Design Results for ANK3

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 3 (Pair 86)
Forward (278,23)CAGATTATTCACGAAGCTCTAGAAmplicon SizecDNA: 111 bpgenomic: 42,340
Reverse (388,21)TGAGCCTGGAAATGGTGAGAGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.886 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.93 kcal/mol
Forward-Reverse Dimers-1.926 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGT
GTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 85)
Forward (279,24)AGATTATTCACGAAGCTCTAGAAAAmplicon SizecDNA: 130 bpgenomic: 42,359
Reverse (408,22)CTTGTTCCTCCACAGTGATTTGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.745 kcal/mol
Reverse Dimers-1.888 kcal/mol
Forward-Reverse Dimers-1.117 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGTG
TGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCACTGTG
GAGGAACAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 84)
Forward (267,23)TGGCTTTGGATCAGATTATTCACAmplicon SizecDNA: 287 bpgenomic: 42,516
Reverse (553,21)GTAGCCCTGTTCAGCTTTCCTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.901 kcal/mol
Forward Dimers-0.894 kcal/mol
Reverse Loops0.704 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.872 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceTGGCTTTGGATCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTG
TGTGAGGGTGTGTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCT
CAAATCACTGTGGAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACGA
TTAGTTAAAAATGAAAGGCTAAAATATTGATTTTCTTTAGAAGAATAATTGACTGTTTGA
TATAGAGAACACCCAGTTTCTTCCTGAGGAAAGCTGAACAGGGCTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 81)
Forward (278,23)CAGATTATTCACGAAGCTCTAGAAmplicon SizecDNA: 113 bpgenomic: 42,342
Reverse (390,22)TTTGAGCCTGGAAATGGTGAGANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.886 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.93 kcal/mol
Forward-Reverse Dimers-1.926 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGT
GTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 80)
Forward (278,23)CAGATTATTCACGAAGCTCTAGAAmplicon SizecDNA: 129 bpgenomic: 42,358
Reverse (406,22)TGTTCCTCCACAGTGATTTGAGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.886 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.737 kcal/mol in 3' area
Reverse Dimers-1.888 kcal/mol
Forward-Reverse Dimers-1.117 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGT
GTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCACTGT
GGAGGAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 78)
Forward (279,24)AGATTATTCACGAAGCTCTAGAAAAmplicon SizecDNA: 128 bpgenomic: 42,357
Reverse (406,22)TGTTCCTCCACAGTGATTTGAGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.737 kcal/mol in 3' area
Reverse Dimers-1.888 kcal/mol
Forward-Reverse Dimers-1.117 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGTG
TGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCACTGTG
GAGGAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 76)
Forward (278,23)CAGATTATTCACGAAGCTCTAGAAmplicon SizecDNA: 174 bpgenomic: 42,403
Reverse (451,23)ACTAATCGTTACCCTGAGATAAGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.886 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.635 kcal/mol
Reverse Dimers-0.672 kcal/mol
Forward-Reverse Dimers-2.605 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGT
GTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCACTGT
GGAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACGATTAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 74)
Forward (278,23)CAGATTATTCACGAAGCTCTAGAAmplicon SizecDNA: 141 bpgenomic: 42,370
Reverse (418,22)GACTTTGTTGCTTGTTCCTCCANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.886 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.702 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.235 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGT
GTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCACTGT
GGAGGAACAAGCAACAAAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 73)
Forward (279,24)AGATTATTCACGAAGCTCTAGAAAAmplicon SizecDNA: 112 bpgenomic: 42,341
Reverse (390,22)TTTGAGCCTGGAAATGGTGAGANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.93 kcal/mol
Forward-Reverse Dimers-1.926 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGTG
TGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 72)
Forward (267,23)TGGCTTTGGATCAGATTATTCACAmplicon SizecDNA: 296 bpgenomic: 42,525
Reverse (562,21)GCTGCTAATGTAGCCCTGTTCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.901 kcal/mol
Forward Dimers-0.894 kcal/mol
Reverse Loops0.492 kcal/mol
Reverse Dimers-1.01 kcal/mol
Forward-Reverse Dimers-2.872 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceTGGCTTTGGATCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTG
TGTGAGGGTGTGTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCT
CAAATCACTGTGGAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACGA
TTAGTTAAAAATGAAAGGCTAAAATATTGATTTTCTTTAGAAGAATAATTGACTGTTTGA
TATAGAGAACACCCAGTTTCTTCCTGAGGAAAGCTGAACAGGGCTACATTAGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 71)
Forward (267,23)TGGCTTTGGATCAGATTATTCACAmplicon SizecDNA: 282 bpgenomic: 42,511
Reverse (548,21)CCTGTTCAGCTTTCCTCAGGANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.901 kcal/mol
Forward Dimers-0.894 kcal/mol
Reverse Loops0.531 kcal/mol in 3' area
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-1.846 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceTGGCTTTGGATCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTG
TGTGAGGGTGTGTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCT
CAAATCACTGTGGAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACGA
TTAGTTAAAAATGAAAGGCTAAAATATTGATTTTCTTTAGAAGAATAATTGACTGTTTGA
TATAGAGAACACCCAGTTTCTTCCTGAGGAAAGCTGAACAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 70)
Forward (278,23)CAGATTATTCACGAAGCTCTAGAAmplicon SizecDNA: 142 bpgenomic: 42,371
Reverse (419,22)AGACTTTGTTGCTTGTTCCTCCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.886 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.702 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-2.235 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGT
GTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCACTGT
GGAGGAACAAGCAACAAAGTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 69)
Forward (278,23)CAGATTATTCACGAAGCTCTAGAAmplicon SizecDNA: 140 bpgenomic: 42,369
Reverse (417,22)ACTTTGTTGCTTGTTCCTCCACNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.886 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops2.265 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.235 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGT
GTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCACTGT
GGAGGAACAAGCAACAAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 68)
Forward (266,23)GTGGCTTTGGATCAGATTATTCAAmplicon SizecDNA: 268 bpgenomic: 42,497
Reverse (533,22)TCAGGAAGAAACTGGGTGTTCTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.901 kcal/mol
Forward Dimers-0.894 kcal/mol
Reverse Loops0.486 kcal/mol in 3' area
Reverse Dimers-0.605 kcal/mol
Forward-Reverse Dimers-1.47 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceGTGGCTTTGGATCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGT
GTGTGAGGGTGTGTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGC
TCAAATCACTGTGGAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACG
ATTAGTTAAAAATGAAAGGCTAAAATATTGATTTTCTTTAGAAGAATAATTGACTGTTTG
ATATAGAGAACACCCAGTTTCTTCCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 66)
Forward (279,24)AGATTATTCACGAAGCTCTAGAAAAmplicon SizecDNA: 101 bpgenomic: 42,330
