Design Results for ANK2

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 3 (Pair 1)
Forward (211,23)TGGTATTTCAAATGACCACCATGAmplicon SizecDNA: 188 bpgenomic: 145,302
Reverse (398,21)CTGCCGTTGAACTTCTCTCCANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.791 kcal/mol in 3' area
Forward Dimers-1.804 kcal/mol
Reverse Loops2.108 kcal/mol
Reverse Dimers-0.044 kcal/mol
Forward-Reverse Dimers-0.813 kcal/mol
Amplicon Folding-1.727 kcal/mol outside primersite
Amplicon SequenceTGGTATTTCAAATGACCACCATGTTGCAAAAGCTCCTCCTCCTGCTTTCCTCCAGTAAGT
GCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATTTTCTTTCC
AAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAGAGAAGTTC
AACGGCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 2)
Forward (197,24)GAGACATGAAGAATTGGTATTTCAAmplicon SizecDNA: 203 bpgenomic: 145,317
Reverse (399,21)ACTGCCGTTGAACTTCTCTCCNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.137 kcal/mol
Forward Dimers-2.294 kcal/mol
Reverse Loops1.85 kcal/mol
Reverse Dimers-0.044 kcal/mol
Forward-Reverse Dimers-1.643 kcal/mol
Amplicon Folding-1.727 kcal/mol outside primersite
Amplicon SequenceGAGACATGAAGAATTGGTATTTCAAATGACCACCATGTTGCAAAAGCTCCTCCTCCTGCT
TTCCTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGA
GATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACA
GTGGAGAGAAGTTCAACGGCAGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 3)
Forward (196,24)AGAGACATGAAGAATTGGTATTTCAmplicon SizecDNA: 200 bpgenomic: 145,314
Reverse (395,21)CCGTTGAACTTCTCTCCACTGNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.137 kcal/mol
Forward Dimers-2.294 kcal/mol
Reverse Loops2.108 kcal/mol
Reverse Dimers-0.044 kcal/mol
Forward-Reverse Dimers-1.896 kcal/mol
Amplicon Folding-1.727 kcal/mol outside primersite
Amplicon SequenceAGAGACATGAAGAATTGGTATTTCAAATGACCACCATGTTGCAAAAGCTCCTCCTCCTGC
TTTCCTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAG
AGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGAC
AGTGGAGAGAAGTTCAACGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 4)
Forward (212,23)GGTATTTCAAATGACCACCATGTAmplicon SizecDNA: 185 bpgenomic: 145,299
Reverse (396,21)GCCGTTGAACTTCTCTCCACTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.791 kcal/mol in 3' area
Forward Dimers-1.207 kcal/mol
Reverse Loops2.108 kcal/mol
Reverse Dimers-0.044 kcal/mol
Forward-Reverse Dimers-0.813 kcal/mol
Amplicon Folding-1.727 kcal/mol outside primersite
Amplicon SequenceGGTATTTCAAATGACCACCATGTTGCAAAAGCTCCTCCTCCTGCTTTCCTCCAGTAAGTG
CATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATTTTCTTTCCA
AACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAGAGAAGTTCA
ACGGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 6)
Forward (197,24)GAGACATGAAGAATTGGTATTTCAAmplicon SizecDNA: 202 bpgenomic: 145,316
Reverse (398,21)CTGCCGTTGAACTTCTCTCCANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.137 kcal/mol
Forward Dimers-2.294 kcal/mol
Reverse Loops2.108 kcal/mol
Reverse Dimers-0.044 kcal/mol
Forward-Reverse Dimers-1.643 kcal/mol
Amplicon Folding-1.727 kcal/mol outside primersite
Amplicon SequenceGAGACATGAAGAATTGGTATTTCAAATGACCACCATGTTGCAAAAGCTCCTCCTCCTGCT
TTCCTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGA
GATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACA
GTGGAGAGAAGTTCAACGGCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 7)
Forward (197,24)GAGACATGAAGAATTGGTATTTCAAmplicon SizecDNA: 199 bpgenomic: 145,313
Reverse (395,21)CCGTTGAACTTCTCTCCACTGNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.137 kcal/mol
Forward Dimers-2.294 kcal/mol
Reverse Loops2.108 kcal/mol
Reverse Dimers-0.044 kcal/mol
Forward-Reverse Dimers-1.643 kcal/mol
Amplicon Folding-1.727 kcal/mol outside primersite
Amplicon SequenceGAGACATGAAGAATTGGTATTTCAAATGACCACCATGTTGCAAAAGCTCCTCCTCCTGCT
TTCCTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGA
GATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACA
GTGGAGAGAAGTTCAACGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 9)
Forward (211,23)TGGTATTTCAAATGACCACCATGAmplicon SizecDNA: 185 bpgenomic: 145,299
Reverse (395,21)CCGTTGAACTTCTCTCCACTGNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.791 kcal/mol in 3' area
Forward Dimers-1.804 kcal/mol
Reverse Loops2.108 kcal/mol
Reverse Dimers-0.044 kcal/mol
Forward-Reverse Dimers-0.813 kcal/mol
Amplicon Folding-1.727 kcal/mol outside primersite
Amplicon SequenceTGGTATTTCAAATGACCACCATGTTGCAAAAGCTCCTCCTCCTGCTTTCCTCCAGTAAGT
GCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATTTTCTTTCC
AAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAGAGAAGTTC
AACGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 12)
Forward (197,24)GAGACATGAAGAATTGGTATTTCAAmplicon SizecDNA: 201 bpgenomic: 145,315
Reverse (397,21)TGCCGTTGAACTTCTCTCCACNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.137 kcal/mol
Forward Dimers-2.294 kcal/mol
Reverse Loops2.108 kcal/mol
Reverse Dimers-0.044 kcal/mol
Forward-Reverse Dimers-1.643 kcal/mol
Amplicon Folding-1.727 kcal/mol outside primersite
Amplicon SequenceGAGACATGAAGAATTGGTATTTCAAATGACCACCATGTTGCAAAAGCTCCTCCTCCTGCT
TTCCTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGA
GATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACA
GTGGAGAGAAGTTCAACGGCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 14)
Forward (215,23)ATTTCAAATGACCACCATGTTGCAmplicon SizecDNA: 181 bpgenomic: 145,295
Reverse (395,21)CCGTTGAACTTCTCTCCACTGNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.791 kcal/mol
Forward Dimers-0.771 kcal/mol
Reverse Loops2.108 kcal/mol
Reverse Dimers-0.044 kcal/mol
Forward-Reverse Dimers-0.813 kcal/mol
Amplicon Folding-1.727 kcal/mol outside primersite
Amplicon SequenceATTTCAAATGACCACCATGTTGCAAAAGCTCCTCCTCCTGCTTTCCTCCAGTAAGTGCAT
ACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATTTTCTTTCCAAAC
TGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAGAGAAGTTCAACG
G
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 15)
Forward (197,24)GAGACATGAAGAATTGGTATTTCAAmplicon SizecDNA: 200 bpgenomic: 145,314
Reverse (396,21)GCCGTTGAACTTCTCTCCACTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.137 kcal/mol
Forward Dimers-2.294 kcal/mol
Reverse Loops2.108 kcal/mol
Reverse Dimers-0.044 kcal/mol
Forward-Reverse Dimers-1.643 kcal/mol
Amplicon Folding-1.727 kcal/mol outside primersite
Amplicon SequenceGAGACATGAAGAATTGGTATTTCAAATGACCACCATGTTGCAAAAGCTCCTCCTCCTGCT
TTCCTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGA
GATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACA
GTGGAGAGAAGTTCAACGGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 17)
Forward (212,23)GGTATTTCAAATGACCACCATGTAmplicon SizecDNA: 184 bpgenomic: 145,298
Reverse (395,21)CCGTTGAACTTCTCTCCACTGNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.791 kcal/mol in 3' area
Forward Dimers-1.207 kcal/mol
Reverse Loops2.108 kcal/mol
Reverse Dimers-0.044 kcal/mol
Forward-Reverse Dimers-0.813 kcal/mol
Amplicon Folding-1.727 kcal/mol outside primersite
Amplicon SequenceGGTATTTCAAATGACCACCATGTTGCAAAAGCTCCTCCTCCTGCTTTCCTCCAGTAAGTG
CATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATTTTCTTTCCA
AACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAGAGAAGTTCA
ACGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 19)
Forward (215,23)ATTTCAAATGACCACCATGTTGCAmplicon SizecDNA: 182 bpgenomic: 145,296
Reverse (396,21)GCCGTTGAACTTCTCTCCACTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.791 kcal/mol
Forward Dimers-0.771 kcal/mol
Reverse Loops2.108 kcal/mol
Reverse Dimers-0.044 kcal/mol
Forward-Reverse Dimers-0.813 kcal/mol
Amplicon Folding-1.727 kcal/mol outside primersite
Amplicon SequenceATTTCAAATGACCACCATGTTGCAAAAGCTCCTCCTCCTGCTTTCCTCCAGTAAGTGCAT
ACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATTTTCTTTCCAAAC
TGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAGAGAAGTTCAACG
GC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 20)
