Temporary Results for AXL

The pipeline has not yet finished: This page will refresh in 30 seconds untill completion.

Design Results for AXL

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size100Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 12 To Exon 14 (Pair 1)
Forward (1743,22)TCATCTTGGCTCTCTTCCTTGTAmplicon SizecDNA: 208 bpgenomic: 5,614
Reverse (1950,20)TGCCGGTCCACCATCACATCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.3 kcal/mol
Forward Dimers-0.004 kcal/mol
Reverse Loops1.322 kcal/mol
Reverse Dimers-2.894 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-1.489 kcal/mol outside primersite
Amplicon SequenceTCATCTTGGCTCTCTTCCTTGTCCACCGGCGAAAGAAGGAGACCCGTTATGGAGAAGTGT
TTGAACCAACAGTGGAAAGAGGTGAACTGGTAGTCAGGTACCGCGTGCGCAAGTCCTACA
GTCGTCGGACCACTGAAGCTACCTTGAACAGCCTGGGCATCAGTGAAGAGCTGAAGGAGA
AGCTGCGGGATGTGATGGTGGACCGGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2081588 - 1795
NM_001278599 ()208966 - 1173
NM_001699 (AXL)2081561 - 1768
Exon 12 To Exon 14 (Pair 2)
Forward (1746,21)TCTTGGCTCTCTTCCTTGTCCAmplicon SizecDNA: 205 bpgenomic: 5,611
Reverse (1950,20)TGCCGGTCCACCATCACATCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.35 kcal/mol
Forward Dimers-0.004 kcal/mol
Reverse Loops1.322 kcal/mol
Reverse Dimers-2.894 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-1.489 kcal/mol outside primersite
Amplicon SequenceTCTTGGCTCTCTTCCTTGTCCACCGGCGAAAGAAGGAGACCCGTTATGGAGAAGTGTTTG
AACCAACAGTGGAAAGAGGTGAACTGGTAGTCAGGTACCGCGTGCGCAAGTCCTACAGTC
GTCGGACCACTGAAGCTACCTTGAACAGCCTGGGCATCAGTGAAGAGCTGAAGGAGAAGC
TGCGGGATGTGATGGTGGACCGGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()205969 - 1173
NM_021913 (AXL)2051591 - 1795
NM_001699 (AXL)2051564 - 1768
Exon 15 To Exon 17 (Pair 1)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 209 bpgenomic: 4,141
Reverse (2216,22)TGAAAGGTAAGATGACCACAGGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.968 kcal/mol
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
CCATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTT
CCCAGCACCTGTGGTCATCTTACCTTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2091231 - 1439
NM_021913 (AXL)2091853 - 2061
NM_001699 (AXL)2091826 - 2034
Exon 15 To Exon 17 (Pair 2)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 234 bpgenomic: 4,166
Reverse (2244,21)AGGAAGCTGTGTAGGTCTCCANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCC
AGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2341829 - 2062
NM_021913 (AXL)2341856 - 2089
NM_001278599 ()2341234 - 1467
Exon 15 To Exon 17 (Pair 3)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 210 bpgenomic: 4,142
Reverse (2220,23)TTCATGAAAGGTAAGATGACCACNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.968 kcal/mol in 3' area
Reverse Dimers-2.324 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCC
AGCACCTGTGGTCATCTTACCTTTCATGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2101829 - 2038
NM_001278599 ()2101234 - 1443
NM_021913 (AXL)2101856 - 2065
Exon 15 To Exon 16 (Pair 1)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 111 bpgenomic: 3,641
Reverse (2119,21)CTTCATGCAGACCGCTTCACTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.776 kcal/mol
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-1.586 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)1111827 - 1937
NM_021913 (AXL)1111854 - 1964
NM_001278599 ()1111232 - 1342
Exon 15 To Exon 16 (Pair 2)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 128 bpgenomic: 3,658
Reverse (2137,22)GTTGGGATGGTCAAATTCCTTCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.384 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.583 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()1281233 - 1360
NM_021913 (AXL)1281855 - 1982
NM_001699 (AXL)1281828 - 1955
Exon 15 To Exon 17 (Pair 4)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 243 bpgenomic: 4,175
Reverse (2252,22)AATAGAGGAGGAAGCTGTGTAGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.718 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTCT
ATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2431828 - 2070
NM_001278599 ()2431233 - 1475
NM_021913 (AXL)2431855 - 2097
Exon 15 To Exon 16 (Pair 3)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 129 bpgenomic: 3,659
Reverse (2137,22)GTTGGGATGGTCAAATTCCTTCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.384 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.583 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)1291827 - 1955
NM_001278599 ()1291232 - 1360
NM_021913 (AXL)1291854 - 1982
Exon 15 To Exon 17 (Pair 5)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 207 bpgenomic: 4,139
Reverse (2220,23)TTCATGAAAGGTAAGATGACCACNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.968 kcal/mol in 3' area
Reverse Dimers-2.324 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCC
CAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGC
ACCTGTGGTCATCTTACCTTTCATGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2071859 - 2065
NM_001278599 ()2071237 - 1443
NM_001699 (AXL)2071832 - 2038
Exon 15 To Exon 17 (Pair 6)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 231 bpgenomic: 4,163
Reverse (2241,22)AAGCTGTGTAGGTCTCCATGTTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCC
AGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2311829 - 2059
NM_001278599 ()2311234 - 1464
NM_021913 (AXL)2311856 - 2086
Exon 15 To Exon 17 (Pair 7)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 250 bpgenomic: 4,182