Reverse (379,23)AAATGGTGAGAGAGAGAGAAAGANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops998.952 kcal/mol
Reverse Dimers0.088 kcal/mol
Forward-Reverse Dimers-2.461 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGTG
TGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 64)
Forward (278,23)CAGATTATTCACGAAGCTCTAGAAmplicon SizecDNA: 115 bpgenomic: 42,344
Reverse (392,22)GATTTGAGCCTGGAAATGGTGANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.886 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.93 kcal/mol
Forward-Reverse Dimers-1.926 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGT
GTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 65)
Forward (266,23)GTGGCTTTGGATCAGATTATTCAAmplicon SizecDNA: 288 bpgenomic: 42,517
Reverse (553,21)GTAGCCCTGTTCAGCTTTCCTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.901 kcal/mol
Forward Dimers-0.894 kcal/mol
Reverse Loops0.704 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.872 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceGTGGCTTTGGATCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGT
GTGTGAGGGTGTGTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGC
TCAAATCACTGTGGAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACG
ATTAGTTAAAAATGAAAGGCTAAAATATTGATTTTCTTTAGAAGAATAATTGACTGTTTG
ATATAGAGAACACCCAGTTTCTTCCTGAGGAAAGCTGAACAGGGCTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 63)
Forward (279,24)AGATTATTCACGAAGCTCTAGAAAAmplicon SizecDNA: 114 bpgenomic: 42,343
Reverse (392,22)GATTTGAGCCTGGAAATGGTGANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.93 kcal/mol
Forward-Reverse Dimers-1.926 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGTG
TGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 62)
Forward (267,23)TGGCTTTGGATCAGATTATTCACAmplicon SizecDNA: 285 bpgenomic: 42,514
Reverse (551,21)AGCCCTGTTCAGCTTTCCTCANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.901 kcal/mol
Forward Dimers-0.894 kcal/mol
Reverse Loops0.934 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.642 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceTGGCTTTGGATCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTG
TGTGAGGGTGTGTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCT
CAAATCACTGTGGAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACGA
TTAGTTAAAAATGAAAGGCTAAAATATTGATTTTCTTTAGAAGAATAATTGACTGTTTGA
TATAGAGAACACCCAGTTTCTTCCTGAGGAAAGCTGAACAGGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 60)
Forward (278,23)CAGATTATTCACGAAGCTCTAGAAmplicon SizecDNA: 131 bpgenomic: 42,360
Reverse (408,22)CTTGTTCCTCCACAGTGATTTGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.886 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.745 kcal/mol
Reverse Dimers-1.888 kcal/mol
Forward-Reverse Dimers-1.117 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGT
GTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCACTGT
GGAGGAACAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 59)
Forward (267,23)TGGCTTTGGATCAGATTATTCACAmplicon SizecDNA: 185 bpgenomic: 42,414
Reverse (451,23)ACTAATCGTTACCCTGAGATAAGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.901 kcal/mol
Forward Dimers-0.894 kcal/mol
Reverse Loops1.635 kcal/mol
Reverse Dimers-0.672 kcal/mol
Forward-Reverse Dimers-1.724 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceTGGCTTTGGATCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTG
TGTGAGGGTGTGTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCT
CAAATCACTGTGGAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACGA
TTAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 57)
Forward (266,23)GTGGCTTTGGATCAGATTATTCAAmplicon SizecDNA: 297 bpgenomic: 42,526
Reverse (562,21)GCTGCTAATGTAGCCCTGTTCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.901 kcal/mol
Forward Dimers-0.894 kcal/mol
Reverse Loops0.492 kcal/mol
Reverse Dimers-1.01 kcal/mol
Forward-Reverse Dimers-2.872 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceGTGGCTTTGGATCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGT
GTGTGAGGGTGTGTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGC
TCAAATCACTGTGGAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACG
ATTAGTTAAAAATGAAAGGCTAAAATATTGATTTTCTTTAGAAGAATAATTGACTGTTTG
ATATAGAGAACACCCAGTTTCTTCCTGAGGAAAGCTGAACAGGGCTACATTAGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 56)
Forward (266,23)GTGGCTTTGGATCAGATTATTCAAmplicon SizecDNA: 186 bpgenomic: 42,415
Reverse (451,23)ACTAATCGTTACCCTGAGATAAGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.901 kcal/mol
Forward Dimers-0.894 kcal/mol
Reverse Loops1.635 kcal/mol
Reverse Dimers-0.672 kcal/mol
Forward-Reverse Dimers-1.724 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceGTGGCTTTGGATCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGT
GTGTGAGGGTGTGTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGC
TCAAATCACTGTGGAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACG
ATTAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 55)
Forward (266,23)GTGGCTTTGGATCAGATTATTCAAmplicon SizecDNA: 283 bpgenomic: 42,512
Reverse (548,21)CCTGTTCAGCTTTCCTCAGGANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.901 kcal/mol
Forward Dimers-0.894 kcal/mol
Reverse Loops0.531 kcal/mol in 3' area
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-1.846 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceGTGGCTTTGGATCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGT
GTGTGAGGGTGTGTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGC
TCAAATCACTGTGGAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACG
ATTAGTTAAAAATGAAAGGCTAAAATATTGATTTTCTTTAGAAGAATAATTGACTGTTTG
ATATAGAGAACACCCAGTTTCTTCCTGAGGAAAGCTGAACAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 54)
Forward (278,23)CAGATTATTCACGAAGCTCTAGAAmplicon SizecDNA: 119 bpgenomic: 42,348
Reverse (396,22)CAGTGATTTGAGCCTGGAAATGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.886 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.757 kcal/mol in 3' area
Reverse Dimers-1.93 kcal/mol
Forward-Reverse Dimers-1.926 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGT
GTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 51)
Forward (278,23)CAGATTATTCACGAAGCTCTAGAAmplicon SizecDNA: 116 bpgenomic: 42,345
Reverse (393,22)TGATTTGAGCCTGGAAATGGTGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.886 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.757 kcal/mol in 3' area
Reverse Dimers-1.93 kcal/mol
Forward-Reverse Dimers-1.926 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGT
GTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 50)
Forward (278,23)CAGATTATTCACGAAGCTCTAGAAmplicon SizecDNA: 117 bpgenomic: 42,346
Reverse (394,22)GTGATTTGAGCCTGGAAATGGTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.886 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.757 kcal/mol in 3' area
Reverse Dimers-1.93 kcal/mol
Forward-Reverse Dimers-1.926 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGT
GTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 48)
Forward (279,24)AGATTATTCACGAAGCTCTAGAAAAmplicon SizecDNA: 284 bpgenomic: 42,513
Reverse (562,21)GCTGCTAATGTAGCCCTGTTCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops0.492 kcal/mol
Reverse Dimers-1.01 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGTG
TGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCACTGTG
GAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACGATTAGTTAAAAAT
GAAAGGCTAAAATATTGATTTTCTTTAGAAGAATAATTGACTGTTTGATATAGAGAACAC
CCAGTTTCTTCCTGAGGAAAGCTGAACAGGGCTACATTAGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 45)
Forward (267,23)TGGCTTTGGATCAGATTATTCACAmplicon SizecDNA: 270 bpgenomic: 42,499