Forward (215,23)ATTTCAAATGACCACCATGTTGCAmplicon SizecDNA: 183 bpgenomic: 145,297
Reverse (397,21)TGCCGTTGAACTTCTCTCCACNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.791 kcal/mol
Forward Dimers-0.771 kcal/mol
Reverse Loops2.108 kcal/mol
Reverse Dimers-0.044 kcal/mol
Forward-Reverse Dimers-0.813 kcal/mol
Amplicon Folding-1.727 kcal/mol outside primersite
Amplicon SequenceATTTCAAATGACCACCATGTTGCAAAAGCTCCTCCTCCTGCTTTCCTCCAGTAAGTGCAT
ACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATTTTCTTTCCAAAC
TGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAGAGAAGTTCAACG
GCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 21)
Forward (211,23)TGGTATTTCAAATGACCACCATGAmplicon SizecDNA: 187 bpgenomic: 145,301
Reverse (397,21)TGCCGTTGAACTTCTCTCCACNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.791 kcal/mol in 3' area
Forward Dimers-1.804 kcal/mol
Reverse Loops2.108 kcal/mol
Reverse Dimers-0.044 kcal/mol
Forward-Reverse Dimers-0.813 kcal/mol
Amplicon Folding-1.727 kcal/mol outside primersite
Amplicon SequenceTGGTATTTCAAATGACCACCATGTTGCAAAAGCTCCTCCTCCTGCTTTCCTCCAGTAAGT
GCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATTTTCTTTCC
AAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAGAGAAGTTC
AACGGCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 22)
Forward (212,23)GGTATTTCAAATGACCACCATGTAmplicon SizecDNA: 187 bpgenomic: 145,301
Reverse (398,21)CTGCCGTTGAACTTCTCTCCANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.791 kcal/mol in 3' area
Forward Dimers-1.207 kcal/mol
Reverse Loops2.108 kcal/mol
Reverse Dimers-0.044 kcal/mol
Forward-Reverse Dimers-0.813 kcal/mol
Amplicon Folding-1.727 kcal/mol outside primersite
Amplicon SequenceGGTATTTCAAATGACCACCATGTTGCAAAAGCTCCTCCTCCTGCTTTCCTCCAGTAAGTG
CATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATTTTCTTTCCA
AACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAGAGAAGTTCA
ACGGCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 23)
Forward (215,23)ATTTCAAATGACCACCATGTTGCAmplicon SizecDNA: 184 bpgenomic: 145,298
Reverse (398,21)CTGCCGTTGAACTTCTCTCCANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.791 kcal/mol
Forward Dimers-0.771 kcal/mol
Reverse Loops2.108 kcal/mol
Reverse Dimers-0.044 kcal/mol
Forward-Reverse Dimers-0.813 kcal/mol
Amplicon Folding-1.727 kcal/mol outside primersite
Amplicon SequenceATTTCAAATGACCACCATGTTGCAAAAGCTCCTCCTCCTGCTTTCCTCCAGTAAGTGCAT
ACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATTTTCTTTCCAAAC
TGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAGAGAAGTTCAACG
GCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 24)
Forward (211,23)TGGTATTTCAAATGACCACCATGAmplicon SizecDNA: 186 bpgenomic: 145,300
Reverse (396,21)GCCGTTGAACTTCTCTCCACTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.791 kcal/mol in 3' area
Forward Dimers-1.804 kcal/mol
Reverse Loops2.108 kcal/mol
Reverse Dimers-0.044 kcal/mol
Forward-Reverse Dimers-0.813 kcal/mol
Amplicon Folding-1.727 kcal/mol outside primersite
Amplicon SequenceTGGTATTTCAAATGACCACCATGTTGCAAAAGCTCCTCCTCCTGCTTTCCTCCAGTAAGT
GCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATTTTCTTTCC
AAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAGAGAAGTTC
AACGGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 25)
Forward (212,23)GGTATTTCAAATGACCACCATGTAmplicon SizecDNA: 186 bpgenomic: 145,300
Reverse (397,21)TGCCGTTGAACTTCTCTCCACNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.791 kcal/mol in 3' area
Forward Dimers-1.207 kcal/mol
Reverse Loops2.108 kcal/mol
Reverse Dimers-0.044 kcal/mol
Forward-Reverse Dimers-0.813 kcal/mol
Amplicon Folding-1.727 kcal/mol outside primersite
Amplicon SequenceGGTATTTCAAATGACCACCATGTTGCAAAAGCTCCTCCTCCTGCTTTCCTCCAGTAAGTG
CATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATTTTCTTTCCA
AACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAGAGAAGTTCA
ACGGCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 26)
Forward (215,23)ATTTCAAATGACCACCATGTTGCAmplicon SizecDNA: 185 bpgenomic: 145,299
Reverse (399,21)ACTGCCGTTGAACTTCTCTCCNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.791 kcal/mol
Forward Dimers-0.771 kcal/mol
Reverse Loops1.85 kcal/mol
Reverse Dimers-0.044 kcal/mol
Forward-Reverse Dimers-0.813 kcal/mol
Amplicon Folding-1.727 kcal/mol outside primersite
Amplicon SequenceATTTCAAATGACCACCATGTTGCAAAAGCTCCTCCTCCTGCTTTCCTCCAGTAAGTGCAT
ACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATTTTCTTTCCAAAC
TGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAGAGAAGTTCAACG
GCAGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 27)
Forward (211,23)TGGTATTTCAAATGACCACCATGAmplicon SizecDNA: 192 bpgenomic: 145,306
Reverse (402,22)ACTACTGCCGTTGAACTTCTCTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.791 kcal/mol in 3' area
Forward Dimers-1.804 kcal/mol
Reverse Loops1.62 kcal/mol
Reverse Dimers-0.044 kcal/mol
Forward-Reverse Dimers-0.813 kcal/mol
Amplicon Folding-1.727 kcal/mol outside primersite
Amplicon SequenceTGGTATTTCAAATGACCACCATGTTGCAAAAGCTCCTCCTCCTGCTTTCCTCCAGTAAGT
GCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATTTTCTTTCC
AAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAGAGAAGTTC
AACGGCAGTAGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 28)
Forward (212,23)GGTATTTCAAATGACCACCATGTAmplicon SizecDNA: 188 bpgenomic: 145,302
Reverse (399,21)ACTGCCGTTGAACTTCTCTCCNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.791 kcal/mol in 3' area
Forward Dimers-1.207 kcal/mol
Reverse Loops1.85 kcal/mol
Reverse Dimers-0.044 kcal/mol
Forward-Reverse Dimers-0.813 kcal/mol
Amplicon Folding-1.727 kcal/mol outside primersite
Amplicon SequenceGGTATTTCAAATGACCACCATGTTGCAAAAGCTCCTCCTCCTGCTTTCCTCCAGTAAGTG
CATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATTTTCTTTCCA
AACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAGAGAAGTTCA
ACGGCAGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 31)
Forward (212,23)GGTATTTCAAATGACCACCATGTAmplicon SizecDNA: 191 bpgenomic: 145,305
Reverse (402,22)ACTACTGCCGTTGAACTTCTCTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.791 kcal/mol in 3' area
Forward Dimers-1.207 kcal/mol
Reverse Loops1.62 kcal/mol
Reverse Dimers-0.044 kcal/mol
Forward-Reverse Dimers-0.813 kcal/mol
Amplicon Folding-1.727 kcal/mol outside primersite
Amplicon SequenceGGTATTTCAAATGACCACCATGTTGCAAAAGCTCCTCCTCCTGCTTTCCTCCAGTAAGTG
CATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATTTTCTTTCCA
AACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAGAGAAGTTCA
ACGGCAGTAGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 32)
Forward (211,23)TGGTATTTCAAATGACCACCATGAmplicon SizecDNA: 189 bpgenomic: 145,303
Reverse (399,21)ACTGCCGTTGAACTTCTCTCCNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.791 kcal/mol in 3' area
Forward Dimers-1.804 kcal/mol
Reverse Loops1.85 kcal/mol
Reverse Dimers-0.044 kcal/mol
Forward-Reverse Dimers-0.813 kcal/mol
Amplicon Folding-1.727 kcal/mol outside primersite
Amplicon SequenceTGGTATTTCAAATGACCACCATGTTGCAAAAGCTCCTCCTCCTGCTTTCCTCCAGTAAGT
GCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATTTTCTTTCC
AAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAGAGAAGTTC
AACGGCAGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 33)
Forward (196,24)AGAGACATGAAGAATTGGTATTTCAmplicon SizecDNA: 201 bpgenomic: 145,315
Reverse (396,21)GCCGTTGAACTTCTCTCCACTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.137 kcal/mol
Forward Dimers-2.294 kcal/mol
Reverse Loops2.108 kcal/mol
Reverse Dimers-0.044 kcal/mol
Forward-Reverse Dimers-1.896 kcal/mol
Amplicon Folding-1.727 kcal/mol outside primersite
Amplicon SequenceAGAGACATGAAGAATTGGTATTTCAAATGACCACCATGTTGCAAAAGCTCCTCCTCCTGC
TTTCCTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAG
AGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGAC
AGTGGAGAGAAGTTCAACGGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 34)
Forward (215,23)ATTTCAAATGACCACCATGTTGCAmplicon SizecDNA: 188 bpgenomic: 145,302
