNA: 162 bpgenomic: 5,509
Reverse (1177,20)GGGTCCGTCACGTTGTTCCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.664 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceTGACACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCAC
GGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGG
GGACATGCAGTACGAGCTGAACAGGAACAACGTGACGGACCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1621016 - 1177
NM_001127501 (ALPL)162851 - 1012
NM_001177520 (ALPL)162735 - 896
Exon 7 To Exon 9 (Pair 12)
Forward (1023,22)TGGAAGAGCTTCAAACCGAGATAmplicon SizecDNA: 154 bpgenomic: 5,501
Reverse (1176,20)GGTCCGTCACGTTGTTCCTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.228 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.289 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGAACTC
CTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGACATG
CAGTACGAGCTGAACAGGAACAACGTGACGGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1541023 - 1176
NM_001127501 (ALPL)154858 - 1011
NM_001177520 (ALPL)154742 - 895
Exon 7 To Exon 9 (Pair 13)
Forward (1016,22)TGACACCTGGAAGAGCTTCAAAAmplicon SizecDNA: 160 bpgenomic: 5,507
Reverse (1175,21)GTCCGTCACGTTGTTCCTGTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.057 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceTGACACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCAC
GGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGG
GGACATGCAGTACGAGCTGAACAGGAACAACGTGACGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1601016 - 1175
NM_001127501 (ALPL)160851 - 1010
NM_001177520 (ALPL)160735 - 894
Exon 7 To Exon 9 (Pair 14)
Forward (1019,21)CACCTGGAAGAGCTTCAAACCAmplicon SizecDNA: 187 bpgenomic: 5,534
Reverse (1205,19)GGCCACCACCACCATCTCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.668 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-1.622 kcal/mol
Amplicon Folding-2.8 kcal/mol outside primersite
Amplicon SequenceCACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGA
ACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGA
CATGCAGTACGAGCTGAACAGGAACAACGTGACGGACCCGTCACTCTCCGAGATGGTGGT
GGTGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1871019 - 1205
NM_001127501 (ALPL)187854 - 1040
NM_001177520 (ALPL)187738 - 924
Exon 7 To Exon 9 (Pair 15)
Forward (1016,22)TGACACCTGGAAGAGCTTCAAAAmplicon SizecDNA: 157 bpgenomic: 5,504
Reverse (1172,21)CGTCACGTTGTTCCTGTTCAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.057 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceTGACACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCAC
GGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGG
GGACATGCAGTACGAGCTGAACAGGAACAACGTGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1571016 - 1172
NM_001127501 (ALPL)157851 - 1007
NM_001177520 (ALPL)157735 - 891
Exon 7 To Exon 9 (Pair 16)
Forward (1019,21)CACCTGGAAGAGCTTCAAACCAmplicon SizecDNA: 154 bpgenomic: 5,501
Reverse (1172,21)CGTCACGTTGTTCCTGTTCAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-0.97 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceCACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGA
ACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGA
CATGCAGTACGAGCTGAACAGGAACAACGTGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1541019 - 1172
NM_001127501 (ALPL)154854 - 1007
NM_001177520 (ALPL)154738 - 891
Exon 7 To Exon 9 (Pair 17)
Forward (1012,21)TCGTTGACACCTGGAAGAGCTAmplicon SizecDNA: 194 bpgenomic: 5,541
Reverse (1205,19)GGCCACCACCACCATCTCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol in 3' area
Forward Dimers-2.268 kcal/mol
Reverse Loops1.668 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-1.622 kcal/mol
Amplicon Folding-2.8 kcal/mol outside primersite
Amplicon SequenceTCGTTGACACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACC
GCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGC
CAGGGGACATGCAGTACGAGCTGAACAGGAACAACGTGACGGACCCGTCACTCTCCGAGA
TGGTGGTGGTGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1941012 - 1205
NM_001127501 (ALPL)194847 - 1040
NM_001177520 (ALPL)194731 - 924
Exon 7 To Exon 9 (Pair 18)
Forward (1012,21)TCGTTGACACCTGGAAGAGCTAmplicon SizecDNA: 165 bpgenomic: 5,512
Reverse (1176,20)GGTCCGTCACGTTGTTCCTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol in 3' area
Forward Dimers-2.268 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.713 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceTCGTTGACACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACC
GCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGC
CAGGGGACATGCAGTACGAGCTGAACAGGAACAACGTGACGGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1651012 - 1176
NM_001127501 (ALPL)165847 - 1011
NM_001177520 (ALPL)165731 - 895
Exon 7 To Exon 9 (Pair 19)
Forward (1012,21)TCGTTGACACCTGGAAGAGCTAmplicon SizecDNA: 240 bpgenomic: 5,587
Reverse (1251,21)CCACCAGCAAGAAGAAGCCTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol in 3' area
Forward Dimers-2.268 kcal/mol
Reverse Loops1.396 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.663 kcal/mol
Amplicon Folding-2.8 kcal/mol outside primersite
Amplicon SequenceTCGTTGACACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACC
GCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGC
CAGGGGACATGCAGTACGAGCTGAACAGGAACAACGTGACGGACCCGTCACTCTCCGAGA
TGGTGGTGGTGGCCATCCAGATCCTGCGGAAGAACCCCAAAGGCTTCTTCTTGCTGGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)2401012 - 1251
NM_001127501 (ALPL)240847 - 1086
NM_001177520 (ALPL)240731 - 970
Exon 7 To Exon 9 (Pair 20)
Forward (1019,21)CACCTGGAAGAGCTTCAAACCAmplicon SizecDNA: 156 bpgenomic: 5,503
Reverse (1174,21)TCCGTCACGTTGTTCCTGTTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-0.97 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceCACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGA
ACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGA
CATGCAGTACGAGCTGAACAGGAACAACGTGACGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1561019 - 1174
NM_001127501 (ALPL)156854 - 1009
NM_001177520 (ALPL)156738 - 893
Exon 7 To Exon 9 (Pair 21)
Forward (1024,22)GGAAGAGCTTCAAACCGAGATAAmplicon SizecDNA: 153 bpgenomic: 5,500
Reverse (1176,20)GGTCCGTCACGTTGTTCCTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.228 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.289 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGAACTCC
TGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGACATGC
AGTACGAGCTGAACAGGAACAACGTGACGGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1531024 - 1176
NM_001127501 (ALPL)153859 - 1011
NM_001177520 (ALPL)153743 - 895
Exon 7 To Exon 9 (Pair 22)
Forward (1012,21)TCGTTGACACCTGGAAGAGCTAmplicon SizecDNA: 164 bpgenomic: 5,511
Reverse (1175,21)GTCCGTCACGTTGTTCCTGTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol in 3' area
Forward Dimers-2.268 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.713 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceTCGTTGACACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACC
GCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGC
CAGGGGACATGCAGTACGAGCTGAACAGGAACAACGTGACGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1641012 - 1175
NM_001127501 (ALPL)164847 - 1010
NM_001177520 (ALPL)164731 - 894
Exon 7 To Exon 9 (Pair 23)
Forward (1025,22)GAAGAGCTTCAAACCGAGATACAmplicon SizecDNA: 153 bpgenomic: 5,500
Reverse (1177,20)GGGTCCGTCACGTTGTTCCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.58 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGAACTCCT
GACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGACATGCA
GTACGAGCTGAACAGGAACAACGTGACGGACCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1531025 - 1177
NM_001127501 (ALPL)153860 - 1012
NM_001177520 (ALPL)153744 - 896
Exon 7 To Exon 9 (Pair 24)
Forward (1016,22)TGACACCTGGAAGAGCTTCAAAAmplicon SizecDNA: 158 bpgenomic: 5,505
Reverse (1173,21)CCGTCACGTTGTTCCTGTTCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.057 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceTGACACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCAC
GGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGG
GGACATGCAGTACGAGCTGAACAGGAACAACGTGACGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1581016 - 1173
NM_001127501 (ALPL)158851 - 1008
NM_001177520 (ALPL)158735 - 892
Exon 7 To Exon 9 (Pair 25)
Forward (1024,22)GGAAGAGCTTCAAACCGAGATAAmplicon SizecDNA: 150 bpgenomic: 5,497
Reverse (1173,21)CCGTCACGTTGTTCCTGTTCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.228 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.004 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGAACTCC
TGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGACATGC
AGTACGAGCTGAACAGGAACAACGTGACGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1501024 - 1173
NM_001127501 (ALPL)150859 - 1008
NM_001177520 (ALPL)150743 - 892
Exon 7 To Exon 9 (Pair 26)
Forward (1019,21)CACCTGGAAGAGCTTCAAACCAmplicon SizecDNA: 155 bpgenomic: 5,502
Reverse (1173,21)CCGTCACGTTGTTCCTGTTCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-0.97 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceCACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGA
ACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGA
CATGCAGTACGAGCTGAACAGGAACAACGTGACGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1551019 - 1173
NM_001127501 (ALPL)155854 - 1008
NM_001177520 (ALPL)155738 - 892
Exon 7 To Exon 9 (Pair 27)
Forward (1012,21)TCGTTGACACCTGGAAGAGCTAmplicon SizecDNA: 241 bpgenomic: 5,588
Reverse (1252,21)TCCACCAGCAAGAAGAAGCCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol in 3' area
Forward Dimers-2.268 kcal/mol
Reverse Loops1.67 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.663 kcal/mol
Amplicon Folding-2.8 kcal/mol outside primersite
Amplicon SequenceTCGTTGACACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACC
GCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGC
CAGGGGACATGCAGTACGAGCTGAACAGGAACAACGTGACGGACCCGTCACTCTCCGAGA
TGGTGGTGGTGGCCATCCAGATCCTGCGGAAGAACCCCAAAGGCTTCTTCTTGCTGGTGG
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)2411012 - 1252
NM_001127501 (ALPL)241847 - 1087
NM_001177520 (ALPL)241731 - 971
Exon 7 To Exon 9 (Pair 28)
Forward (1024,22)GGAAGAGCTTCAAACCGAGATAAmplicon SizecDNA: 151 bpgenomic: 5,498