Reverse (536,21)TCCTCAGGAAGAAACTGGGTGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.901 kcal/mol
Forward Dimers-0.894 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-2.494 kcal/mol
Forward-Reverse Dimers-1.47 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceTGGCTTTGGATCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTG
TGTGAGGGTGTGTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCT
CAAATCACTGTGGAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACGA
TTAGTTAAAAATGAAAGGCTAAAATATTGATTTTCTTTAGAAGAATAATTGACTGTTTGA
TATAGAGAACACCCAGTTTCTTCCTGAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 44)
Forward (278,23)CAGATTATTCACGAAGCTCTAGAAmplicon SizecDNA: 256 bpgenomic: 42,485
Reverse (533,22)TCAGGAAGAAACTGGGTGTTCTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.886 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops0.486 kcal/mol in 3' area
Reverse Dimers-0.605 kcal/mol
Forward-Reverse Dimers-1.063 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGT
GTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCACTGT
GGAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACGATTAGTTAAAAA
TGAAAGGCTAAAATATTGATTTTCTTTAGAAGAATAATTGACTGTTTGATATAGAGAACA
CCCAGTTTCTTCCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 43)
Forward (267,23)TGGCTTTGGATCAGATTATTCACAmplicon SizecDNA: 286 bpgenomic: 42,515
Reverse (552,21)TAGCCCTGTTCAGCTTTCCTCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.901 kcal/mol
Forward Dimers-0.894 kcal/mol
Reverse Loops0.704 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.872 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceTGGCTTTGGATCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTG
TGTGAGGGTGTGTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCT
CAAATCACTGTGGAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACGA
TTAGTTAAAAATGAAAGGCTAAAATATTGATTTTCTTTAGAAGAATAATTGACTGTTTGA
TATAGAGAACACCCAGTTTCTTCCTGAGGAAAGCTGAACAGGGCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 42)
Forward (279,24)AGATTATTCACGAAGCTCTAGAAAAmplicon SizecDNA: 117 bpgenomic: 42,346
Reverse (395,22)AGTGATTTGAGCCTGGAAATGGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.757 kcal/mol in 3' area
Reverse Dimers-1.93 kcal/mol
Forward-Reverse Dimers-1.926 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGTG
TGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 40)
Forward (266,23)GTGGCTTTGGATCAGATTATTCAAmplicon SizecDNA: 286 bpgenomic: 42,515
Reverse (551,21)AGCCCTGTTCAGCTTTCCTCANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.901 kcal/mol
Forward Dimers-0.894 kcal/mol
Reverse Loops0.934 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.642 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceGTGGCTTTGGATCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGT
GTGTGAGGGTGTGTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGC
TCAAATCACTGTGGAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACG
ATTAGTTAAAAATGAAAGGCTAAAATATTGATTTTCTTTAGAAGAATAATTGACTGTTTG
ATATAGAGAACACCCAGTTTCTTCCTGAGGAAAGCTGAACAGGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 39)
Forward (278,23)CAGATTATTCACGAAGCTCTAGAAmplicon SizecDNA: 285 bpgenomic: 42,514
Reverse (562,21)GCTGCTAATGTAGCCCTGTTCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.886 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops0.492 kcal/mol
Reverse Dimers-1.01 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGT
GTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCACTGT
GGAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACGATTAGTTAAAAA
TGAAAGGCTAAAATATTGATTTTCTTTAGAAGAATAATTGACTGTTTGATATAGAGAACA
CCCAGTTTCTTCCTGAGGAAAGCTGAACAGGGCTACATTAGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 37)
Forward (279,24)AGATTATTCACGAAGCTCTAGAAAAmplicon SizecDNA: 115 bpgenomic: 42,344
Reverse (393,22)TGATTTGAGCCTGGAAATGGTGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.757 kcal/mol in 3' area
Reverse Dimers-1.93 kcal/mol
Forward-Reverse Dimers-1.926 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGTG
TGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 36)
Forward (279,24)AGATTATTCACGAAGCTCTAGAAAAmplicon SizecDNA: 116 bpgenomic: 42,345
Reverse (394,22)GTGATTTGAGCCTGGAAATGGTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.757 kcal/mol in 3' area
Reverse Dimers-1.93 kcal/mol
Forward-Reverse Dimers-1.926 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGTG
TGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 35)
Forward (279,24)AGATTATTCACGAAGCTCTAGAAAAmplicon SizecDNA: 255 bpgenomic: 42,484
Reverse (533,22)TCAGGAAGAAACTGGGTGTTCTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops0.486 kcal/mol in 3' area
Reverse Dimers-0.605 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGTG
TGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCACTGTG
GAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACGATTAGTTAAAAAT
GAAAGGCTAAAATATTGATTTTCTTTAGAAGAATAATTGACTGTTTGATATAGAGAACAC
CCAGTTTCTTCCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 34)
Forward (267,23)TGGCTTTGGATCAGATTATTCACAmplicon SizecDNA: 153 bpgenomic: 42,382
Reverse (419,22)AGACTTTGTTGCTTGTTCCTCCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.901 kcal/mol
Forward Dimers-0.894 kcal/mol
Reverse Loops1.702 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.105 kcal/mol
Amplicon Folding0.009 kcal/mol outside primersite
Amplicon SequenceTGGCTTTGGATCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTG
TGTGAGGGTGTGTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCT
CAAATCACTGTGGAGGAACAAGCAACAAAGTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 32)
Forward (266,23)GTGGCTTTGGATCAGATTATTCAAmplicon SizecDNA: 271 bpgenomic: 42,500
Reverse (536,21)TCCTCAGGAAGAAACTGGGTGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.901 kcal/mol
Forward Dimers-0.894 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-2.494 kcal/mol
Forward-Reverse Dimers-1.47 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceGTGGCTTTGGATCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGT
GTGTGAGGGTGTGTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGC
TCAAATCACTGTGGAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACG
ATTAGTTAAAAATGAAAGGCTAAAATATTGATTTTCTTTAGAAGAATAATTGACTGTTTG
ATATAGAGAACACCCAGTTTCTTCCTGAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 31)
Forward (266,23)GTGGCTTTGGATCAGATTATTCAAmplicon SizecDNA: 154 bpgenomic: 42,383
Reverse (419,22)AGACTTTGTTGCTTGTTCCTCCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.901 kcal/mol
Forward Dimers-0.894 kcal/mol
Reverse Loops1.702 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.105 kcal/mol
Amplicon Folding0.009 kcal/mol outside primersite
Amplicon SequenceGTGGCTTTGGATCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGT
GTGTGAGGGTGTGTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGC
TCAAATCACTGTGGAGGAACAAGCAACAAAGTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 29)
Forward (278,23)CAGATTATTCACGAAGCTCTAGAAmplicon SizecDNA: 118 bpgenomic: 42,347
Reverse (395,22)AGTGATTTGAGCCTGGAAATGGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.886 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.757 kcal/mol in 3' area
Reverse Dimers-1.93 kcal/mol
Forward-Reverse Dimers-1.926 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGT
GTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 28)
Forward (266,23)GTGGCTTTGGATCAGATTATTCAAmplicon SizecDNA: 270 bpgenomic: 42,499
Reverse (535,21)CCTCAGGAAGAAACTGGGTGTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.901 kcal/mol
Forward Dimers-0.894 kcal/mol