Reverse (402,22)ACTACTGCCGTTGAACTTCTCTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.791 kcal/mol
Forward Dimers-0.771 kcal/mol
Reverse Loops1.62 kcal/mol
Reverse Dimers-0.044 kcal/mol
Forward-Reverse Dimers-0.813 kcal/mol
Amplicon Folding-1.727 kcal/mol outside primersite
Amplicon SequenceATTTCAAATGACCACCATGTTGCAAAAGCTCCTCCTCCTGCTTTCCTCCAGTAAGTGCAT
ACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATTTTCTTTCCAAAC
TGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAGAGAAGTTCAACG
GCAGTAGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 2)
Forward (263,21)CAGTAAGTGCATACCCGCTAGAmplicon SizecDNA: 213 bpgenomic: 57,263
Reverse (475,22)AGGCAGGAGATGGACCTTTATTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.986 kcal/mol
Forward-Reverse Dimers-1.872 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATT
TTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAG
AGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCAAT
TATAGGAGTGAAATAAAGGTCCATCTCCTGCCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 4)
Forward (258,21)TCCTCCAGTAAGTGCATACCCAmplicon SizecDNA: 209 bpgenomic: 57,259
Reverse (466,24)ATGGACCTTTATTTCACTCCTATANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.906 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops2.149 kcal/mol in 3' area
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-2.103 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceTCCTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAG
ATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAG
TGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGA
TCAATTATAGGAGTGAAATAAAGGTCCAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 5)
Forward (263,21)CAGTAAGTGCATACCCGCTAGAmplicon SizecDNA: 211 bpgenomic: 57,261
Reverse (473,22)GCAGGAGATGGACCTTTATTTCNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.986 kcal/mol
Forward-Reverse Dimers-1.872 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATT
TTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAG
AGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCAAT
TATAGGAGTGAAATAAAGGTCCATCTCCTGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 7)
Forward (258,21)TCCTCCAGTAAGTGCATACCCAmplicon SizecDNA: 217 bpgenomic: 57,267
Reverse (474,22)GGCAGGAGATGGACCTTTATTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.906 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.986 kcal/mol
Forward-Reverse Dimers-2.519 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceTCCTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAG
ATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAG
TGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGA
TCAATTATAGGAGTGAAATAAAGGTCCATCTCCTGCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 9)
Forward (300,22)CACGGTTTGATGGCAGAGATATAmplicon SizecDNA: 165 bpgenomic: 57,215
Reverse (464,24)GGACCTTTATTTCACTCCTATAATNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-1.395 kcal/mol
Reverse Loops2.42 kcal/mol
Reverse Dimers-0.295 kcal/mol
Forward-Reverse Dimers-1.506 kcal/mol
Amplicon Folding0.256 kcal/mol inside primersite
Amplicon SequenceCACGGTTTGATGGCAGAGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGC
AGCTCAGAAAAGCGACAGTGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACC
CAAGAAGCTAAAACTGGATCAATTATAGGAGTGAAATAAAGGTCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 11)
Forward (263,21)CAGTAAGTGCATACCCGCTAGAmplicon SizecDNA: 203 bpgenomic: 57,253
Reverse (465,24)TGGACCTTTATTTCACTCCTATAANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol
Reverse Loops2.149 kcal/mol
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-2.103 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATT
TTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAG
AGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCAAT
TATAGGAGTGAAATAAAGGTCCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 14)
Forward (244,20)TCCTCCTCCTGCTTTCCTCCAmplicon SizecDNA: 221 bpgenomic: 57,271
Reverse (464,24)GGACCTTTATTTCACTCCTATAATNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops999.483 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops2.42 kcal/mol
Reverse Dimers-0.295 kcal/mol
Forward-Reverse Dimers-0.516 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceTCCTCCTCCTGCTTTCCTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACG
GTTTGATGGCAGAGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCT
CAGAAAAGCGACAGTGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAG
AAGCTAAAACTGGATCAATTATAGGAGTGAAATAAAGGTCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 16)
Forward (258,21)TCCTCCAGTAAGTGCATACCCAmplicon SizecDNA: 207 bpgenomic: 57,257
Reverse (464,24)GGACCTTTATTTCACTCCTATAATNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.906 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops2.42 kcal/mol
Reverse Dimers-0.295 kcal/mol
Forward-Reverse Dimers-2.103 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceTCCTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAG
ATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAG
TGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGA
TCAATTATAGGAGTGAAATAAAGGTCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 17)
Forward (265,21)GTAAGTGCATACCCGCTAGTGAmplicon SizecDNA: 211 bpgenomic: 57,261
Reverse (475,22)AGGCAGGAGATGGACCTTTATTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.986 kcal/mol
Forward-Reverse Dimers-1.872 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATTTT
CTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAGAG
AAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCAATTA
TAGGAGTGAAATAAAGGTCCATCTCCTGCCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 18)
Forward (258,21)TCCTCCAGTAAGTGCATACCCAmplicon SizecDNA: 218 bpgenomic: 57,268
Reverse (475,22)AGGCAGGAGATGGACCTTTATTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.906 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.986 kcal/mol
Forward-Reverse Dimers-2.519 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceTCCTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAG
ATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAG
TGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGA
TCAATTATAGGAGTGAAATAAAGGTCCATCTCCTGCCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 20)
Forward (265,21)GTAAGTGCATACCCGCTAGTGAmplicon SizecDNA: 210 bpgenomic: 57,260
Reverse (474,22)GGCAGGAGATGGACCTTTATTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.986 kcal/mol
Forward-Reverse Dimers-1.872 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATTTT
CTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAGAG
AAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCAATTA
TAGGAGTGAAATAAAGGTCCATCTCCTGCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 21)
Forward (263,21)CAGTAAGTGCATACCCGCTAGAmplicon SizecDNA: 202 bpgenomic: 57,252
Reverse (464,24)GGACCTTTATTTCACTCCTATAATNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol
Reverse Loops2.42 kcal/mol
Reverse Dimers-0.295 kcal/mol
Forward-Reverse Dimers-2.103 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATT
TTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAG
AGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCAAT
TATAGGAGTGAAATAAAGGTCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 23)
Forward (261,21)TCCAGTAAGTGCATACCCGCTAmplicon SizecDNA: 204 bpgenomic: 57,254
Reverse (464,24)GGACCTTTATTTCACTCCTATAATNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol
Reverse Loops2.42 kcal/mol
Reverse Dimers-0.295 kcal/mol
Forward-Reverse Dimers-2.103 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATA
TTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGG
AGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCA
ATTATAGGAGTGAAATAAAGGTCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 24)
Forward (301,23)ACGGTTTGATGGCAGAGATATTTAmplicon SizecDNA: 165 bpgenomic: 57,215