Reverse (1174,21)TCCGTCACGTTGTTCCTGTTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.228 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.004 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGAACTCC
TGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGACATGC
AGTACGAGCTGAACAGGAACAACGTGACGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1511024 - 1174
NM_001127501 (ALPL)151859 - 1009
NM_001177520 (ALPL)151743 - 893
Exon 7 To Exon 9 (Pair 29)
Forward (1025,22)GAAGAGCTTCAAACCGAGATACAmplicon SizecDNA: 151 bpgenomic: 5,498
Reverse (1175,21)GTCCGTCACGTTGTTCCTGTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.004 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGAACTCCT
GACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGACATGCA
GTACGAGCTGAACAGGAACAACGTGACGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1511025 - 1175
NM_001127501 (ALPL)151860 - 1010
NM_001177520 (ALPL)151744 - 894
Exon 7 To Exon 9 (Pair 30)
Forward (1012,21)TCGTTGACACCTGGAAGAGCTAmplicon SizecDNA: 193 bpgenomic: 5,540
Reverse (1204,19)GCCACCACCACCATCTCGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol in 3' area
Forward Dimers-2.268 kcal/mol
Reverse Loops0.951 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.622 kcal/mol
Amplicon Folding-2.8 kcal/mol outside primersite
Amplicon SequenceTCGTTGACACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACC
GCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGC
CAGGGGACATGCAGTACGAGCTGAACAGGAACAACGTGACGGACCCGTCACTCTCCGAGA
TGGTGGTGGTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1931012 - 1204
NM_001127501 (ALPL)193847 - 1039
NM_001177520 (ALPL)193731 - 923
Exon 7 To Exon 9 (Pair 31)
Forward (1016,22)TGACACCTGGAAGAGCTTCAAAAmplicon SizecDNA: 159 bpgenomic: 5,506
Reverse (1174,21)TCCGTCACGTTGTTCCTGTTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.057 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceTGACACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCAC
GGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGG
GGACATGCAGTACGAGCTGAACAGGAACAACGTGACGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1591016 - 1174
NM_001127501 (ALPL)159851 - 1009
NM_001177520 (ALPL)159735 - 893
Exon 7 To Exon 9 (Pair 32)
Forward (1025,22)GAAGAGCTTCAAACCGAGATACAmplicon SizecDNA: 152 bpgenomic: 5,499
Reverse (1176,20)GGTCCGTCACGTTGTTCCTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.289 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGAACTCCT
GACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGACATGCA
GTACGAGCTGAACAGGAACAACGTGACGGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1521025 - 1176
NM_001127501 (ALPL)152860 - 1011
NM_001177520 (ALPL)152744 - 895
Exon 7 To Exon 9 (Pair 33)
Forward (1020,21)ACCTGGAAGAGCTTCAAACCGAmplicon SizecDNA: 186 bpgenomic: 5,533
Reverse (1205,19)GGCCACCACCACCATCTCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.668 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-1.622 kcal/mol
Amplicon Folding-2.8 kcal/mol outside primersite
Amplicon SequenceACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGAA
CTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGAC
ATGCAGTACGAGCTGAACAGGAACAACGTGACGGACCCGTCACTCTCCGAGATGGTGGTG
GTGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1861020 - 1205
NM_001127501 (ALPL)186855 - 1040
NM_001177520 (ALPL)186739 - 924
Exon 7 To Exon 9 (Pair 34)
Forward (1012,21)TCGTTGACACCTGGAAGAGCTAmplicon SizecDNA: 166 bpgenomic: 5,513
Reverse (1177,20)GGGTCCGTCACGTTGTTCCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol in 3' area
Forward Dimers-2.268 kcal/mol
Reverse Loops1.791 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.713 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceTCGTTGACACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACC
GCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGC
CAGGGGACATGCAGTACGAGCTGAACAGGAACAACGTGACGGACCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1661012 - 1177
NM_001127501 (ALPL)166847 - 1012
NM_001177520 (ALPL)166731 - 896
Exon 7 To Exon 9 (Pair 35)
Forward (1020,21)ACCTGGAAGAGCTTCAAACCGAmplicon SizecDNA: 153 bpgenomic: 5,500
Reverse (1172,21)CGTCACGTTGTTCCTGTTCAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-0.97 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGAA
CTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGAC
ATGCAGTACGAGCTGAACAGGAACAACGTGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1531020 - 1172
NM_001127501 (ALPL)153855 - 1007
NM_001177520 (ALPL)153739 - 891
Exon 7 To Exon 9 (Pair 36)
Forward (1012,21)TCGTTGACACCTGGAAGAGCTAmplicon SizecDNA: 242 bpgenomic: 5,589
Reverse (1253,21)TTCCACCAGCAAGAAGAAGCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol in 3' area
Forward Dimers-2.268 kcal/mol
Reverse Loops1.67 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.663 kcal/mol
Amplicon Folding-2.8 kcal/mol outside primersite
Amplicon SequenceTCGTTGACACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACC
GCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGC
CAGGGGACATGCAGTACGAGCTGAACAGGAACAACGTGACGGACCCGTCACTCTCCGAGA
TGGTGGTGGTGGCCATCCAGATCCTGCGGAAGAACCCCAAAGGCTTCTTCTTGCTGGTGG
AA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)2421012 - 1253