Reverse Loops1.425 kcal/mol
Reverse Dimers-1.884 kcal/mol
Forward-Reverse Dimers-1.47 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceGTGGCTTTGGATCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGT
GTGTGAGGGTGTGTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGC
TCAAATCACTGTGGAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACG
ATTAGTTAAAAATGAAAGGCTAAAATATTGATTTTCTTTAGAAGAATAATTGACTGTTTG
ATATAGAGAACACCCAGTTTCTTCCTGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 25)
Forward (279,24)AGATTATTCACGAAGCTCTAGAAAAmplicon SizecDNA: 257 bpgenomic: 42,486
Reverse (535,21)CCTCAGGAAGAAACTGGGTGTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.425 kcal/mol
Reverse Dimers-1.884 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGTG
TGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCACTGTG
GAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACGATTAGTTAAAAAT
GAAAGGCTAAAATATTGATTTTCTTTAGAAGAATAATTGACTGTTTGATATAGAGAACAC
CCAGTTTCTTCCTGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 23)
Forward (279,24)AGATTATTCACGAAGCTCTAGAAAAmplicon SizecDNA: 173 bpgenomic: 42,402
Reverse (451,23)ACTAATCGTTACCCTGAGATAAGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.635 kcal/mol
Reverse Dimers-0.672 kcal/mol
Forward-Reverse Dimers-2.605 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGTG
TGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCACTGTG
GAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACGATTAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 20)
Forward (279,24)AGATTATTCACGAAGCTCTAGAAAAmplicon SizecDNA: 141 bpgenomic: 42,370
Reverse (419,22)AGACTTTGTTGCTTGTTCCTCCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.702 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-2.235 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGTG
TGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCACTGTG
GAGGAACAAGCAACAAAGTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 18)
Forward (279,24)AGATTATTCACGAAGCTCTAGAAAAmplicon SizecDNA: 113 bpgenomic: 42,342
Reverse (391,22)ATTTGAGCCTGGAAATGGTGAGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.93 kcal/mol
Forward-Reverse Dimers-1.926 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGTG
TGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 16)
Forward (278,23)CAGATTATTCACGAAGCTCTAGAAmplicon SizecDNA: 114 bpgenomic: 42,343
Reverse (391,22)ATTTGAGCCTGGAAATGGTGAGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.886 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.93 kcal/mol
Forward-Reverse Dimers-1.926 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGT
GTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 15)
Forward (279,24)AGATTATTCACGAAGCTCTAGAAAAmplicon SizecDNA: 118 bpgenomic: 42,347
Reverse (396,22)CAGTGATTTGAGCCTGGAAATGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.757 kcal/mol in 3' area
Reverse Dimers-1.93 kcal/mol
Forward-Reverse Dimers-1.926 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGTG
TGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 14)
Forward (267,23)TGGCTTTGGATCAGATTATTCACAmplicon SizecDNA: 267 bpgenomic: 42,496
Reverse (533,22)TCAGGAAGAAACTGGGTGTTCTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.901 kcal/mol
Forward Dimers-0.894 kcal/mol
Reverse Loops0.486 kcal/mol in 3' area
Reverse Dimers-0.605 kcal/mol
Forward-Reverse Dimers-1.47 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceTGGCTTTGGATCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTG
TGTGAGGGTGTGTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCT
CAAATCACTGTGGAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACGA
TTAGTTAAAAATGAAAGGCTAAAATATTGATTTTCTTTAGAAGAATAATTGACTGTTTGA
TATAGAGAACACCCAGTTTCTTCCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 13)
Forward (279,24)AGATTATTCACGAAGCTCTAGAAAAmplicon SizecDNA: 139 bpgenomic: 42,368
Reverse (417,22)ACTTTGTTGCTTGTTCCTCCACNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops2.265 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.235 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGTG
TGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCACTGTG
GAGGAACAAGCAACAAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 12)
Forward (266,23)GTGGCTTTGGATCAGATTATTCAAmplicon SizecDNA: 287 bpgenomic: 42,516
Reverse (552,21)TAGCCCTGTTCAGCTTTCCTCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.901 kcal/mol
Forward Dimers-0.894 kcal/mol
Reverse Loops0.704 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.872 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceGTGGCTTTGGATCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGT
GTGTGAGGGTGTGTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGC
TCAAATCACTGTGGAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACG
ATTAGTTAAAAATGAAAGGCTAAAATATTGATTTTCTTTAGAAGAATAATTGACTGTTTG
ATATAGAGAACACCCAGTTTCTTCCTGAGGAAAGCTGAACAGGGCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 11)
Forward (279,24)AGATTATTCACGAAGCTCTAGAAAAmplicon SizecDNA: 140 bpgenomic: 42,369
Reverse (418,22)GACTTTGTTGCTTGTTCCTCCANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.702 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.235 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGTG
TGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCACTGTG
GAGGAACAAGCAACAAAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 9)
Forward (279,24)AGATTATTCACGAAGCTCTAGAAAAmplicon SizecDNA: 258 bpgenomic: 42,487
Reverse (536,21)TCCTCAGGAAGAAACTGGGTGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-2.494 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGTG
TGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCACTGTG
GAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACGATTAGTTAAAAAT
GAAAGGCTAAAATATTGATTTTCTTTAGAAGAATAATTGACTGTTTGATATAGAGAACAC
CCAGTTTCTTCCTGAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 6)
Forward (279,24)AGATTATTCACGAAGCTCTAGAAAAmplicon SizecDNA: 110 bpgenomic: 42,339
Reverse (388,21)TGAGCCTGGAAATGGTGAGAGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.93 kcal/mol
Forward-Reverse Dimers-1.926 kcal/mol
Amplicon Folding0.009 kcal/mol inside primersite
Amplicon SequenceAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGTG
TGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 5)
Forward (267,23)TGGCTTTGGATCAGATTATTCACAmplicon SizecDNA: 269 bpgenomic: 42,498
Reverse (535,21)CCTCAGGAAGAAACTGGGTGTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.901 kcal/mol
Forward Dimers-0.894 kcal/mol
Reverse Loops1.425 kcal/mol
Reverse Dimers-1.884 kcal/mol
Forward-Reverse Dimers-1.47 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceTGGCTTTGGATCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTG
TGTGAGGGTGTGTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCT
CAAATCACTGTGGAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACGA
TTAGTTAAAAATGAAAGGCTAAAATATTGATTTTCTTTAGAAGAATAATTGACTGTTTGA
TATAGAGAACACCCAGTTTCTTCCTGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 2)
Forward (278,23)CAGATTATTCACGAAGCTCTAGAAmplicon SizecDNA: 258 bpgenomic: 42,487
Reverse (535,21)CCTCAGGAAGAAACTGGGTGTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.886 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.425 kcal/mol
Reverse Dimers-1.884 kcal/mol
Forward-Reverse Dimers-1.063 kcal/mol
Amplicon Folding-0.011 kcal/mol outside primersite
Amplicon SequenceCAGATTATTCACGAAGCTCTAGAAAGAGTCTGTAGCTTATTTCTGTGTGTGTGAGGGTGT
GTGTGTGTGTCTCTCTCTCTCTTTCTCTCTCTCTCACCATTTCCAGGCTCAAATCACTGT
GGAGGAACAAGCAACAAAGTCTTGTCAGGACCTTATCTCAGGGTAACGATTAGTTAAAAA
TGAAAGGCTAAAATATTGATTTTCTTTAGAAGAATAATTGACTGTTTGATATAGAGAACA
CCCAGTTTCTTCCTGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 11)
Forward (632,23)ATGGACTTTGGTCTCAATGCTTTAmplicon SizecDNA: 215 bpgenomic: 182,695
Reverse (846,21)AGTCACCACACATGCAGAAGCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.146 kcal/mol
Forward Dimers0.006 kcal/mol
Reverse Loops0.987 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-2.312 kcal/mol
Amplicon Folding0.125 kcal/mol outside primersite
Amplicon SequenceATGGACTTTGGTCTCAATGCTTTGACTCTTTGCCGTGGTTTTGGATGTTGGAATACCGGC
GGTGATCTGTCTTTTATAAACTCACCTGATTTAAAGGAAAGATGAGTGAAGAACCAAAGG
AGAAAAATGCAAAACCTGCTCATAGGAAAAGGAAAGGAAAAAAGATAGGTTTTCAGAATT
AGCGCTGGATTTTTGCTTCTGCATGTGTGGTGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 10)
Forward (628,23)GTAAATGGACTTTGGTCTCAATGAmplicon SizecDNA: 219 bpgenomic: 182,699
Reverse (846,21)AGTCACCACACATGCAGAAGCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.146 kcal/mol
Forward Dimers0.006 kcal/mol
Reverse Loops0.987 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-2.312 kcal/mol
Amplicon Folding0.125 kcal/mol outside primersite
Amplicon SequenceGTAAATGGACTTTGGTCTCAATGCTTTGACTCTTTGCCGTGGTTTTGGATGTTGGAATAC
CGGCGGTGATCTGTCTTTTATAAACTCACCTGATTTAAAGGAAAGATGAGTGAAGAACCA
AAGGAGAAAAATGCAAAACCTGCTCATAGGAAAAGGAAAGGAAAAAAGATAGGTTTTCAG
AATTAGCGCTGGATTTTTGCTTCTGCATGTGTGGTGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 9)
Forward (627,23)CGTAAATGGACTTTGGTCTCAATAmplicon SizecDNA: 220 bpgenomic: 182,700
Reverse (846,21)AGTCACCACACATGCAGAAGCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.146 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol in 3' area
Reverse Loops0.987 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-2.312 kcal/mol
Amplicon Folding0.125 kcal/mol outside primersite
Amplicon SequenceCGTAAATGGACTTTGGTCTCAATGCTTTGACTCTTTGCCGTGGTTTTGGATGTTGGAATA
CCGGCGGTGATCTGTCTTTTATAAACTCACCTGATTTAAAGGAAAGATGAGTGAAGAACC
AAAGGAGAAAAATGCAAAACCTGCTCATAGGAAAAGGAAAGGAAAAAAGATAGGTTTTCA
GAATTAGCGCTGGATTTTTGCTTCTGCATGTGTGGTGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 8)
Forward (622,21)GCACCCGTAAATGGACTTTGGAmplicon SizecDNA: 225 bpgenomic: 182,705
Reverse (846,21)AGTCACCACACATGCAGAAGCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.962 kcal/mol
Forward Dimers-0.758 kcal/mol
Reverse Loops0.987 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-1.923 kcal/mol
Amplicon Folding0.125 kcal/mol outside primersite
Amplicon SequenceGCACCCGTAAATGGACTTTGGTCTCAATGCTTTGACTCTTTGCCGTGGTTTTGGATGTTG
GAATACCGGCGGTGATCTGTCTTTTATAAACTCACCTGATTTAAAGGAAAGATGAGTGAA
GAACCAAAGGAGAAAAATGCAAAACCTGCTCATAGGAAAAGGAAAGGAAAAAAGATAGGT
TTTCAGAATTAGCGCTGGATTTTTGCTTCTGCATGTGTGGTGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 6)
Forward (630,23)AAATGGACTTTGGTCTCAATGCTAmplicon SizecDNA: 217 bpgenomic: 182,697
Reverse (846,21)AGTCACCACACATGCAGAAGCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.146 kcal/mol
Forward Dimers0.006 kcal/mol
Reverse Loops0.987 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-2.312 kcal/mol
Amplicon Folding0.125 kcal/mol outside primersite
Amplicon SequenceAAATGGACTTTGGTCTCAATGCTTTGACTCTTTGCCGTGGTTTTGGATGTTGGAATACCG
GCGGTGATCTGTCTTTTATAAACTCACCTGATTTAAAGGAAAGATGAGTGAAGAACCAAA
GGAGAAAAATGCAAAACCTGCTCATAGGAAAAGGAAAGGAAAAAAGATAGGTTTTCAGAA
TTAGCGCTGGATTTTTGCTTCTGCATGTGTGGTGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 5)
Forward (631,23)AATGGACTTTGGTCTCAATGCTTAmplicon SizecDNA: 216 bpgenomic: 182,696
Reverse (846,21)AGTCACCACACATGCAGAAGCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.146 kcal/mol
Forward Dimers0.006 kcal/mol
Reverse Loops0.987 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-2.312 kcal/mol
Amplicon Folding0.125 kcal/mol outside primersite
Amplicon SequenceAATGGACTTTGGTCTCAATGCTTTGACTCTTTGCCGTGGTTTTGGATGTTGGAATACCGG
CGGTGATCTGTCTTTTATAAACTCACCTGATTTAAAGGAAAGATGAGTGAAGAACCAAAG
GAGAAAAATGCAAAACCTGCTCATAGGAAAAGGAAAGGAAAAAAGATAGGTTTTCAGAAT
TAGCGCTGGATTTTTGCTTCTGCATGTGTGGTGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 4)
Forward (629,23)TAAATGGACTTTGGTCTCAATGCAmplicon SizecDNA: 218 bpgenomic: 182,698
Reverse (846,21)AGTCACCACACATGCAGAAGCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.146 kcal/mol
Forward Dimers0.006 kcal/mol
Reverse Loops0.987 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-2.312 kcal/mol
Amplicon Folding0.125 kcal/mol outside primersite
Amplicon SequenceTAAATGGACTTTGGTCTCAATGCTTTGACTCTTTGCCGTGGTTTTGGATGTTGGAATACC
GGCGGTGATCTGTCTTTTATAAACTCACCTGATTTAAAGGAAAGATGAGTGAAGAACCAA
AGGAGAAAAATGCAAAACCTGCTCATAGGAAAAGGAAAGGAAAAAAGATAGGTTTTCAGA
ATTAGCGCTGGATTTTTGCTTCTGCATGTGTGGTGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 2)
Forward (634,22)GGACTTTGGTCTCAATGCTTTGAmplicon SizecDNA: 213 bpgenomic: 182,693
Reverse (846,21)AGTCACCACACATGCAGAAGCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.163 kcal/mol
Forward Dimers0.023 kcal/mol
Reverse Loops0.987 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-2.312 kcal/mol
Amplicon Folding0.125 kcal/mol outside primersite
Amplicon SequenceGGACTTTGGTCTCAATGCTTTGACTCTTTGCCGTGGTTTTGGATGTTGGAATACCGGCGG
TGATCTGTCTTTTATAAACTCACCTGATTTAAAGGAAAGATGAGTGAAGAACCAAAGGAG
AAAAATGCAAAACCTGCTCATAGGAAAAGGAAAGGAAAAAAGATAGGTTTTCAGAATTAG
CGCTGGATTTTTGCTTCTGCATGTGTGGTGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 12 To Exon 13 (Pair 10)
Forward (2156,20)GCACTGTGGAGCAAGGAGTGAmplicon SizecDNA: 163 bpgenomic: 5,341
Reverse (2318,21)GGGTACATTATGCTGGAGGAGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.515 kcal/mol in 3' area
Forward Dimers-1.482 kcal/mol
Reverse Loops1.831 kcal/mol in 3' area
Reverse Dimers-0.684 kcal/mol
Forward-Reverse Dimers-2.732 kcal/mol
Amplicon Folding-1.793 kcal/mol outside primersite
Amplicon SequenceGCACTGTGGAGCAAGGAGTGGCCACGAGCAGGTGGTAGAAATGTTGCTTGATCGAGCTGC
CCCCATTCTTTCAAAAACCAAGAATGGATTATCTCCATTGCACATGGCCACACAAGGGGA
TCATTTAAACTGCGTCCAGCTTCTCCTCCAGCATAATGTACCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204404 (ANK3)1631293 - 1455
NM_001204403 (ANK3)1631104 - 1266
NM_020987 (ANK3)1631253 - 1415
Exon 12 To Exon 13 (Pair 9)
Forward (2154,20)CTGCACTGTGGAGCAAGGAGAmplicon SizecDNA: 164 bpgenomic: 5,342
Reverse (2317,22)GGTACATTATGCTGGAGGAGAANr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.053 kcal/mol
Forward Dimers-2.88 kcal/mol
Reverse Loops1.288 kcal/mol in 3' area
Reverse Dimers-0.684 kcal/mol
Forward-Reverse Dimers-2.732 kcal/mol
Amplicon Folding-1.793 kcal/mol outside primersite
Amplicon SequenceCTGCACTGTGGAGCAAGGAGTGGCCACGAGCAGGTGGTAGAAATGTTGCTTGATCGAGCT
GCCCCCATTCTTTCAAAAACCAAGAATGGATTATCTCCATTGCACATGGCCACACAAGGG
GATCATTTAAACTGCGTCCAGCTTCTCCTCCAGCATAATGTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204404 (ANK3)1641291 - 1454
NM_001204403 (ANK3)1641102 - 1265
NM_020987 (ANK3)1641251 - 1414
Exon 12 To Exon 13 (Pair 8)
Forward (2154,20)CTGCACTGTGGAGCAAGGAGAmplicon SizecDNA: 169 bpgenomic: 5,347
Reverse (2322,21)CCACGGGTACATTATGCTGGANr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.053 kcal/mol
Forward Dimers-2.88 kcal/mol
Reverse Loops1.728 kcal/mol in 3' area
Reverse Dimers-0.684 kcal/mol
Forward-Reverse Dimers-2.78 kcal/mol
Amplicon Folding-1.793 kcal/mol outside primersite
Amplicon SequenceCTGCACTGTGGAGCAAGGAGTGGCCACGAGCAGGTGGTAGAAATGTTGCTTGATCGAGCT
GCCCCCATTCTTTCAAAAACCAAGAATGGATTATCTCCATTGCACATGGCCACACAAGGG
GATCATTTAAACTGCGTCCAGCTTCTCCTCCAGCATAATGTACCCGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204404 (ANK3)1691291 - 1459
NM_001204403 (ANK3)1691102 - 1270
NM_020987 (ANK3)1691251 - 1419
Exon 12 To Exon 13 (Pair 7)
Forward (2156,20)GCACTGTGGAGCAAGGAGTGAmplicon SizecDNA: 162 bpgenomic: 5,340