Reverse (465,24)TGGACCTTTATTTCACTCCTATAANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.639 kcal/mol in 3' area
Forward Dimers-1.395 kcal/mol
Reverse Loops2.149 kcal/mol
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-1.506 kcal/mol
Amplicon Folding0.303 kcal/mol outside primersite
Amplicon SequenceACGGTTTGATGGCAGAGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCA
GCTCAGAAAAGCGACAGTGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCC
AAGAAGCTAAAACTGGATCAATTATAGGAGTGAAATAAAGGTCCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 27)
Forward (249,21)CTCCTGCTTTCCTCCAGTAAGAmplicon SizecDNA: 223 bpgenomic: 57,273
Reverse (471,23)AGGAGATGGACCTTTATTTCACTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.283 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops1.282 kcal/mol
Reverse Dimers-1.512 kcal/mol
Forward-Reverse Dimers-2.819 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceCTCCTGCTTTCCTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTG
ATGGCAGAGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAA
AAGCGACAGTGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCT
AAAACTGGATCAATTATAGGAGTGAAATAAAGGTCCATCTCCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 29)
Forward (261,21)TCCAGTAAGTGCATACCCGCTAmplicon SizecDNA: 215 bpgenomic: 57,265
Reverse (475,22)AGGCAGGAGATGGACCTTTATTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.986 kcal/mol
Forward-Reverse Dimers-1.872 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATA
TTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGG
AGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCA
ATTATAGGAGTGAAATAAAGGTCCATCTCCTGCCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 30)
Forward (301,23)ACGGTTTGATGGCAGAGATATTTAmplicon SizecDNA: 168 bpgenomic: 57,218
Reverse (468,23)AGATGGACCTTTATTTCACTCCTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.639 kcal/mol in 3' area
Forward Dimers-1.395 kcal/mol
Reverse Loops2.149 kcal/mol in 3' area
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-1.506 kcal/mol
Amplicon Folding0.303 kcal/mol outside primersite
Amplicon SequenceACGGTTTGATGGCAGAGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCA
GCTCAGAAAAGCGACAGTGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCC
AAGAAGCTAAAACTGGATCAATTATAGGAGTGAAATAAAGGTCCATCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 32)
Forward (262,21)CCAGTAAGTGCATACCCGCTAAmplicon SizecDNA: 204 bpgenomic: 57,254
Reverse (465,24)TGGACCTTTATTTCACTCCTATAANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol
Reverse Loops2.149 kcal/mol
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-2.103 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATAT
TTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGA
GAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCAA
TTATAGGAGTGAAATAAAGGTCCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 34)
Forward (244,20)TCCTCCTCCTGCTTTCCTCCAmplicon SizecDNA: 222 bpgenomic: 57,272
Reverse (465,24)TGGACCTTTATTTCACTCCTATAANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops999.483 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops2.149 kcal/mol
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-0.787 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceTCCTCCTCCTGCTTTCCTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACG
GTTTGATGGCAGAGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCT
CAGAAAAGCGACAGTGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAG
AAGCTAAAACTGGATCAATTATAGGAGTGAAATAAAGGTCCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 35)
Forward (262,21)CCAGTAAGTGCATACCCGCTAAmplicon SizecDNA: 205 bpgenomic: 57,255
Reverse (466,24)ATGGACCTTTATTTCACTCCTATANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol
Reverse Loops2.149 kcal/mol in 3' area
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-2.103 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATAT
TTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGA
GAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCAA
TTATAGGAGTGAAATAAAGGTCCAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 36)
Forward (265,21)GTAAGTGCATACCCGCTAGTGAmplicon SizecDNA: 202 bpgenomic: 57,252
Reverse (466,24)ATGGACCTTTATTTCACTCCTATANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops2.149 kcal/mol in 3' area
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-2.103 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATTTT
CTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAGAG
AAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCAATTA
TAGGAGTGAAATAAAGGTCCAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 37)
Forward (299,21)GCACGGTTTGATGGCAGAGATAmplicon SizecDNA: 170 bpgenomic: 57,220
Reverse (468,23)AGATGGACCTTTATTTCACTCCTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.243 kcal/mol
Forward Dimers-1.395 kcal/mol
Reverse Loops2.149 kcal/mol in 3' area
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-1.506 kcal/mol
Amplicon Folding0.256 kcal/mol inside primersite
Amplicon SequenceGCACGGTTTGATGGCAGAGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATG
CAGCTCAGAAAAGCGACAGTGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGAC
CCAAGAAGCTAAAACTGGATCAATTATAGGAGTGAAATAAAGGTCCATCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 39)
Forward (265,21)GTAAGTGCATACCCGCTAGTGAmplicon SizecDNA: 201 bpgenomic: 57,251
Reverse (465,24)TGGACCTTTATTTCACTCCTATAANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops2.149 kcal/mol
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-2.103 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATTTT
CTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAGAG
AAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCAATTA
TAGGAGTGAAATAAAGGTCCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 40)
Forward (243,20)CTCCTCCTCCTGCTTTCCTCAmplicon SizecDNA: 223 bpgenomic: 57,273
Reverse (465,24)TGGACCTTTATTTCACTCCTATAANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops999.483 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops2.149 kcal/mol
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-0.787 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceCTCCTCCTCCTGCTTTCCTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCAC
GGTTTGATGGCAGAGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGC
TCAGAAAAGCGACAGTGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAA
GAAGCTAAAACTGGATCAATTATAGGAGTGAAATAAAGGTCCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 41)
Forward (261,21)TCCAGTAAGTGCATACCCGCTAmplicon SizecDNA: 213 bpgenomic: 57,263
Reverse (473,22)GCAGGAGATGGACCTTTATTTCNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.986 kcal/mol
Forward-Reverse Dimers-1.872 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATA
TTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGG
AGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCA
ATTATAGGAGTGAAATAAAGGTCCATCTCCTGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 42)
Forward (263,21)CAGTAAGTGCATACCCGCTAGAmplicon SizecDNA: 204 bpgenomic: 57,254
Reverse (466,24)ATGGACCTTTATTTCACTCCTATANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol
Reverse Loops2.149 kcal/mol in 3' area
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-2.103 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATT
TTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAG
AGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCAAT
TATAGGAGTGAAATAAAGGTCCAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 46)
Forward (258,21)TCCTCCAGTAAGTGCATACCCAmplicon SizecDNA: 208 bpgenomic: 57,258
Reverse (465,24)TGGACCTTTATTTCACTCCTATAANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.906 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops2.149 kcal/mol
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-2.103 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceTCCTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAG
ATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAG
TGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGA
TCAATTATAGGAGTGAAATAAAGGTCCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 51)
Forward (262,21)CCAGTAAGTGCATACCCGCTAAmplicon SizecDNA: 203 bpgenomic: 57,253
Reverse (464,24)GGACCTTTATTTCACTCCTATAATNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol
Reverse Loops2.42 kcal/mol
Reverse Dimers-0.295 kcal/mol
Forward-Reverse Dimers-2.103 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATAT
TTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGA
GAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCAA
TTATAGGAGTGAAATAAAGGTCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 54)
Forward (244,20)TCCTCCTCCTGCTTTCCTCCAmplicon SizecDNA: 223 bpgenomic: 57,273
Reverse (466,24)ATGGACCTTTATTTCACTCCTATANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops999.483 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops2.149 kcal/mol in 3' area
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-0.787 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceTCCTCCTCCTGCTTTCCTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACG
GTTTGATGGCAGAGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCT
CAGAAAAGCGACAGTGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAG
AAGCTAAAACTGGATCAATTATAGGAGTGAAATAAAGGTCCAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 55)
Forward (262,21)CCAGTAAGTGCATACCCGCTAAmplicon SizecDNA: 214 bpgenomic: 57,264
Reverse (475,22)AGGCAGGAGATGGACCTTTATTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.986 kcal/mol
Forward-Reverse Dimers-1.872 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATAT
TTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGA
GAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCAA
TTATAGGAGTGAAATAAAGGTCCATCTCCTGCCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 56)
Forward (262,21)CCAGTAAGTGCATACCCGCTAAmplicon SizecDNA: 210 bpgenomic: 57,260
Reverse (471,23)AGGAGATGGACCTTTATTTCACTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol
Reverse Loops1.282 kcal/mol
Reverse Dimers-1.512 kcal/mol
Forward-Reverse Dimers-1.872 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATAT
TTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGA
GAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCAA
TTATAGGAGTGAAATAAAGGTCCATCTCCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 57)
Forward (265,21)GTAAGTGCATACCCGCTAGTGAmplicon SizecDNA: 200 bpgenomic: 57,250
Reverse (464,24)GGACCTTTATTTCACTCCTATAATNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops2.42 kcal/mol
Reverse Dimers-0.295 kcal/mol
Forward-Reverse Dimers-2.103 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATTTT
CTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAGAG
AAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCAATTA
TAGGAGTGAAATAAAGGTCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 60)
Forward (243,20)CTCCTCCTCCTGCTTTCCTCAmplicon SizecDNA: 225 bpgenomic: 57,275
Reverse (467,23)GATGGACCTTTATTTCACTCCTANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops999.483 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops2.149 kcal/mol in 3' area
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-0.787 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceCTCCTCCTCCTGCTTTCCTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCAC
GGTTTGATGGCAGAGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGC
TCAGAAAAGCGACAGTGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAA
GAAGCTAAAACTGGATCAATTATAGGAGTGAAATAAAGGTCCATC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 61)
Forward (243,20)CTCCTCCTCCTGCTTTCCTCAmplicon SizecDNA: 222 bpgenomic: 57,272
Reverse (464,24)GGACCTTTATTTCACTCCTATAATNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops999.483 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops2.42 kcal/mol
Reverse Dimers-0.295 kcal/mol
Forward-Reverse Dimers-0.516 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceCTCCTCCTCCTGCTTTCCTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCAC
GGTTTGATGGCAGAGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGC
TCAGAAAAGCGACAGTGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAA
GAAGCTAAAACTGGATCAATTATAGGAGTGAAATAAAGGTCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 62)
Forward (258,21)TCCTCCAGTAAGTGCATACCCAmplicon SizecDNA: 216 bpgenomic: 57,266
Reverse (473,22)GCAGGAGATGGACCTTTATTTCNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.906 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.986 kcal/mol
Forward-Reverse Dimers-2.519 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceTCCTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAG
ATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAG
TGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGA
TCAATTATAGGAGTGAAATAAAGGTCCATCTCCTGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 63)
Forward (300,22)CACGGTTTGATGGCAGAGATATAmplicon SizecDNA: 166 bpgenomic: 57,216
Reverse (465,24)TGGACCTTTATTTCACTCCTATAANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-1.395 kcal/mol
Reverse Loops2.149 kcal/mol
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-1.506 kcal/mol
Amplicon Folding0.256 kcal/mol inside primersite
Amplicon SequenceCACGGTTTGATGGCAGAGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGC
AGCTCAGAAAAGCGACAGTGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACC
CAAGAAGCTAAAACTGGATCAATTATAGGAGTGAAATAAAGGTCCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 64)
Forward (244,20)TCCTCCTCCTGCTTTCCTCCAmplicon SizecDNA: 224 bpgenomic: 57,274
Reverse (467,23)GATGGACCTTTATTTCACTCCTANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops999.483 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops2.149 kcal/mol in 3' area
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-0.787 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceTCCTCCTCCTGCTTTCCTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACG
GTTTGATGGCAGAGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCT
CAGAAAAGCGACAGTGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAG
AAGCTAAAACTGGATCAATTATAGGAGTGAAATAAAGGTCCATC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 67)
Forward (299,21)GCACGGTTTGATGGCAGAGATAmplicon SizecDNA: 168 bpgenomic: 57,218
Reverse (466,24)ATGGACCTTTATTTCACTCCTATANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.243 kcal/mol
Forward Dimers-1.395 kcal/mol
Reverse Loops2.149 kcal/mol in 3' area
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-1.506 kcal/mol
Amplicon Folding0.256 kcal/mol inside primersite
Amplicon SequenceGCACGGTTTGATGGCAGAGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATG
CAGCTCAGAAAAGCGACAGTGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGAC
CCAAGAAGCTAAAACTGGATCAATTATAGGAGTGAAATAAAGGTCCAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 68)
Forward (299,21)GCACGGTTTGATGGCAGAGATAmplicon SizecDNA: 169 bpgenomic: 57,219
Reverse (467,23)GATGGACCTTTATTTCACTCCTANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.243 kcal/mol
Forward Dimers-1.395 kcal/mol
Reverse Loops2.149 kcal/mol in 3' area
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-1.506 kcal/mol
Amplicon Folding0.256 kcal/mol inside primersite
Amplicon SequenceGCACGGTTTGATGGCAGAGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATG
CAGCTCAGAAAAGCGACAGTGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGAC
CCAAGAAGCTAAAACTGGATCAATTATAGGAGTGAAATAAAGGTCCATC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 70)
Forward (243,20)CTCCTCCTCCTGCTTTCCTCAmplicon SizecDNA: 224 bpgenomic: 57,274
Reverse (466,24)ATGGACCTTTATTTCACTCCTATANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops999.483 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops2.149 kcal/mol in 3' area