NM_001127501 (ALPL)242847 - 1088
NM_001177520 (ALPL)242731 - 972
Exon 7 To Exon 9 (Pair 37)
Forward (1024,22)GGAAGAGCTTCAAACCGAGATAAmplicon SizecDNA: 152 bpgenomic: 5,499
Reverse (1175,21)GTCCGTCACGTTGTTCCTGTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.228 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.004 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGAACTCC
TGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGACATGC
AGTACGAGCTGAACAGGAACAACGTGACGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1521024 - 1175
NM_001127501 (ALPL)152859 - 1010
NM_001177520 (ALPL)152743 - 894
Exon 7 To Exon 9 (Pair 38)
Forward (1022,21)CTGGAAGAGCTTCAAACCGAGAmplicon SizecDNA: 184 bpgenomic: 5,531
Reverse (1205,19)GGCCACCACCACCATCTCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.086 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.668 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-1.622 kcal/mol
Amplicon Folding-2.8 kcal/mol outside primersite
Amplicon SequenceCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGAACT
CCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGACAT
GCAGTACGAGCTGAACAGGAACAACGTGACGGACCCGTCACTCTCCGAGATGGTGGTGGT
GGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1841022 - 1205
NM_001127501 (ALPL)184857 - 1040
NM_001177520 (ALPL)184741 - 924
Exon 7 To Exon 9 (Pair 39)
Forward (1016,22)TGACACCTGGAAGAGCTTCAAAAmplicon SizecDNA: 190 bpgenomic: 5,537
Reverse (1205,19)GGCCACCACCACCATCTCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.668 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-1.622 kcal/mol
Amplicon Folding-2.8 kcal/mol outside primersite
Amplicon SequenceTGACACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCAC
GGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGG
GGACATGCAGTACGAGCTGAACAGGAACAACGTGACGGACCCGTCACTCTCCGAGATGGT
GGTGGTGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1901016 - 1205
NM_001127501 (ALPL)190851 - 1040
NM_001177520 (ALPL)190735 - 924
Exon 7 To Exon 9 (Pair 40)
Forward (1028,22)GAGCTTCAAACCGAGATACAAGAmplicon SizecDNA: 150 bpgenomic: 5,497
Reverse (1177,20)GGGTCCGTCACGTTGTTCCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.718 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.58 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGAACTCCTGAC
CCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGACATGCAGTA
CGAGCTGAACAGGAACAACGTGACGGACCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1501028 - 1177
NM_001127501 (ALPL)150863 - 1012
NM_001177520 (ALPL)150747 - 896
Exon 7 To Exon 9 (Pair 41)
Forward (1012,21)TCGTTGACACCTGGAAGAGCTAmplicon SizecDNA: 162 bpgenomic: 5,509
Reverse (1173,21)CCGTCACGTTGTTCCTGTTCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol in 3' area
Forward Dimers-2.268 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.713 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceTCGTTGACACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACC
GCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGC
CAGGGGACATGCAGTACGAGCTGAACAGGAACAACGTGACGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1621012 - 1173
NM_001127501 (ALPL)162847 - 1008
NM_001177520 (ALPL)162731 - 892
Exon 7 To Exon 9 (Pair 42)
Forward (1026,23)AAGAGCTTCAAACCGAGATACAAAmplicon SizecDNA: 152 bpgenomic: 5,499
Reverse (1177,20)GGGTCCGTCACGTTGTTCCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.718 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.58 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGAACTCCTG
ACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGACATGCAG
TACGAGCTGAACAGGAACAACGTGACGGACCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1521026 - 1177
NM_001127501 (ALPL)152861 - 1012
NM_001177520 (ALPL)152745 - 896
Exon 7 To Exon 9 (Pair 43)
Forward (1020,21)ACCTGGAAGAGCTTCAAACCGAmplicon SizecDNA: 155 bpgenomic: 5,502
Reverse (1174,21)TCCGTCACGTTGTTCCTGTTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-0.97 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGAA
CTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGAC
ATGCAGTACGAGCTGAACAGGAACAACGTGACGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1551020 - 1174
NM_001127501 (ALPL)155855 - 1009
NM_001177520 (ALPL)155739 - 893
Exon 7 To Exon 9 (Pair 44)
Forward (1020,21)ACCTGGAAGAGCTTCAAACCGAmplicon SizecDNA: 154 bpgenomic: 5,501
Reverse (1173,21)CCGTCACGTTGTTCCTGTTCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-0.97 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGAA
CTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGAC
ATGCAGTACGAGCTGAACAGGAACAACGTGACGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1541020 - 1173
NM_001127501 (ALPL)154855 - 1008
NM_001177520 (ALPL)154739 - 892
Exon 7 To Exon 9 (Pair 45)
Forward (1019,21)CACCTGGAAGAGCTTCAAACCAmplicon SizecDNA: 186 bpgenomic: 5,533
Reverse (1204,19)GCCACCACCACCATCTCGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops0.951 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.622 kcal/mol
Amplicon Folding-2.8 kcal/mol outside primersite
Amplicon SequenceCACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGA
ACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGA
CATGCAGTACGAGCTGAACAGGAACAACGTGACGGACCCGTCACTCTCCGAGATGGTGGT
GGTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1861019 - 1204
NM_001127501 (ALPL)186854 - 1039
NM_001177520 (ALPL)186738 - 923
Exon 7 To Exon 9 (Pair 46)
Forward (1026,23)AAGAGCTTCAAACCGAGATACAAAmplicon SizecDNA: 151 bpgenomic: 5,498
Reverse (1176,20)GGTCCGTCACGTTGTTCCTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.718 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.289 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGAACTCCTG
ACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGACATGCAG
TACGAGCTGAACAGGAACAACGTGACGGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1511026 - 1176
NM_001127501 (ALPL)151861 - 1011
NM_001177520 (ALPL)151745 - 895
Exon 7 To Exon 9 (Pair 47)
Forward (1025,22)GAAGAGCTTCAAACCGAGATACAmplicon SizecDNA: 148 bpgenomic: 5,495
Reverse (1172,21)CGTCACGTTGTTCCTGTTCAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.004 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGAACTCCT
GACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGACATGCA
GTACGAGCTGAACAGGAACAACGTGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1481025 - 1172
NM_001127501 (ALPL)148860 - 1007
NM_001177520 (ALPL)148744 - 891
Exon 7 To Exon 9 (Pair 48)
Forward (1024,22)GGAAGAGCTTCAAACCGAGATAAmplicon SizecDNA: 149 bpgenomic: 5,496
Reverse (1172,21)CGTCACGTTGTTCCTGTTCAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.228 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.004 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGAACTCC
TGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGACATGC
AGTACGAGCTGAACAGGAACAACGTGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1491024 - 1172
NM_001127501 (ALPL)149859 - 1007
NM_001177520 (ALPL)149743 - 891
Exon 7 To Exon 9 (Pair 49)
Forward (1012,21)TCGTTGACACCTGGAAGAGCTAmplicon SizecDNA: 163 bpgenomic: 5,510
Reverse (1174,21)TCCGTCACGTTGTTCCTGTTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol in 3' area
Forward Dimers-2.268 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.713 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceTCGTTGACACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACC
GCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGC
CAGGGGACATGCAGTACGAGCTGAACAGGAACAACGTGACGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1631012 - 1174
NM_001127501 (ALPL)163847 - 1009
NM_001177520 (ALPL)163731 - 893
Exon 7 To Exon 9 (Pair 50)
Forward (1020,21)ACCTGGAAGAGCTTCAAACCGAmplicon SizecDNA: 185 bpgenomic: 5,532
Reverse (1204,19)GCCACCACCACCATCTCGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops0.951 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.622 kcal/mol
Amplicon Folding-2.8 kcal/mol outside primersite
Amplicon SequenceACCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGAA
CTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGAC
ATGCAGTACGAGCTGAACAGGAACAACGTGACGGACCCGTCACTCTCCGAGATGGTGGTG
GTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1851020 - 1204
NM_001127501 (ALPL)185855 - 1039
NM_001177520 (ALPL)185739 - 923
Exon 7 To Exon 9 (Pair 51)
Forward (1028,22)GAGCTTCAAACCGAGATACAAGAmplicon SizecDNA: 149 bpgenomic: 5,496
Reverse (1176,20)GGTCCGTCACGTTGTTCCTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.718 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.289 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGAACTCCTGAC
CCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGACATGCAGTA
CGAGCTGAACAGGAACAACGTGACGGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1491028 - 1176
NM_001127501 (ALPL)149863 - 1011
NM_001177520 (ALPL)149747 - 895
Exon 7 To Exon 9 (Pair 52)
Forward (1021,21)CCTGGAAGAGCTTCAAACCGAAmplicon SizecDNA: 185 bpgenomic: 5,532
Reverse (1205,19)GGCCACCACCACCATCTCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.875 kcal/mol
Forward Dimers-2.948 kcal/mol
Reverse Loops1.668 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-1.622 kcal/mol
Amplicon Folding-2.8 kcal/mol outside primersite
Amplicon SequenceCCTGGAAGAGCTTCAAACCGAGATACAAGCACTCCCACTTCATCTGGAACCGCACGGAAC
TCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGGGACA
TGCAGTACGAGCTGAACAGGAACAACGTGACGGACCCGTCACTCTCCGAGATGGTGGTGG
TGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1851021 - 1205
NM_001127501 (ALPL)185856 - 1040
NM_001177520 (ALPL)185740 - 924
Exon 8 To Exon 9 (Pair 1)
Forward (1071,19)CGCACGGAACTCCTGACCCAmplicon SizecDNA: 102 bpgenomic: 3,392
Reverse (1172,21)CGTCACGTTGTTCCTGTTCAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.485 kcal/mol in 3' area
Forward Dimers-0.36 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.084 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceCGCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAG
CCAGGGGACATGCAGTACGAGCTGAACAGGAACAACGTGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127501 (ALPL)102906 - 1007
NM_001177520 (ALPL)102790 - 891
NM_000478 (ALPL)1021071 - 1172
Exon 8 To Exon 9 (Pair 2)
Forward (1075,20)CGGAACTCCTGACCCTTGACAmplicon SizecDNA: 91 bpgenomic: 3,381
Reverse (1165,22)TTGTTCCTGTTCAGCTCGTACTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.592 kcal/mol