Reverse (2317,22)GGTACATTATGCTGGAGGAGAANr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.515 kcal/mol in 3' area
Forward Dimers-1.482 kcal/mol
Reverse Loops1.288 kcal/mol in 3' area
Reverse Dimers-0.684 kcal/mol
Forward-Reverse Dimers-2.732 kcal/mol
Amplicon Folding-1.793 kcal/mol outside primersite
Amplicon SequenceGCACTGTGGAGCAAGGAGTGGCCACGAGCAGGTGGTAGAAATGTTGCTTGATCGAGCTGC
CCCCATTCTTTCAAAAACCAAGAATGGATTATCTCCATTGCACATGGCCACACAAGGGGA
TCATTTAAACTGCGTCCAGCTTCTCCTCCAGCATAATGTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204404 (ANK3)1621293 - 1454
NM_001204403 (ANK3)1621104 - 1265
NM_020987 (ANK3)1621253 - 1414
Exon 12 To Exon 13 (Pair 6)
Forward (2154,20)CTGCACTGTGGAGCAAGGAGAmplicon SizecDNA: 166 bpgenomic: 5,344
Reverse (2319,21)CGGGTACATTATGCTGGAGGANr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.053 kcal/mol
Forward Dimers-2.88 kcal/mol
Reverse Loops1.831 kcal/mol in 3' area
Reverse Dimers-0.684 kcal/mol
Forward-Reverse Dimers-2.732 kcal/mol
Amplicon Folding-1.793 kcal/mol outside primersite
Amplicon SequenceCTGCACTGTGGAGCAAGGAGTGGCCACGAGCAGGTGGTAGAAATGTTGCTTGATCGAGCT
GCCCCCATTCTTTCAAAAACCAAGAATGGATTATCTCCATTGCACATGGCCACACAAGGG
GATCATTTAAACTGCGTCCAGCTTCTCCTCCAGCATAATGTACCCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020987 (ANK3)1661251 - 1416
NM_001204403 (ANK3)1661102 - 1267
NM_001204404 (ANK3)1661291 - 1456
Exon 12 To Exon 13 (Pair 5)
Forward (2156,20)GCACTGTGGAGCAAGGAGTGAmplicon SizecDNA: 167 bpgenomic: 5,345
Reverse (2322,21)CCACGGGTACATTATGCTGGANr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.515 kcal/mol in 3' area
Forward Dimers-1.482 kcal/mol
Reverse Loops1.728 kcal/mol in 3' area
Reverse Dimers-0.684 kcal/mol
Forward-Reverse Dimers-2.78 kcal/mol
Amplicon Folding-1.793 kcal/mol outside primersite
Amplicon SequenceGCACTGTGGAGCAAGGAGTGGCCACGAGCAGGTGGTAGAAATGTTGCTTGATCGAGCTGC
CCCCATTCTTTCAAAAACCAAGAATGGATTATCTCCATTGCACATGGCCACACAAGGGGA
TCATTTAAACTGCGTCCAGCTTCTCCTCCAGCATAATGTACCCGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204404 (ANK3)1671293 - 1459
NM_001204403 (ANK3)1671104 - 1270
NM_020987 (ANK3)1671253 - 1419
Exon 12 To Exon 13 (Pair 4)
Forward (2154,20)CTGCACTGTGGAGCAAGGAGAmplicon SizecDNA: 165 bpgenomic: 5,343
Reverse (2318,21)GGGTACATTATGCTGGAGGAGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.053 kcal/mol
Forward Dimers-2.88 kcal/mol
Reverse Loops1.831 kcal/mol in 3' area
Reverse Dimers-0.684 kcal/mol
Forward-Reverse Dimers-2.732 kcal/mol
Amplicon Folding-1.793 kcal/mol outside primersite
Amplicon SequenceCTGCACTGTGGAGCAAGGAGTGGCCACGAGCAGGTGGTAGAAATGTTGCTTGATCGAGCT
GCCCCCATTCTTTCAAAAACCAAGAATGGATTATCTCCATTGCACATGGCCACACAAGGG
GATCATTTAAACTGCGTCCAGCTTCTCCTCCAGCATAATGTACCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204403 (ANK3)1651102 - 1266
NM_020987 (ANK3)1651251 - 1415
NM_001204404 (ANK3)1651291 - 1455
Exon 12 To Exon 13 (Pair 3)
Forward (2156,20)GCACTGTGGAGCAAGGAGTGAmplicon SizecDNA: 164 bpgenomic: 5,342
Reverse (2319,21)CGGGTACATTATGCTGGAGGANr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.515 kcal/mol in 3' area
Forward Dimers-1.482 kcal/mol
Reverse Loops1.831 kcal/mol in 3' area
Reverse Dimers-0.684 kcal/mol
Forward-Reverse Dimers-2.732 kcal/mol
Amplicon Folding-1.793 kcal/mol outside primersite
Amplicon SequenceGCACTGTGGAGCAAGGAGTGGCCACGAGCAGGTGGTAGAAATGTTGCTTGATCGAGCTGC
CCCCATTCTTTCAAAAACCAAGAATGGATTATCTCCATTGCACATGGCCACACAAGGGGA
TCATTTAAACTGCGTCCAGCTTCTCCTCCAGCATAATGTACCCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204403 (ANK3)1641104 - 1267
NM_020987 (ANK3)1641253 - 1416
NM_001204404 (ANK3)1641293 - 1456
Exon 12 To Exon 13 (Pair 2)
Forward (2154,20)CTGCACTGTGGAGCAAGGAGAmplicon SizecDNA: 167 bpgenomic: 5,345
Reverse (2320,21)ACGGGTACATTATGCTGGAGGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.053 kcal/mol
Forward Dimers-2.88 kcal/mol
Reverse Loops2.014 kcal/mol
Reverse Dimers-0.684 kcal/mol
Forward-Reverse Dimers-2.732 kcal/mol
Amplicon Folding-1.793 kcal/mol outside primersite
Amplicon SequenceCTGCACTGTGGAGCAAGGAGTGGCCACGAGCAGGTGGTAGAAATGTTGCTTGATCGAGCT
GCCCCCATTCTTTCAAAAACCAAGAATGGATTATCTCCATTGCACATGGCCACACAAGGG
GATCATTTAAACTGCGTCCAGCTTCTCCTCCAGCATAATGTACCCGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204403 (ANK3)1671102 - 1268
NM_020987 (ANK3)1671251 - 1417
NM_001204404 (ANK3)1671291 - 1457
Exon 12 To Exon 13 (Pair 1)
Forward (2156,20)GCACTGTGGAGCAAGGAGTGAmplicon SizecDNA: 165 bpgenomic: 5,343
Reverse (2320,21)ACGGGTACATTATGCTGGAGGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.515 kcal/mol in 3' area
Forward Dimers-1.482 kcal/mol
Reverse Loops2.014 kcal/mol
Reverse Dimers-0.684 kcal/mol
Forward-Reverse Dimers-2.732 kcal/mol
Amplicon Folding-1.793 kcal/mol outside primersite
Amplicon SequenceGCACTGTGGAGCAAGGAGTGGCCACGAGCAGGTGGTAGAAATGTTGCTTGATCGAGCTGC
CCCCATTCTTTCAAAAACCAAGAATGGATTATCTCCATTGCACATGGCCACACAAGGGGA
TCATTTAAACTGCGTCCAGCTTCTCCTCCAGCATAATGTACCCGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204404 (ANK3)1651293 - 1457
NM_020987 (ANK3)1651253 - 1417
NM_001204403 (ANK3)1651104 - 1268
Exon 15 To Exon 17 (Pair 4)
Forward (2598,21)ATGCATCATGGAGCCTCACCAAmplicon SizecDNA: 165 bpgenomic: 4,530
Reverse (2762,21)GGCTGAAATGTGGAGTGGTGTNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.356 kcal/mol in 3' area
Forward Dimers-2.826 kcal/mol
Reverse Loops2.265 kcal/mol
Reverse Dimers0.03 kcal/mol
Forward-Reverse Dimers-2.859 kcal/mol
Amplicon Folding-2.485 kcal/mol outside primersite
Amplicon SequenceATGCATCATGGAGCCTCACCAAACACCACCAATGTGAGAGGAGAAACAGCACTGCACATG
GCAGCTCGCTCCGGCCAAGCTGAAGTTGTGCGGTATCTGGTACAAGACGGAGCTCAGGTA
GAAGCTAAAGCTAAGGATGACCAAACACCACTCCACATTTCAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204404 (ANK3)1651735 - 1899
NM_001204403 (ANK3)1651546 - 1710
NM_020987 (ANK3)1651695 - 1859
Exon 15 To Exon 17 (Pair 3)
Forward (2609,21)AGCCTCACCAAACACCACCAAAmplicon SizecDNA: 161 bpgenomic: 4,526
Reverse (2769,20)CCAGTCGGGCTGAAATGTGGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops999.25 kcal/mol
Forward Dimers0.022 kcal/mol
Reverse Loops0.252 kcal/mol
Reverse Dimers-3 kcal/mol
Forward-Reverse Dimers-2.604 kcal/mol
Amplicon Folding-2.485 kcal/mol outside primersite
Amplicon SequenceAGCCTCACCAAACACCACCAATGTGAGAGGAGAAACAGCACTGCACATGGCAGCTCGCTC
CGGCCAAGCTGAAGTTGTGCGGTATCTGGTACAAGACGGAGCTCAGGTAGAAGCTAAAGC
TAAGGATGACCAAACACCACTCCACATTTCAGCCCGACTGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 15 To Exon 17 (Pair 2)
Forward (2603,21)TCATGGAGCCTCACCAAACACAmplicon SizecDNA: 160 bpgenomic: 4,525
Reverse (2762,21)GGCTGAAATGTGGAGTGGTGTNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.286 kcal/mol
Forward Dimers-1.508 kcal/mol
Reverse Loops2.265 kcal/mol
Reverse Dimers0.03 kcal/mol
Forward-Reverse Dimers-2.859 kcal/mol
Amplicon Folding-2.485 kcal/mol outside primersite
Amplicon SequenceTCATGGAGCCTCACCAAACACCACCAATGTGAGAGGAGAAACAGCACTGCACATGGCAGC
TCGCTCCGGCCAAGCTGAAGTTGTGCGGTATCTGGTACAAGACGGAGCTCAGGTAGAAGC
TAAAGCTAAGGATGACCAAACACCACTCCACATTTCAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020987 (ANK3)1601700 - 1859
NM_001204403 (ANK3)1601551 - 1710
NM_001204404 (ANK3)1601740 - 1899
Exon 15 To Exon 17 (Pair 1)
Forward (2611,21)CCTCACCAAACACCACCAATGAmplicon SizecDNA: 154 bpgenomic: 4,519
Reverse (2764,20)CGGGCTGAAATGTGGAGTGGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.184 kcal/mol in 3' area
Forward Dimers0.088 kcal/mol in 3' area
Reverse Loops1.875 kcal/mol
Reverse Dimers-0.931 kcal/mol
Forward-Reverse Dimers-2.757 kcal/mol
Amplicon Folding-2.485 kcal/mol outside primersite
Amplicon SequenceCCTCACCAAACACCACCAATGTGAGAGGAGAAACAGCACTGCACATGGCAGCTCGCTCCG