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-0.787 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceCTCCTCCTCCTGCTTTCCTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCAC
GGTTTGATGGCAGAGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGC
TCAGAAAAGCGACAGTGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAA
GAAGCTAAAACTGGATCAATTATAGGAGTGAAATAAAGGTCCAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 71)
Forward (301,23)ACGGTTTGATGGCAGAGATATTTAmplicon SizecDNA: 166 bpgenomic: 57,216
Reverse (466,24)ATGGACCTTTATTTCACTCCTATANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.639 kcal/mol in 3' area
Forward Dimers-1.395 kcal/mol
Reverse Loops2.149 kcal/mol in 3' area
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-1.506 kcal/mol
Amplicon Folding0.303 kcal/mol outside primersite
Amplicon SequenceACGGTTTGATGGCAGAGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCA
GCTCAGAAAAGCGACAGTGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCC
AAGAAGCTAAAACTGGATCAATTATAGGAGTGAAATAAAGGTCCAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 72)
Forward (261,21)TCCAGTAAGTGCATACCCGCTAmplicon SizecDNA: 214 bpgenomic: 57,264
Reverse (474,22)GGCAGGAGATGGACCTTTATTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.986 kcal/mol
Forward-Reverse Dimers-1.872 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATA
TTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGG
AGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCA
ATTATAGGAGTGAAATAAAGGTCCATCTCCTGCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 73)
Forward (263,21)CAGTAAGTGCATACCCGCTAGAmplicon SizecDNA: 209 bpgenomic: 57,259
Reverse (471,23)AGGAGATGGACCTTTATTTCACTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol
Reverse Loops1.282 kcal/mol
Reverse Dimers-1.512 kcal/mol
Forward-Reverse Dimers-1.872 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATT
TTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAG
AGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCAAT
TATAGGAGTGAAATAAAGGTCCATCTCCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 74)
Forward (262,21)CCAGTAAGTGCATACCCGCTAAmplicon SizecDNA: 213 bpgenomic: 57,263
Reverse (474,22)GGCAGGAGATGGACCTTTATTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.986 kcal/mol
Forward-Reverse Dimers-1.872 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATAT
TTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGA
GAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCAA
TTATAGGAGTGAAATAAAGGTCCATCTCCTGCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 75)
Forward (265,21)GTAAGTGCATACCCGCTAGTGAmplicon SizecDNA: 207 bpgenomic: 57,257
Reverse (471,23)AGGAGATGGACCTTTATTTCACTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops1.282 kcal/mol
Reverse Dimers-1.512 kcal/mol
Forward-Reverse Dimers-1.872 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATTTT
CTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAGAG
AAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCAATTA
TAGGAGTGAAATAAAGGTCCATCTCCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 77)
Forward (258,21)TCCTCCAGTAAGTGCATACCCAmplicon SizecDNA: 214 bpgenomic: 57,264
Reverse (471,23)AGGAGATGGACCTTTATTTCACTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.906 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops1.282 kcal/mol
Reverse Dimers-1.512 kcal/mol
Forward-Reverse Dimers-2.519 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceTCCTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAG
ATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAG
TGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGA
TCAATTATAGGAGTGAAATAAAGGTCCATCTCCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 80)
Forward (299,21)GCACGGTTTGATGGCAGAGATAmplicon SizecDNA: 167 bpgenomic: 57,217
Reverse (465,24)TGGACCTTTATTTCACTCCTATAANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.243 kcal/mol
Forward Dimers-1.395 kcal/mol
Reverse Loops2.149 kcal/mol
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-1.506 kcal/mol
Amplicon Folding0.256 kcal/mol inside primersite
Amplicon SequenceGCACGGTTTGATGGCAGAGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATG
CAGCTCAGAAAAGCGACAGTGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGAC
CCAAGAAGCTAAAACTGGATCAATTATAGGAGTGAAATAAAGGTCCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 81)
Forward (244,20)TCCTCCTCCTGCTTTCCTCCAmplicon SizecDNA: 225 bpgenomic: 57,275
Reverse (468,23)AGATGGACCTTTATTTCACTCCTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops999.483 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops2.149 kcal/mol in 3' area
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-0.787 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceTCCTCCTCCTGCTTTCCTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACG
GTTTGATGGCAGAGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCT
CAGAAAAGCGACAGTGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAG
AAGCTAAAACTGGATCAATTATAGGAGTGAAATAAAGGTCCATCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 86)
Forward (261,21)TCCAGTAAGTGCATACCCGCTAmplicon SizecDNA: 211 bpgenomic: 57,261
Reverse (471,23)AGGAGATGGACCTTTATTTCACTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol
Reverse Loops1.282 kcal/mol
Reverse Dimers-1.512 kcal/mol
Forward-Reverse Dimers-1.872 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATA
TTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGG
AGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCA
ATTATAGGAGTGAAATAAAGGTCCATCTCCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 87)
Forward (300,22)CACGGTTTGATGGCAGAGATATAmplicon SizecDNA: 167 bpgenomic: 57,217
Reverse (466,24)ATGGACCTTTATTTCACTCCTATANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-1.395 kcal/mol
Reverse Loops2.149 kcal/mol in 3' area
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-1.506 kcal/mol
Amplicon Folding0.256 kcal/mol inside primersite
Amplicon SequenceCACGGTTTGATGGCAGAGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGC
AGCTCAGAAAAGCGACAGTGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACC
CAAGAAGCTAAAACTGGATCAATTATAGGAGTGAAATAAAGGTCCAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 88)
Forward (261,21)TCCAGTAAGTGCATACCCGCTAmplicon SizecDNA: 205 bpgenomic: 57,255
Reverse (465,24)TGGACCTTTATTTCACTCCTATAANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol
Reverse Loops2.149 kcal/mol
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-2.103 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATA
TTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGG
AGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCA
ATTATAGGAGTGAAATAAAGGTCCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 90)
Forward (300,22)CACGGTTTGATGGCAGAGATATAmplicon SizecDNA: 169 bpgenomic: 57,219
Reverse (468,23)AGATGGACCTTTATTTCACTCCTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-1.395 kcal/mol
Reverse Loops2.149 kcal/mol in 3' area
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-1.506 kcal/mol
Amplicon Folding0.256 kcal/mol inside primersite
Amplicon SequenceCACGGTTTGATGGCAGAGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGC
AGCTCAGAAAAGCGACAGTGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACC
CAAGAAGCTAAAACTGGATCAATTATAGGAGTGAAATAAAGGTCCATCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 91)
Forward (262,21)CCAGTAAGTGCATACCCGCTAAmplicon SizecDNA: 212 bpgenomic: 57,262
Reverse (473,22)GCAGGAGATGGACCTTTATTTCNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.986 kcal/mol
Forward-Reverse Dimers-1.872 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATAT
TTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGA
GAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCAA
TTATAGGAGTGAAATAAAGGTCCATCTCCTGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 93)
Forward (299,21)GCACGGTTTGATGGCAGAGATAmplicon SizecDNA: 166 bpgenomic: 57,216