Forward Dimers-0.31 kcal/mol
Reverse Loops2.093 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.941 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceCGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAG
GGGACATGCAGTACGAGCTGAACAGGAACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127501 (ALPL)91910 - 1000
NM_001177520 (ALPL)91794 - 884
NM_000478 (ALPL)911075 - 1165
Exon 8 To Exon 9 (Pair 3)
Forward (1075,20)CGGAACTCCTGACCCTTGACAmplicon SizecDNA: 88 bpgenomic: 3,378
Reverse (1162,21)TTCCTGTTCAGCTCGTACTGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.592 kcal/mol
Forward Dimers-0.31 kcal/mol
Reverse Loops1.276 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.115 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceCGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAG
GGGACATGCAGTACGAGCTGAACAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127501 (ALPL)88910 - 997
NM_001177520 (ALPL)88794 - 881
NM_000478 (ALPL)881075 - 1162
Exon 8 To Exon 9 (Pair 4)
Forward (1070,19)CCGCACGGAACTCCTGACCAmplicon SizecDNA: 88 bpgenomic: 3,378
Reverse (1157,21)GTTCAGCTCGTACTGCATGTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.054 kcal/mol
Forward Dimers-2.423 kcal/mol
Reverse Loops1.243 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.799 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceCCGCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGA
GCCAGGGGACATGCAGTACGAGCTGAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)881070 - 1157
NM_001127501 (ALPL)88905 - 992
NM_001177520 (ALPL)88789 - 876
Exon 8 To Exon 9 (Pair 5)
Forward (1077,20)GAACTCCTGACCCTTGACCCAmplicon SizecDNA: 85 bpgenomic: 3,375
Reverse (1161,21)TCCTGTTCAGCTCGTACTGCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.474 kcal/mol
Forward Dimers0.901 kcal/mol
Reverse Loops1.276 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.085 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGG
GACATGCAGTACGAGCTGAACAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)851077 - 1161
NM_001127501 (ALPL)85912 - 996
NM_001177520 (ALPL)85796 - 880
Exon 8 To Exon 9 (Pair 6)
Forward (1072,20)GCACGGAACTCCTGACCCTTAmplicon SizecDNA: 101 bpgenomic: 3,391
Reverse (1172,21)CGTCACGTTGTTCCTGTTCAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.485 kcal/mol
Forward Dimers-0.36 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.084 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceGCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGC
CAGGGGACATGCAGTACGAGCTGAACAGGAACAACGTGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1011072 - 1172
NM_001127501 (ALPL)101907 - 1007
NM_001177520 (ALPL)101791 - 891
Exon 8 To Exon 9 (Pair 7)
Forward (1076,20)GGAACTCCTGACCCTTGACCAmplicon SizecDNA: 79 bpgenomic: 3,369
Reverse (1154,20)CAGCTCGTACTGCATGTCCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.64 kcal/mol
Forward Dimers-0.263 kcal/mol
Reverse Loops1.243 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-0.78 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGG
GGACATGCAGTACGAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)791076 - 1154
NM_001127501 (ALPL)79911 - 989
NM_001177520 (ALPL)79795 - 873
Exon 8 To Exon 9 (Pair 8)
Forward (1072,20)GCACGGAACTCCTGACCCTTAmplicon SizecDNA: 133 bpgenomic: 3,423
Reverse (1204,19)GCCACCACCACCATCTCGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.485 kcal/mol
Forward Dimers-0.36 kcal/mol
Reverse Loops0.951 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.072 kcal/mol
Amplicon Folding-2.8 kcal/mol outside primersite
Amplicon SequenceGCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGC
CAGGGGACATGCAGTACGAGCTGAACAGGAACAACGTGACGGACCCGTCACTCTCCGAGA
TGGTGGTGGTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1331072 - 1204
NM_001127501 (ALPL)133907 - 1039
NM_001177520 (ALPL)133791 - 923
Exon 8 To Exon 9 (Pair 9)
Forward (1072,20)GCACGGAACTCCTGACCCTTAmplicon SizecDNA: 98 bpgenomic: 3,388
Reverse (1169,21)CACGTTGTTCCTGTTCAGCTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.485 kcal/mol
Forward Dimers-0.36 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.084 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceGCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGC
CAGGGGACATGCAGTACGAGCTGAACAGGAACAACGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)981072 - 1169
NM_001127501 (ALPL)98907 - 1004
NM_001177520 (ALPL)98791 - 888
Exon 8 To Exon 9 (Pair 10)
Forward (1076,20)GGAACTCCTGACCCTTGACCAmplicon SizecDNA: 84 bpgenomic: 3,374
Reverse (1159,21)CTGTTCAGCTCGTACTGCATGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.64 kcal/mol
Forward Dimers-0.263 kcal/mol
Reverse Loops1.276 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.115 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGG
GGACATGCAGTACGAGCTGAACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)841076 - 1159
NM_001127501 (ALPL)84911 - 994
NM_001177520 (ALPL)84795 - 878
Exon 8 To Exon 9 (Pair 11)
Forward (1073,20)CACGGAACTCCTGACCCTTGAmplicon SizecDNA: 89 bpgenomic: 3,379
Reverse (1161,21)TCCTGTTCAGCTCGTACTGCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.485 kcal/mol
