Design Results for ARRDC3

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size90Maximal Amplicon Size150
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size1000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 9 To Exon 10 (Pair 1)
Forward (2853,22)ATCCAGGAGTTTCGATTCTTGCAmplicon SizecDNA: 108 bpgenomic: 2,335
Reverse (2960,21)AGTGTTCCTTCAACGAGAGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.135 kcal/mol
Forward Dimers-1.304 kcal/mol
Reverse Loops0.926 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding0.677 kcal/mol outside primersite
Amplicon SequenceATCCAGGAGTTTCGATTCTTGCCTCCACCTCTTTATTCAGAGATTGATCCAAATCCTGAT
CAGTCAGCAGATGATAGACCATCCTGCCCCTCTCGTTGAAGGAACACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020801 (ARRDC3)1081387 - 1494
Exon 9 To Exon 10 (Pair 2)
Forward (2858,21)GGAGTTTCGATTCTTGCCTCCAmplicon SizecDNA: 103 bpgenomic: 2,330
Reverse (2960,21)AGTGTTCCTTCAACGAGAGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.643 kcal/mol in 3' area
Forward Dimers-1.184 kcal/mol
Reverse Loops0.926 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding0.677 kcal/mol outside primersite
Amplicon SequenceGGAGTTTCGATTCTTGCCTCCACCTCTTTATTCAGAGATTGATCCAAATCCTGATCAGTC
AGCAGATGATAGACCATCCTGCCCCTCTCGTTGAAGGAACACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020801 (ARRDC3)1031392 - 1494
Exon 9 To Exon 10 (Pair 3)
Forward (2855,21)CCAGGAGTTTCGATTCTTGCCAmplicon SizecDNA: 106 bpgenomic: 2,333
Reverse (2960,21)AGTGTTCCTTCAACGAGAGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.135 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.926 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding0.677 kcal/mol outside primersite
Amplicon SequenceCCAGGAGTTTCGATTCTTGCCTCCACCTCTTTATTCAGAGATTGATCCAAATCCTGATCA
GTCAGCAGATGATAGACCATCCTGCCCCTCTCGTTGAAGGAACACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020801 (ARRDC3)1061389 - 1494
Exon 9 To Exon 10 (Pair 4)
Forward (2861,21)GTTTCGATTCTTGCCTCCACCAmplicon SizecDNA: 100 bpgenomic: 2,327
Reverse (2960,21)AGTGTTCCTTCAACGAGAGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.211 kcal/mol in 3' area
Forward Dimers-1.184 kcal/mol
Reverse Loops0.926 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding0.677 kcal/mol outside primersite
Amplicon SequenceGTTTCGATTCTTGCCTCCACCTCTTTATTCAGAGATTGATCCAAATCCTGATCAGTCAGC
AGATGATAGACCATCCTGCCCCTCTCGTTGAAGGAACACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020801 (ARRDC3)1001395 - 1494
Exon 9 To Exon 10 (Pair 5)
Forward (2851,23)ATATCCAGGAGTTTCGATTCTTGAmplicon SizecDNA: 110 bpgenomic: 2,337
Reverse (2960,21)AGTGTTCCTTCAACGAGAGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.135 kcal/mol
Forward Dimers-1.304 kcal/mol
Reverse Loops0.926 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding0.677 kcal/mol outside primersite
Amplicon SequenceATATCCAGGAGTTTCGATTCTTGCCTCCACCTCTTTATTCAGAGATTGATCCAAATCCTG
ATCAGTCAGCAGATGATAGACCATCCTGCCCCTCTCGTTGAAGGAACACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020801 (ARRDC3)1101385 - 1494
 

See below for some more details.

Program Output:

Loading ...