Reverse (464,24)GGACCTTTATTTCACTCCTATAATNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.243 kcal/mol
Forward Dimers-1.395 kcal/mol
Reverse Loops2.42 kcal/mol
Reverse Dimers-0.295 kcal/mol
Forward-Reverse Dimers-1.506 kcal/mol
Amplicon Folding0.256 kcal/mol inside primersite
Amplicon SequenceGCACGGTTTGATGGCAGAGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATG
CAGCTCAGAAAAGCGACAGTGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGAC
CCAAGAAGCTAAAACTGGATCAATTATAGGAGTGAAATAAAGGTCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 94)
Forward (243,20)CTCCTCCTCCTGCTTTCCTCAmplicon SizecDNA: 226 bpgenomic: 57,276
Reverse (468,23)AGATGGACCTTTATTTCACTCCTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops999.483 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops2.149 kcal/mol in 3' area
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-0.787 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceCTCCTCCTCCTGCTTTCCTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCAC
GGTTTGATGGCAGAGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGC
TCAGAAAAGCGACAGTGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAA
GAAGCTAAAACTGGATCAATTATAGGAGTGAAATAAAGGTCCATCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 95)
Forward (301,23)ACGGTTTGATGGCAGAGATATTTAmplicon SizecDNA: 164 bpgenomic: 57,214
Reverse (464,24)GGACCTTTATTTCACTCCTATAATNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.639 kcal/mol in 3' area
Forward Dimers-1.395 kcal/mol
Reverse Loops2.42 kcal/mol
Reverse Dimers-0.295 kcal/mol
Forward-Reverse Dimers-1.506 kcal/mol
Amplicon Folding0.303 kcal/mol outside primersite
Amplicon SequenceACGGTTTGATGGCAGAGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCA
GCTCAGAAAAGCGACAGTGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCC
AAGAAGCTAAAACTGGATCAATTATAGGAGTGAAATAAAGGTCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 96)
Forward (300,22)CACGGTTTGATGGCAGAGATATAmplicon SizecDNA: 168 bpgenomic: 57,218
Reverse (467,23)GATGGACCTTTATTTCACTCCTANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-1.395 kcal/mol
Reverse Loops2.149 kcal/mol in 3' area
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-1.506 kcal/mol
Amplicon Folding0.256 kcal/mol inside primersite
Amplicon SequenceCACGGTTTGATGGCAGAGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGC
AGCTCAGAAAAGCGACAGTGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACC
CAAGAAGCTAAAACTGGATCAATTATAGGAGTGAAATAAAGGTCCATC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 100)
Forward (265,21)GTAAGTGCATACCCGCTAGTGAmplicon SizecDNA: 209 bpgenomic: 57,259
Reverse (473,22)GCAGGAGATGGACCTTTATTTCNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.986 kcal/mol
Forward-Reverse Dimers-1.872 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATTTT
CTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAGAG
AAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCAATTA
TAGGAGTGAAATAAAGGTCCATCTCCTGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 101)
Forward (301,23)ACGGTTTGATGGCAGAGATATTTAmplicon SizecDNA: 167 bpgenomic: 57,217
Reverse (467,23)GATGGACCTTTATTTCACTCCTANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.639 kcal/mol in 3' area
Forward Dimers-1.395 kcal/mol
Reverse Loops2.149 kcal/mol in 3' area
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-1.506 kcal/mol
Amplicon Folding0.303 kcal/mol outside primersite
Amplicon SequenceACGGTTTGATGGCAGAGATATTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCA
GCTCAGAAAAGCGACAGTGGAGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCC
AAGAAGCTAAAACTGGATCAATTATAGGAGTGAAATAAAGGTCCATC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 103)
Forward (263,21)CAGTAAGTGCATACCCGCTAGAmplicon SizecDNA: 212 bpgenomic: 57,262
Reverse (474,22)GGCAGGAGATGGACCTTTATTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol
Reverse Loops0.808 kcal/mol
Reverse Dimers-1.986 kcal/mol
Forward-Reverse Dimers-1.872 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATATT
TTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGGAG
AGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCAAT
TATAGGAGTGAAATAAAGGTCCATCTCCTGCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 106)
Forward (261,21)TCCAGTAAGTGCATACCCGCTAmplicon SizecDNA: 206 bpgenomic: 57,256
Reverse (466,24)ATGGACCTTTATTTCACTCCTATANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.528 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol
Reverse Loops2.149 kcal/mol in 3' area
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-2.103 kcal/mol
Amplicon Folding-1.333 kcal/mol outside primersite
Amplicon SequenceTCCAGTAAGTGCATACCCGCTAGTGGTCTGTACAGGCGGCACGGTTTGATGGCAGAGATA
TTTTCTTTCCAAACTGTTCAAAATGATGAACGAAGATGCAGCTCAGAAAAGCGACAGTGG
AGAGAAGTTCAACGGCAGTAGTCAGAGGAGAAAAAGACCCAAGAAGCTAAAACTGGATCA
ATTATAGGAGTGAAATAAAGGTCCAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 7 To Exon 10 (Pair 1)
Forward (775,20)GGGTCCTCTGTGGATTCTGCAmplicon SizecDNA: 278 bpgenomic: 40,600
Reverse (1052,20)ACCGCCTGGTTGTGTCCTTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.328 kcal/mol
Reverse Loops0.066 kcal/mol
Reverse Dimers-0.822 kcal/mol
Forward-Reverse Dimers-1.415 kcal/mol
Amplicon Folding-1.669 kcal/mol outside primersite
Amplicon SequenceGGGTCCTCTGTGGATTCTGCCACTAAGAAGGGAAATACCGCTCTTCACATTGCATCTTTG
GCTGGACAAGCAGAAGTTGTCAAAGTTCTTGTTAAGGAAGGAGCCAATATTAATGCACAG
TCTCAGAATGGCTTTACTCCTTTATACATGGCTGCCCAAGAGAATCACATTGATGTTGTA
AAATATTTGCTGGAAAATGGAGCTAATCAGAGCACTGCTACAGAGGATGGCTTTACTCCT
CTAGCTGTGGCACTCCAGCAAGGACACAACCAGGCGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127493 (ANK2)278417 - 694
NM_020977 (ANK2)278359 - 636
NM_001148 (ANK2)278359 - 636
Exon 7 To Exon 10 (Pair 2)
Forward (776,20)GGTCCTCTGTGGATTCTGCCAmplicon SizecDNA: 277 bpgenomic: 40,599
Reverse (1052,20)ACCGCCTGGTTGTGTCCTTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.328 kcal/mol
Reverse Loops0.066 kcal/mol
Reverse Dimers-0.822 kcal/mol
Forward-Reverse Dimers-1.415 kcal/mol
Amplicon Folding-1.669 kcal/mol outside primersite
Amplicon SequenceGGTCCTCTGTGGATTCTGCCACTAAGAAGGGAAATACCGCTCTTCACATTGCATCTTTGG
CTGGACAAGCAGAAGTTGTCAAAGTTCTTGTTAAGGAAGGAGCCAATATTAATGCACAGT
CTCAGAATGGCTTTACTCCTTTATACATGGCTGCCCAAGAGAATCACATTGATGTTGTAA
AATATTTGCTGGAAAATGGAGCTAATCAGAGCACTGCTACAGAGGATGGCTTTACTCCTC
TAGCTGTGGCACTCCAGCAAGGACACAACCAGGCGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020977 (ANK2)277360 - 636
NM_001148 (ANK2)277360 - 636
NM_001127493 (ANK2)277418 - 694
Exon 7 To Exon 10 (Pair 3)
Forward (775,20)GGGTCCTCTGTGGATTCTGCAmplicon SizecDNA: 274 bpgenomic: 40,596
Reverse (1048,20)CCTGGTTGTGTCCTTGCTGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.328 kcal/mol
Reverse Loops1.326 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol in 3' area
Forward-Reverse Dimers-0.787 kcal/mol
Amplicon Folding-1.669 kcal/mol outside primersite
Amplicon SequenceGGGTCCTCTGTGGATTCTGCCACTAAGAAGGGAAATACCGCTCTTCACATTGCATCTTTG
GCTGGACAAGCAGAAGTTGTCAAAGTTCTTGTTAAGGAAGGAGCCAATATTAATGCACAG
TCTCAGAATGGCTTTACTCCTTTATACATGGCTGCCCAAGAGAATCACATTGATGTTGTA
AAATATTTGCTGGAAAATGGAGCTAATCAGAGCACTGCTACAGAGGATGGCTTTACTCCT
CTAGCTGTGGCACTCCAGCAAGGACACAACCAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020977 (ANK2)274359 - 632
NM_001148 (ANK2)274359 - 632
NM_001127493 (ANK2)274417 - 690
Exon 7 To Exon 9 (Pair 1)
Forward (776,20)GGTCCTCTGTGGATTCTGCCAmplicon SizecDNA: 176 bpgenomic: 35,771
Reverse (951,23)AACATCAATGTGATTCTCTTGGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.328 kcal/mol
Reverse Loops0.481 kcal/mol
Reverse Dimers-1.789 kcal/mol
Forward-Reverse Dimers-0.883 kcal/mol
Amplicon Folding-0.675 kcal/mol outside primersite
Amplicon SequenceGGTCCTCTGTGGATTCTGCCACTAAGAAGGGAAATACCGCTCTTCACATTGCATCTTTGG
CTGGACAAGCAGAAGTTGTCAAAGTTCTTGTTAAGGAAGGAGCCAATATTAATGCACAGT
CTCAGAATGGCTTTACTCCTTTATACATGGCTGCCCAAGAGAATCACATTGATGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020977 (ANK2)176360 - 535
NM_001148 (ANK2)176360 - 535