Forward Dimers-0.36 kcal/mol
Reverse Loops1.276 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.799 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCC
AGGGGACATGCAGTACGAGCTGAACAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)891073 - 1161
NM_001127501 (ALPL)89908 - 996
NM_001177520 (ALPL)89792 - 880
Exon 8 To Exon 9 (Pair 12)
Forward (1077,20)GAACTCCTGACCCTTGACCCAmplicon SizecDNA: 87 bpgenomic: 3,377
Reverse (1163,21)GTTCCTGTTCAGCTCGTACTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.474 kcal/mol
Forward Dimers0.901 kcal/mol
Reverse Loops1.487 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.085 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGG
GACATGCAGTACGAGCTGAACAGGAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)871077 - 1163
NM_001127501 (ALPL)87912 - 998
NM_001177520 (ALPL)87796 - 882
Exon 8 To Exon 9 (Pair 13)
Forward (1071,19)CGCACGGAACTCCTGACCCAmplicon SizecDNA: 87 bpgenomic: 3,377
Reverse (1157,21)GTTCAGCTCGTACTGCATGTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.485 kcal/mol in 3' area
Forward Dimers-0.36 kcal/mol
Reverse Loops1.243 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.799 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceCGCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAG
CCAGGGGACATGCAGTACGAGCTGAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)871071 - 1157
NM_001127501 (ALPL)87906 - 992
NM_001177520 (ALPL)87790 - 876
Exon 8 To Exon 9 (Pair 14)
Forward (1054,20)CCCACTTCATCTGGAACCGCAmplicon SizecDNA: 200 bpgenomic: 3,490
Reverse (1253,21)TTCCACCAGCAAGAAGAAGCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.195 kcal/mol
Forward Dimers-0.831 kcal/mol
Reverse Loops1.67 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.757 kcal/mol
Amplicon Folding-2.8 kcal/mol outside primersite
Amplicon SequenceCCCACTTCATCTGGAACCGCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACC
TATTGGGTCTCTTCGAGCCAGGGGACATGCAGTACGAGCTGAACAGGAACAACGTGACGG
ACCCGTCACTCTCCGAGATGGTGGTGGTGGCCATCCAGATCCTGCGGAAGAACCCCAAAG
GCTTCTTCTTGCTGGTGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)2001054 - 1253
NM_001127501 (ALPL)200889 - 1088
NM_001177520 (ALPL)200773 - 972
Exon 8 To Exon 9 (Pair 15)
Forward (1070,19)CCGCACGGAACTCCTGACCAmplicon SizecDNA: 136 bpgenomic: 3,426
Reverse (1205,19)GGCCACCACCACCATCTCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.054 kcal/mol
Forward Dimers-2.423 kcal/mol
Reverse Loops1.668 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-1.072 kcal/mol
Amplicon Folding-2.8 kcal/mol outside primersite
Amplicon SequenceCCGCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGA
GCCAGGGGACATGCAGTACGAGCTGAACAGGAACAACGTGACGGACCCGTCACTCTCCGA
GATGGTGGTGGTGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1361070 - 1205
NM_001127501 (ALPL)136905 - 1040
NM_001177520 (ALPL)136789 - 924
Exon 8 To Exon 9 (Pair 16)
Forward (1073,20)CACGGAACTCCTGACCCTTGAmplicon SizecDNA: 87 bpgenomic: 3,377
Reverse (1159,21)CTGTTCAGCTCGTACTGCATGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.485 kcal/mol
Forward Dimers-0.36 kcal/mol
Reverse Loops1.276 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.799 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCC
AGGGGACATGCAGTACGAGCTGAACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)871073 - 1159
NM_001127501 (ALPL)87908 - 994
NM_001177520 (ALPL)87792 - 878
Exon 8 To Exon 9 (Pair 17)
Forward (1070,19)CCGCACGGAACTCCTGACCAmplicon SizecDNA: 100 bpgenomic: 3,390
Reverse (1169,21)CACGTTGTTCCTGTTCAGCTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.054 kcal/mol
Forward Dimers-2.423 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.084 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceCCGCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGA
GCCAGGGGACATGCAGTACGAGCTGAACAGGAACAACGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1001070 - 1169
NM_001127501 (ALPL)100905 - 1004
NM_001177520 (ALPL)100789 - 888
Exon 8 To Exon 9 (Pair 18)
Forward (1077,20)GAACTCCTGACCCTTGACCCAmplicon SizecDNA: 80 bpgenomic: 3,370
Reverse (1156,21)TTCAGCTCGTACTGCATGTCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.474 kcal/mol
Forward Dimers0.901 kcal/mol
Reverse Loops1.243 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.085 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGG
GACATGCAGTACGAGCTGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)801077 - 1156
NM_001127501 (ALPL)80912 - 991
NM_001177520 (ALPL)80796 - 875
Exon 8 To Exon 9 (Pair 19)
Forward (1076,20)GGAACTCCTGACCCTTGACCAmplicon SizecDNA: 99 bpgenomic: 3,389
Reverse (1174,21)TCCGTCACGTTGTTCCTGTTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.64 kcal/mol
Forward Dimers-0.263 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.893 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGG
GGACATGCAGTACGAGCTGAACAGGAACAACGTGACGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)991076 - 1174
NM_001127501 (ALPL)99911 - 1009
NM_001177520 (ALPL)99795 - 893
Exon 8 To Exon 9 (Pair 20)
Forward (1073,20)CACGGAACTCCTGACCCTTGAmplicon SizecDNA: 93 bpgenomic: 3,383