GCCAAGCTGAAGTTGTGCGGTATCTGGTACAAGACGGAGCTCAGGTAGAAGCTAAAGCTA
AGGATGACCAAACACCACTCCACATTTCAGCCCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204404 (ANK3)1541748 - 1901
NM_001204403 (ANK3)1541559 - 1712
NM_020987 (ANK3)1541708 - 1861
Exon 19 To Exon 20 (Pair 75)
Forward (3093,20)TTGGACCAAGGAGCCTCACCAmplicon SizecDNA: 120 bpgenomic: 9,352
Reverse (3212,21)GGCATCAGCACCATATTCCAGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.292 kcal/mol in 3' area
Forward Dimers-2.132 kcal/mol
Reverse Loops0.544 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.785 kcal/mol
Amplicon Folding0.36 kcal/mol outside primersite
Amplicon SequenceTTGGACCAAGGAGCCTCACCTCACGCAGCCGCAAAGAATGGTTATACGCCACTGCACATC
GCTGCCAAAAAGAACCAGATGGACATAGCGACAACTCTGCTGGAATATGGTGCTGATGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020987 (ANK3)1202190 - 2309
NM_001204403 (ANK3)1202041 - 2160
NM_001204404 (ANK3)1202230 - 2349
Exon 19 To Exon 20 (Pair 74)
Forward (3093,20)TTGGACCAAGGAGCCTCACCAmplicon SizecDNA: 114 bpgenomic: 9,346
Reverse (3206,22)AGCACCATATTCCAGCAGAGTTNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.292 kcal/mol in 3' area
Forward Dimers-2.132 kcal/mol
Reverse Loops1.474 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.667 kcal/mol
Amplicon Folding0.36 kcal/mol outside primersite
Amplicon SequenceTTGGACCAAGGAGCCTCACCTCACGCAGCCGCAAAGAATGGTTATACGCCACTGCACATC
GCTGCCAAAAAGAACCAGATGGACATAGCGACAACTCTGCTGGAATATGGTGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204403 (ANK3)1142041 - 2154
NM_020987 (ANK3)1142190 - 2303
NM_001204404 (ANK3)1142230 - 2343
Exon 19 To Exon 20 (Pair 73)
Forward (3107,19)CTCACCTCACGCAGCCGCAAmplicon SizecDNA: 98 bpgenomic: 9,330
Reverse (3204,22)CACCATATTCCAGCAGAGTTGTNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.944 kcal/mol in 3' area
Forward Dimers-0.458 kcal/mol
Reverse Loops1.748 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.777 kcal/mol
Amplicon Folding0.36 kcal/mol inside primersite
Amplicon SequenceCTCACCTCACGCAGCCGCAAAGAATGGTTATACGCCACTGCACATCGCTGCCAAAAAGAA
CCAGATGGACATAGCGACAACTCTGCTGGAATATGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204404 (ANK3)982244 - 2341
NM_020987 (ANK3)982204 - 2301
NM_001204403 (ANK3)982055 - 2152
Exon 19 To Exon 20 (Pair 72)
Forward (3094,20)TGGACCAAGGAGCCTCACCTAmplicon SizecDNA: 199 bpgenomic: 9,431
Reverse (3292,20)AGGAGCAGCGACACCATGTCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.246 kcal/mol in 3' area
Forward Dimers-2.052 kcal/mol
Reverse Loops0.705 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.806 kcal/mol
Amplicon Folding-1.799 kcal/mol outside primersite
Amplicon SequenceTGGACCAAGGAGCCTCACCTCACGCAGCCGCAAAGAATGGTTATACGCCACTGCACATCG
CTGCCAAAAAGAACCAGATGGACATAGCGACAACTCTGCTGGAATATGGTGCTGATGCCA
ACGCAGTTACCCGGCAAGGAATTGCTTCCGTCCATCTCGCAGCTCAGGAAGGGCACGTGG
ACATGGTGTCGCTGCTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204404 (ANK3)1992231 - 2429
NM_001204403 (ANK3)1992042 - 2240
NM_020987 (ANK3)1992191 - 2389
Exon 19 To Exon 20 (Pair 71)
Forward (3104,19)AGCCTCACCTCACGCAGCCAmplicon SizecDNA: 100 bpgenomic: 9,332
Reverse (3203,22)ACCATATTCCAGCAGAGTTGTCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.801 kcal/mol in 3' area
Forward Dimers-0.458 kcal/mol
Reverse Loops1.748 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.777 kcal/mol
Amplicon Folding0.36 kcal/mol inside primersite
Amplicon SequenceAGCCTCACCTCACGCAGCCGCAAAGAATGGTTATACGCCACTGCACATCGCTGCCAAAAA
GAACCAGATGGACATAGCGACAACTCTGCTGGAATATGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204404 (ANK3)1002241 - 2340
NM_001204403 (ANK3)1002052 - 2151
NM_020987 (ANK3)1002201 - 2300
Exon 19 To Exon 20 (Pair 70)
Forward (3068,22)TAATCAGAAAGTGGCCCTTCTGAmplicon SizecDNA: 147 bpgenomic: 9,379
Reverse (3214,22)TTGGCATCAGCACCATATTCCANr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.728 kcal/mol in 3' area
Forward Dimers-2.544 kcal/mol
Reverse Loops0.544 kcal/mol
Reverse Dimers-0.935 kcal/mol
Forward-Reverse Dimers-1.987 kcal/mol
Amplicon Folding0.36 kcal/mol outside primersite
Amplicon SequenceTAATCAGAAAGTGGCCCTTCTGCTTTTGGACCAAGGAGCCTCACCTCACGCAGCCGCAAA
GAATGGTTATACGCCACTGCACATCGCTGCCAAAAAGAACCAGATGGACATAGCGACAAC
TCTGCTGGAATATGGTGCTGATGCCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204404 (ANK3)1472205 - 2351
NM_001204403 (ANK3)1472016 - 2162
NM_020987 (ANK3)1472165 - 2311
Exon 19 To Exon 20 (Pair 69)
Forward (3068,22)TAATCAGAAAGTGGCCCTTCTGAmplicon SizecDNA: 144 bpgenomic: 9,376
Reverse (3211,21)GCATCAGCACCATATTCCAGCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.728 kcal/mol in 3' area
Forward Dimers-2.544 kcal/mol
Reverse Loops0.835 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.995 kcal/mol
Amplicon Folding0.36 kcal/mol outside primersite
Amplicon SequenceTAATCAGAAAGTGGCCCTTCTGCTTTTGGACCAAGGAGCCTCACCTCACGCAGCCGCAAA
GAATGGTTATACGCCACTGCACATCGCTGCCAAAAAGAACCAGATGGACATAGCGACAAC
TCTGCTGGAATATGGTGCTGATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204404 (ANK3)1442205 - 2348
NM_001204403 (ANK3)1442016 - 2159
NM_020987 (ANK3)1442165 - 2308
Exon 19 To Exon 20 (Pair 68)
Forward (3093,20)TTGGACCAAGGAGCCTCACCAmplicon SizecDNA: 122 bpgenomic: 9,354
Reverse (3214,22)TTGGCATCAGCACCATATTCCANr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.292 kcal/mol in 3' area
Forward Dimers-2.132 kcal/mol
Reverse Loops0.544 kcal/mol
Reverse Dimers-0.935 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding0.36 kcal/mol outside primersite
Amplicon SequenceTTGGACCAAGGAGCCTCACCTCACGCAGCCGCAAAGAATGGTTATACGCCACTGCACATC
GCTGCCAAAAAGAACCAGATGGACATAGCGACAACTCTGCTGGAATATGGTGCTGATGCC
AA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204403 (ANK3)1222041 - 2162
NM_020987 (ANK3)1222190 - 2311
NM_001204404 (ANK3)1222230 - 2351
Exon 19 To Exon 20 (Pair 67)
Forward (3107,19)CTCACCTCACGCAGCCGCAAmplicon SizecDNA: 105 bpgenomic: 9,337
Reverse (3211,21)GCATCAGCACCATATTCCAGCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.944 kcal/mol in 3' area
Forward Dimers-0.458 kcal/mol
Reverse Loops0.835 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.763 kcal/mol
Amplicon Folding0.36 kcal/mol outside primersite
Amplicon SequenceCTCACCTCACGCAGCCGCAAAGAATGGTTATACGCCACTGCACATCGCTGCCAAAAAGAA
CCAGATGGACATAGCGACAACTCTGCTGGAATATGGTGCTGATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204403 (ANK3)1052055 - 2159
NM_020987 (ANK3)1052204 - 2308
NM_001204404 (ANK3)1052244 - 2348
Exon 19 To Exon 20 (Pair 66)
Forward (3104,19)AGCCTCACCTCACGCAGCCAmplicon SizecDNA: 109 bpgenomic: 9,341
Reverse (3212,21)GGCATCAGCACCATATTCCAGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.801 kcal/mol in 3' area
Forward Dimers-0.458 kcal/mol
Reverse Loops0.544 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.785 kcal/mol
Amplicon Folding0.36 kcal/mol outside primersite
Amplicon SequenceAGCCTCACCTCACGCAGCCGCAAAGAATGGTTATACGCCACTGCACATCGCTGCCAAAAA
GAACCAGATGGACATAGCGACAACTCTGCTGGAATATGGTGCTGATGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204403 (ANK3)1092052 - 2160
NM_020987 (ANK3)1092201 - 2309
NM_001204404 (ANK3)1092241 - 2349
Exon 19 To Exon 20 (Pair 65)
Forward (3102,19)GGAGCCTCACCTCACGCAGAmplicon SizecDNA: 102 bpgenomic: 9,334
Reverse (3203,22)ACCATATTCCAGCAGAGTTGTCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.626 kcal/mol
Forward Dimers-0.617 kcal/mol
Reverse Loops1.748 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.025 kcal/mol
Amplicon Folding0.36 kcal/mol inside primersite
Amplicon SequenceGGAGCCTCACCTCACGCAGCCGCAAAGAATGGTTATACGCCACTGCACATCGCTGCCAAA
AAGAACCAGATGGACATAGCGACAACTCTGCTGGAATATGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204403 (ANK3)1022050 - 2151