NM_001127493 (ANK2)176418 - 593
Exon 7 To Exon 10 (Pair 4)
Forward (776,20)GGTCCTCTGTGGATTCTGCCAmplicon SizecDNA: 274 bpgenomic: 40,596
Reverse (1049,20)GCCTGGTTGTGTCCTTGCTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.328 kcal/mol
Reverse Loops2.021 kcal/mol
Reverse Dimers-0.666 kcal/mol
Forward-Reverse Dimers-0.856 kcal/mol
Amplicon Folding-1.669 kcal/mol outside primersite
Amplicon SequenceGGTCCTCTGTGGATTCTGCCACTAAGAAGGGAAATACCGCTCTTCACATTGCATCTTTGG
CTGGACAAGCAGAAGTTGTCAAAGTTCTTGTTAAGGAAGGAGCCAATATTAATGCACAGT
CTCAGAATGGCTTTACTCCTTTATACATGGCTGCCCAAGAGAATCACATTGATGTTGTAA
AATATTTGCTGGAAAATGGAGCTAATCAGAGCACTGCTACAGAGGATGGCTTTACTCCTC
TAGCTGTGGCACTCCAGCAAGGACACAACCAGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020977 (ANK2)274360 - 633
NM_001148 (ANK2)274360 - 633
NM_001127493 (ANK2)274418 - 691
Exon 7 To Exon 10 (Pair 5)
Forward (775,20)GGGTCCTCTGTGGATTCTGCAmplicon SizecDNA: 275 bpgenomic: 40,597
Reverse (1049,20)GCCTGGTTGTGTCCTTGCTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.328 kcal/mol
Reverse Loops2.021 kcal/mol
Reverse Dimers-0.666 kcal/mol
Forward-Reverse Dimers-0.856 kcal/mol
Amplicon Folding-1.669 kcal/mol outside primersite
Amplicon SequenceGGGTCCTCTGTGGATTCTGCCACTAAGAAGGGAAATACCGCTCTTCACATTGCATCTTTG
GCTGGACAAGCAGAAGTTGTCAAAGTTCTTGTTAAGGAAGGAGCCAATATTAATGCACAG
TCTCAGAATGGCTTTACTCCTTTATACATGGCTGCCCAAGAGAATCACATTGATGTTGTA
AAATATTTGCTGGAAAATGGAGCTAATCAGAGCACTGCTACAGAGGATGGCTTTACTCCT
CTAGCTGTGGCACTCCAGCAAGGACACAACCAGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020977 (ANK2)275359 - 633
NM_001148 (ANK2)275359 - 633
NM_001127493 (ANK2)275417 - 691
Exon 7 To Exon 9 (Pair 2)
Forward (776,20)GGTCCTCTGTGGATTCTGCCAmplicon SizecDNA: 179 bpgenomic: 35,774
Reverse (954,24)TACAACATCAATGTGATTCTCTTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.328 kcal/mol
Reverse Loops0.481 kcal/mol
Reverse Dimers-1.789 kcal/mol
Forward-Reverse Dimers-0.883 kcal/mol
Amplicon Folding-0.675 kcal/mol outside primersite
Amplicon SequenceGGTCCTCTGTGGATTCTGCCACTAAGAAGGGAAATACCGCTCTTCACATTGCATCTTTGG
CTGGACAAGCAGAAGTTGTCAAAGTTCTTGTTAAGGAAGGAGCCAATATTAATGCACAGT
CTCAGAATGGCTTTACTCCTTTATACATGGCTGCCCAAGAGAATCACATTGATGTTGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020977 (ANK2)179360 - 538
NM_001148 (ANK2)179360 - 538
NM_001127493 (ANK2)179418 - 596
Exon 7 To Exon 10 (Pair 6)
Forward (776,20)GGTCCTCTGTGGATTCTGCCAmplicon SizecDNA: 273 bpgenomic: 40,595
Reverse (1048,20)CCTGGTTGTGTCCTTGCTGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.328 kcal/mol
Reverse Loops1.326 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol in 3' area
Forward-Reverse Dimers-0.787 kcal/mol
Amplicon Folding-1.669 kcal/mol outside primersite
Amplicon SequenceGGTCCTCTGTGGATTCTGCCACTAAGAAGGGAAATACCGCTCTTCACATTGCATCTTTGG
CTGGACAAGCAGAAGTTGTCAAAGTTCTTGTTAAGGAAGGAGCCAATATTAATGCACAGT
CTCAGAATGGCTTTACTCCTTTATACATGGCTGCCCAAGAGAATCACATTGATGTTGTAA
AATATTTGCTGGAAAATGGAGCTAATCAGAGCACTGCTACAGAGGATGGCTTTACTCCTC
TAGCTGTGGCACTCCAGCAAGGACACAACCAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020977 (ANK2)273360 - 632
NM_001148 (ANK2)273360 - 632
NM_001127493 (ANK2)273418 - 690
Exon 7 To Exon 9 (Pair 3)
Forward (776,20)GGTCCTCTGTGGATTCTGCCAmplicon SizecDNA: 177 bpgenomic: 35,772
Reverse (952,23)CAACATCAATGTGATTCTCTTGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.328 kcal/mol
Reverse Loops0.481 kcal/mol
Reverse Dimers-1.789 kcal/mol
Forward-Reverse Dimers-0.883 kcal/mol
Amplicon Folding-0.675 kcal/mol outside primersite
Amplicon SequenceGGTCCTCTGTGGATTCTGCCACTAAGAAGGGAAATACCGCTCTTCACATTGCATCTTTGG
CTGGACAAGCAGAAGTTGTCAAAGTTCTTGTTAAGGAAGGAGCCAATATTAATGCACAGT
CTCAGAATGGCTTTACTCCTTTATACATGGCTGCCCAAGAGAATCACATTGATGTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020977 (ANK2)177360 - 536
NM_001148 (ANK2)177360 - 536
NM_001127493 (ANK2)177418 - 594
Exon 7 To Exon 10 (Pair 7)
Forward (776,20)GGTCCTCTGTGGATTCTGCCAmplicon SizecDNA: 275 bpgenomic: 40,597
Reverse (1050,20)CGCCTGGTTGTGTCCTTGCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.328 kcal/mol
Reverse Loops2.021 kcal/mol
Reverse Dimers-0.822 kcal/mol
Forward-Reverse Dimers-0.856 kcal/mol
Amplicon Folding-1.669 kcal/mol outside primersite
Amplicon SequenceGGTCCTCTGTGGATTCTGCCACTAAGAAGGGAAATACCGCTCTTCACATTGCATCTTTGG
CTGGACAAGCAGAAGTTGTCAAAGTTCTTGTTAAGGAAGGAGCCAATATTAATGCACAGT
CTCAGAATGGCTTTACTCCTTTATACATGGCTGCCCAAGAGAATCACATTGATGTTGTAA
AATATTTGCTGGAAAATGGAGCTAATCAGAGCACTGCTACAGAGGATGGCTTTACTCCTC
TAGCTGTGGCACTCCAGCAAGGACACAACCAGGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020977 (ANK2)275360 - 634
NM_001148 (ANK2)275360 - 634
NM_001127493 (ANK2)275418 - 692
Exon 7 To Exon 10 (Pair 8)
Forward (775,20)GGGTCCTCTGTGGATTCTGCAmplicon SizecDNA: 276 bpgenomic: 40,598
Reverse (1050,20)CGCCTGGTTGTGTCCTTGCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.328 kcal/mol
Reverse Loops2.021 kcal/mol
Reverse Dimers-0.822 kcal/mol
Forward-Reverse Dimers-0.856 kcal/mol
Amplicon Folding-1.669 kcal/mol outside primersite
Amplicon SequenceGGGTCCTCTGTGGATTCTGCCACTAAGAAGGGAAATACCGCTCTTCACATTGCATCTTTG
GCTGGACAAGCAGAAGTTGTCAAAGTTCTTGTTAAGGAAGGAGCCAATATTAATGCACAG
TCTCAGAATGGCTTTACTCCTTTATACATGGCTGCCCAAGAGAATCACATTGATGTTGTA
AAATATTTGCTGGAAAATGGAGCTAATCAGAGCACTGCTACAGAGGATGGCTTTACTCCT
CTAGCTGTGGCACTCCAGCAAGGACACAACCAGGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020977 (ANK2)276359 - 634
NM_001148 (ANK2)276359 - 634
NM_001127493 (ANK2)276417 - 692
Exon 8 To Exon 10 (Pair 1)
Forward (878,23)CCAATATTAATGCACAGTCTCAGAmplicon SizecDNA: 256 bpgenomic: 38,034
Reverse (1133,21)TTGGTGTCGTCTTTCCTAGCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.901 kcal/mol
Forward Dimers-1.726 kcal/mol
Reverse Loops2.123 kcal/mol in 3' area
Reverse Dimers0.112 kcal/mol in 3' area
Forward-Reverse Dimers-1.018 kcal/mol
Amplicon Folding-2.979 kcal/mol outside primersite
Amplicon SequenceCCAATATTAATGCACAGTCTCAGAATGGCTTTACTCCTTTATACATGGCTGCCCAAGAGA
ATCACATTGATGTTGTAAAATATTTGCTGGAAAATGGAGCTAATCAGAGCACTGCTACAG
AGGATGGCTTTACTCCTCTAGCTGTGGCACTCCAGCAAGGACACAACCAGGCGGTGGCCA
TCCTCTTGGAGAATGACACCAAAGGGAAAGTGAGGCTGCCAGCTCTGCATATTGCCGCTA
GGAAAGACGACACCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127493 (ANK2)256520 - 775
NM_020977 (ANK2)256462 - 717
NM_001148 (ANK2)256462 - 717
Exon 8 To Exon 10 (Pair 2)
Forward (877,23)GCCAATATTAATGCACAGTCTCAAmplicon SizecDNA: 260 bpgenomic: 38,038
Reverse (1136,22)GATTTGGTGTCGTCTTTCCTAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.901 kcal/mol
Forward Dimers-1.726 kcal/mol
Reverse Loops2.198 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.311 kcal/mol
Amplicon Folding-2.979 kcal/mol outside primersite
Amplicon SequenceGCCAATATTAATGCACAGTCTCAGAATGGCTTTACTCCTTTATACATGGCTGCCCAAGAG
AATCACATTGATGTTGTAAAATATTTGCTGGAAAATGGAGCTAATCAGAGCACTGCTACA
GAGGATGGCTTTACTCCTCTAGCTGTGGCACTCCAGCAAGGACACAACCAGGCGGTGGCC
ATCCTCTTGGAGAATGACACCAAAGGGAAAGTGAGGCTGCCAGCTCTGCATATTGCCGCT
AGGAAAGACGACACCAAATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127493 (ANK2)260519 - 778
NM_020977 (ANK2)260461 - 720
NM_001148 (ANK2)260461 - 720
Exon 8 To Exon 10 (Pair 3)
Forward (877,23)GCCAATATTAATGCACAGTCTCAAmplicon SizecDNA: 265 bpgenomic: 38,043
Reverse (1141,21)CGGCAGATTTGGTGTCGTCTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.901 kcal/mol
Forward Dimers-1.726 kcal/mol
Reverse Loops0.963 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-2.979 kcal/mol outside primersite
Amplicon SequenceGCCAATATTAATGCACAGTCTCAGAATGGCTTTACTCCTTTATACATGGCTGCCCAAGAG
AATCACATTGATGTTGTAAAATATTTGCTGGAAAATGGAGCTAATCAGAGCACTGCTACA
GAGGATGGCTTTACTCCTCTAGCTGTGGCACTCCAGCAAGGACACAACCAGGCGGTGGCC
ATCCTCTTGGAGAATGACACCAAAGGGAAAGTGAGGCTGCCAGCTCTGCATATTGCCGCT
AGGAAAGACGACACCAAATCTGCCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127493 (ANK2)265519 - 783
NM_020977 (ANK2)265461 - 725
NM_001148 (ANK2)265461 - 725
 

See below for some more details.

Program Output:

Loading ...