Reverse (1165,22)TTGTTCCTGTTCAGCTCGTACTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.485 kcal/mol
Forward Dimers-0.36 kcal/mol
Reverse Loops2.093 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.941 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCC
AGGGGACATGCAGTACGAGCTGAACAGGAACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)931073 - 1165
NM_001127501 (ALPL)93908 - 1000
NM_001177520 (ALPL)93792 - 884
Exon 8 To Exon 9 (Pair 21)
Forward (1076,20)GGAACTCCTGACCCTTGACCAmplicon SizecDNA: 85 bpgenomic: 3,375
Reverse (1160,21)CCTGTTCAGCTCGTACTGCATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.64 kcal/mol
Forward Dimers-0.263 kcal/mol
Reverse Loops1.276 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.115 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGG
GGACATGCAGTACGAGCTGAACAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)851076 - 1160
NM_001127501 (ALPL)85911 - 995
NM_001177520 (ALPL)85795 - 879
Exon 8 To Exon 9 (Pair 22)
Forward (1077,20)GAACTCCTGACCCTTGACCCAmplicon SizecDNA: 84 bpgenomic: 3,374
Reverse (1160,21)CCTGTTCAGCTCGTACTGCATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.474 kcal/mol
Forward Dimers0.901 kcal/mol
Reverse Loops1.276 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.085 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGG
GACATGCAGTACGAGCTGAACAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)841077 - 1160
NM_001127501 (ALPL)84912 - 995
NM_001177520 (ALPL)84796 - 879
Exon 8 To Exon 9 (Pair 23)
Forward (1077,20)GAACTCCTGACCCTTGACCCAmplicon SizecDNA: 99 bpgenomic: 3,389
Reverse (1175,21)GTCCGTCACGTTGTTCCTGTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.474 kcal/mol
Forward Dimers0.901 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-0.838 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAGGG
GACATGCAGTACGAGCTGAACAGGAACAACGTGACGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)991077 - 1175
NM_001127501 (ALPL)99912 - 1010
NM_001177520 (ALPL)99796 - 894
Exon 8 To Exon 9 (Pair 24)
Forward (1071,19)CGCACGGAACTCCTGACCCAmplicon SizecDNA: 91 bpgenomic: 3,381
Reverse (1161,21)TCCTGTTCAGCTCGTACTGCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.485 kcal/mol in 3' area
Forward Dimers-0.36 kcal/mol
Reverse Loops1.276 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.799 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceCGCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAG
CCAGGGGACATGCAGTACGAGCTGAACAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)911071 - 1161
NM_001127501 (ALPL)91906 - 996
NM_001177520 (ALPL)91790 - 880
Exon 8 To Exon 9 (Pair 25)
Forward (1073,20)CACGGAACTCCTGACCCTTGAmplicon SizecDNA: 132 bpgenomic: 3,422
Reverse (1204,19)GCCACCACCACCATCTCGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.485 kcal/mol
Forward Dimers-0.36 kcal/mol
Reverse Loops0.951 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.072 kcal/mol
Amplicon Folding-2.8 kcal/mol outside primersite
Amplicon SequenceCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCC
AGGGGACATGCAGTACGAGCTGAACAGGAACAACGTGACGGACCCGTCACTCTCCGAGAT
GGTGGTGGTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)1321073 - 1204
NM_001127501 (ALPL)132908 - 1039
NM_001177520 (ALPL)132792 - 923
Exon 8 To Exon 9 (Pair 26)
Forward (1072,20)GCACGGAACTCCTGACCCTTAmplicon SizecDNA: 88 bpgenomic: 3,378
Reverse (1159,21)CTGTTCAGCTCGTACTGCATGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.485 kcal/mol
Forward Dimers-0.36 kcal/mol
Reverse Loops1.276 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.799 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceGCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGC
CAGGGGACATGCAGTACGAGCTGAACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)881072 - 1159
NM_001127501 (ALPL)88907 - 994
NM_001177520 (ALPL)88791 - 878
Exon 8 To Exon 9 (Pair 27)
Forward (1071,19)CGCACGGAACTCCTGACCCAmplicon SizecDNA: 95 bpgenomic: 3,385
Reverse (1165,22)TTGTTCCTGTTCAGCTCGTACTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.485 kcal/mol in 3' area
Forward Dimers-0.36 kcal/mol
Reverse Loops2.093 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.941 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceCGCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAG
CCAGGGGACATGCAGTACGAGCTGAACAGGAACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)951071 - 1165
NM_001127501 (ALPL)95906 - 1000
NM_001177520 (ALPL)95790 - 884
Exon 8 To Exon 9 (Pair 28)
Forward (1075,20)CGGAACTCCTGACCCTTGACAmplicon SizecDNA: 99 bpgenomic: 3,389
Reverse (1173,21)CCGTCACGTTGTTCCTGTTCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.592 kcal/mol
Forward Dimers-0.31 kcal/mol
Reverse Loops1.791 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.941 kcal/mol
Amplicon Folding-0.913 kcal/mol outside primersite
Amplicon SequenceCGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTGGGTCTCTTCGAGCCAG
GGGACATGCAGTACGAGCTGAACAGGAACAACGTGACGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000478 (ALPL)991075 - 1173
NM_001127501 (ALPL)99910 - 1008
NM_001177520 (ALPL)99794 - 892
 

See below for some more details.

Program Output:

Loading ...