NM_020987 (ANK3)1022199 - 2300
NM_001204404 (ANK3)1022239 - 2340
Exon 19 To Exon 20 (Pair 64)
Forward (3068,22)TAATCAGAAAGTGGCCCTTCTGAmplicon SizecDNA: 199 bpgenomic: 9,431
Reverse (3266,20)CCCTTCCTGAGCTGCGAGATNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.728 kcal/mol in 3' area
Forward Dimers-2.544 kcal/mol
Reverse Loops1.712 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.724 kcal/mol
Amplicon Folding-1.799 kcal/mol outside primersite
Amplicon SequenceTAATCAGAAAGTGGCCCTTCTGCTTTTGGACCAAGGAGCCTCACCTCACGCAGCCGCAAA
GAATGGTTATACGCCACTGCACATCGCTGCCAAAAAGAACCAGATGGACATAGCGACAAC
TCTGCTGGAATATGGTGCTGATGCCAACGCAGTTACCCGGCAAGGAATTGCTTCCGTCCA
TCTCGCAGCTCAGGAAGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204404 (ANK3)1992205 - 2403
NM_020987 (ANK3)1992165 - 2363
NM_001204403 (ANK3)1992016 - 2214
Exon 19 To Exon 20 (Pair 63)
Forward (3108,20)TCACCTCACGCAGCCGCAAAAmplicon SizecDNA: 104 bpgenomic: 9,336
Reverse (3211,21)GCATCAGCACCATATTCCAGCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.944 kcal/mol in 3' area
Forward Dimers-0.458 kcal/mol
Reverse Loops0.835 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.763 kcal/mol
Amplicon Folding0.36 kcal/mol outside primersite
Amplicon SequenceTCACCTCACGCAGCCGCAAAGAATGGTTATACGCCACTGCACATCGCTGCCAAAAAGAAC
CAGATGGACATAGCGACAACTCTGCTGGAATATGGTGCTGATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204404 (ANK3)1042245 - 2348
NM_020987 (ANK3)1042205 - 2308
NM_001204403 (ANK3)1042056 - 2159
Exon 19 To Exon 20 (Pair 62)
Forward (3104,19)AGCCTCACCTCACGCAGCCAmplicon SizecDNA: 111 bpgenomic: 9,343
Reverse (3214,22)TTGGCATCAGCACCATATTCCANr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.801 kcal/mol in 3' area
Forward Dimers-0.458 kcal/mol
Reverse Loops0.544 kcal/mol
Reverse Dimers-0.935 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding0.36 kcal/mol outside primersite
Amplicon SequenceAGCCTCACCTCACGCAGCCGCAAAGAATGGTTATACGCCACTGCACATCGCTGCCAAAAA
GAACCAGATGGACATAGCGACAACTCTGCTGGAATATGGTGCTGATGCCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204404 (ANK3)1112241 - 2351
NM_001204403 (ANK3)1112052 - 2162
NM_020987 (ANK3)1112201 - 2311
Exon 19 To Exon 20 (Pair 61)
Forward (3094,20)TGGACCAAGGAGCCTCACCTAmplicon SizecDNA: 118 bpgenomic: 9,350
Reverse (3211,21)GCATCAGCACCATATTCCAGCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.246 kcal/mol in 3' area
Forward Dimers-2.052 kcal/mol
Reverse Loops0.835 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.596 kcal/mol
Amplicon Folding0.36 kcal/mol outside primersite
Amplicon SequenceTGGACCAAGGAGCCTCACCTCACGCAGCCGCAAAGAATGGTTATACGCCACTGCACATCG
CTGCCAAAAAGAACCAGATGGACATAGCGACAACTCTGCTGGAATATGGTGCTGATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204404 (ANK3)1182231 - 2348
NM_020987 (ANK3)1182191 - 2308
NM_001204403 (ANK3)1182042 - 2159
Exon 19 To Exon 20 (Pair 60)
Forward (3100,20)AAGGAGCCTCACCTCACGCAAmplicon SizecDNA: 95 bpgenomic: 9,327
Reverse (3194,21)CAGCAGAGTTGTCGCTATGTCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.737 kcal/mol
Forward Dimers-2.057 kcal/mol
Reverse Loops0.493 kcal/mol
Reverse Dimers-1.334 kcal/mol
Forward-Reverse Dimers-1.579 kcal/mol
Amplicon Folding0.36 kcal/mol inside primersite
Amplicon SequenceAAGGAGCCTCACCTCACGCAGCCGCAAAGAATGGTTATACGCCACTGCACATCGCTGCCA
AAAAGAACCAGATGGACATAGCGACAACTCTGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204404 (ANK3)952237 - 2331
NM_001204403 (ANK3)952048 - 2142
NM_020987 (ANK3)952197 - 2291
Exon 19 To Exon 20 (Pair 59)
Forward (3100,20)AAGGAGCCTCACCTCACGCAAmplicon SizecDNA: 94 bpgenomic: 9,326
Reverse (3193,21)AGCAGAGTTGTCGCTATGTCCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.737 kcal/mol
Forward Dimers-2.057 kcal/mol
Reverse Loops0.967 kcal/mol
Reverse Dimers-0.86 kcal/mol
Forward-Reverse Dimers-1.579 kcal/mol
Amplicon Folding0.36 kcal/mol inside primersite
Amplicon SequenceAAGGAGCCTCACCTCACGCAGCCGCAAAGAATGGTTATACGCCACTGCACATCGCTGCCA
AAAAGAACCAGATGGACATAGCGACAACTCTGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020987 (ANK3)942197 - 2290
NM_001204403 (ANK3)942048 - 2141
NM_001204404 (ANK3)942237 - 2330
Exon 19 To Exon 20 (Pair 58)
Forward (3094,20)TGGACCAAGGAGCCTCACCTAmplicon SizecDNA: 172 bpgenomic: 9,404
Reverse (3265,20)CCTTCCTGAGCTGCGAGATGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.246 kcal/mol in 3' area
Forward Dimers-2.052 kcal/mol
Reverse Loops1.712 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.351 kcal/mol
Amplicon Folding-1.799 kcal/mol outside primersite
Amplicon SequenceTGGACCAAGGAGCCTCACCTCACGCAGCCGCAAAGAATGGTTATACGCCACTGCACATCG
CTGCCAAAAAGAACCAGATGGACATAGCGACAACTCTGCTGGAATATGGTGCTGATGCCA
ACGCAGTTACCCGGCAAGGAATTGCTTCCGTCCATCTCGCAGCTCAGGAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204403 (ANK3)1722042 - 2213
NM_020987 (ANK3)1722191 - 2362
NM_001204404 (ANK3)1722231 - 2402
Exon 19 To Exon 20 (Pair 57)
Forward (3068,22)TAATCAGAAAGTGGCCCTTCTGAmplicon SizecDNA: 197 bpgenomic: 9,429
Reverse (3264,20)CTTCCTGAGCTGCGAGATGGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.728 kcal/mol in 3' area
Forward Dimers-2.544 kcal/mol
Reverse Loops1.712 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.724 kcal/mol
Amplicon Folding-1.799 kcal/mol outside primersite
Amplicon SequenceTAATCAGAAAGTGGCCCTTCTGCTTTTGGACCAAGGAGCCTCACCTCACGCAGCCGCAAA
GAATGGTTATACGCCACTGCACATCGCTGCCAAAAAGAACCAGATGGACATAGCGACAAC
TCTGCTGGAATATGGTGCTGATGCCAACGCAGTTACCCGGCAAGGAATTGCTTCCGTCCA
TCTCGCAGCTCAGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204403 (ANK3)1972016 - 2212
NM_020987 (ANK3)1972165 - 2361
NM_001204404 (ANK3)1972205 - 2401
Exon 19 To Exon 20 (Pair 56)
Forward (3100,20)AAGGAGCCTCACCTCACGCAAmplicon SizecDNA: 83 bpgenomic: 9,315
Reverse (3182,22)CGCTATGTCCATCTGGTTCTTTNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.737 kcal/mol
Forward Dimers-2.057 kcal/mol
Reverse Loops1.458 kcal/mol
Reverse Dimers-0.116 kcal/mol
Forward-Reverse Dimers-1.64 kcal/mol
Amplicon Folding0.405 kcal/mol outside primersite
Amplicon SequenceAAGGAGCCTCACCTCACGCAGCCGCAAAGAATGGTTATACGCCACTGCACATCGCTGCCA
AAAAGAACCAGATGGACATAGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204404 (ANK3)832237 - 2319
NM_020987 (ANK3)832197 - 2279
NM_001204403 (ANK3)832048 - 2130
Exon 19 To Exon 20 (Pair 55)
Forward (3108,20)TCACCTCACGCAGCCGCAAAAmplicon SizecDNA: 87 bpgenomic: 9,319
Reverse (3194,21)CAGCAGAGTTGTCGCTATGTCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.944 kcal/mol in 3' area
Forward Dimers-0.458 kcal/mol
Reverse Loops0.493 kcal/mol
Reverse Dimers-1.334 kcal/mol
Forward-Reverse Dimers-1.49 kcal/mol
Amplicon Folding0.36 kcal/mol inside primersite
Amplicon SequenceTCACCTCACGCAGCCGCAAAGAATGGTTATACGCCACTGCACATCGCTGCCAAAAAGAAC
CAGATGGACATAGCGACAACTCTGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204404 (ANK3)872245 - 2331
NM_001204403 (ANK3)872056 - 2142
NM_020987 (ANK3)872205 - 2291
Exon 19 To Exon 20 (Pair 54)
Forward (3093,20)TTGGACCAAGGAGCCTCACCAmplicon SizecDNA: 101 bpgenomic: 9,333
Reverse (3193,21)AGCAGAGTTGTCGCTATGTCCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.292 kcal/mol in 3' area
Forward Dimers-2.132 kcal/mol
Reverse Loops0.967 kcal/mol
Reverse Dimers-0.86 kcal/mol
Forward-Reverse Dimers-1.579 kcal/mol
Amplicon Folding0.36 kcal/mol inside primersite
Amplicon SequenceTTGGACCAAGGAGCCTCACCTCACGCAGCCGCAAAGAATGGTTATACGCCACTGCACATC
GCTGCCAAAAAGAACCAGATGGACATAGCGACAACTCTGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204403 (ANK3)1012041 - 2141
NM_020987 (ANK3)1012190 - 2290
NM_001204404 (ANK3)1012230 - 2330
 

See below for some more details.

Program Output:

Loading ...