Reverse (2257,20)CCGGGAATAGAGGAGGAAGCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.772 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
CCATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTT
CCCAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCT
CTATTCCCGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2501826 - 2075
NM_001278599 ()2501231 - 1480
NM_021913 (AXL)2501853 - 2102
Exon 15 To Exon 17 (Pair 8)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 240 bpgenomic: 4,172
Reverse (2249,21)AGAGGAGGAAGCTGTGTAGGTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.718 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2401828 - 2067
NM_001278599 ()2401233 - 1472
NM_021913 (AXL)2401855 - 2094
Exon 15 To Exon 17 (Pair 9)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 232 bpgenomic: 4,164
Reverse (2241,22)AAGCTGTGTAGGTCTCCATGTTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.718 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2321828 - 2059
NM_001278599 ()2321233 - 1464
NM_021913 (AXL)2321855 - 2086
Exon 15 To Exon 17 (Pair 10)
Forward (2038,21)GGTGGCTGTGAAGACGATGAAAmplicon SizecDNA: 205 bpgenomic: 4,137
Reverse (2242,21)GAAGCTGTGTAGGTCTCCATGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCT
GAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGT
CTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCAT
GAAACATGGAGACCTACACAGCTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2051261 - 1465
NM_021913 (AXL)2051883 - 2087
NM_001699 (AXL)2051856 - 2060
Exon 15 To Exon 17 (Pair 11)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 230 bpgenomic: 4,162
Reverse (2240,22)AGCTGTGTAGGTCTCCATGTTTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCC
AGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2301829 - 2058
NM_001278599 ()2301234 - 1463
NM_021913 (AXL)2301856 - 2085
Exon 15 To Exon 17 (Pair 12)
Forward (2038,21)GGTGGCTGTGAAGACGATGAAAmplicon SizecDNA: 204 bpgenomic: 4,136
Reverse (2241,22)AAGCTGTGTAGGTCTCCATGTTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCT
GAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGT
CTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCAT
GAAACATGGAGACCTACACAGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2041883 - 2086
NM_001278599 ()2041261 - 1464
NM_001699 (AXL)2041856 - 2059
Exon 15 To Exon 16 (Pair 4)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 127 bpgenomic: 3,657
Reverse (2134,22)GGGATGGTCAAATTCCTTCATGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.752 kcal/mol in 3' area
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.583 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
CCATCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)1271826 - 1952
NM_001278599 ()1271231 - 1357
NM_021913 (AXL)1271853 - 1979
Exon 15 To Exon 17 (Pair 13)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 206 bpgenomic: 4,138
Reverse (2215,22)GAAAGGTAAGATGACCACAGGTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops0.867 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2061855 - 2060
NM_001278599 ()2061233 - 1438
NM_001699 (AXL)2061828 - 2033
Exon 15 To Exon 16 (Pair 5)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 114 bpgenomic: 3,644
Reverse (2122,21)TTCCTTCATGCAGACCGCTTCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.776 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)1141827 - 1940
NM_001278599 ()1141232 - 1345
NM_021913 (AXL)1141854 - 1967
Exon 15 To Exon 17 (Pair 14)
Forward (2039,21)GTGGCTGTGAAGACGATGAAGAmplicon SizecDNA: 206 bpgenomic: 4,138
Reverse (2244,21)AGGAAGCTGTGTAGGTCTCCANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCTG
AGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGTC
TGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCATG
AAACATGGAGACCTACACAGCTTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2061884 - 2089
NM_001278599 ()2061262 - 1467
NM_001699 (AXL)2061857 - 2062
Exon 15 To Exon 18 (Pair 1)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 299 bpgenomic: 4,862
Reverse (2309,22)CCATGAACTTCACTAGCATCTGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.586 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.568 kcal/mol
Amplicon Folding-1.612 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCC
AGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTCTA
TTCCCGGCTCGGGGACCAGCCAGTGTACCTGCCCACTCAGATGCTAGTGAAGTTCATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2991829 - 2127
NM_021913 (AXL)2991856 - 2154
NM_001278599 ()2991234 - 1532
Exon 15 To Exon 16 (Pair 6)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 128 bpgenomic: 3,658
Reverse (2136,23)TTGGGATGGTCAAATTCCTTCATNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.384 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.583 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)1281827 - 1954
NM_001278599 ()1281232 - 1359
NM_021913 (AXL)1281854 - 1981
Exon 15 To Exon 18 (Pair 2)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 301 bpgenomic: 4,864
Reverse (2309,22)CCATGAACTTCACTAGCATCTGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.586 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.895 kcal/mol
Amplicon Folding-1.612 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
CCAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTC
TATTCCCGGCTCGGGGACCAGCCAGTGTACCTGCCCACTCAGATGCTAGTGAAGTTCATG
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)3011827 - 2127
NM_021913 (AXL)3011854 - 2154
NM_001278599 ()3011232 - 1532
Exon 15 To Exon 16 (Pair 7)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 106 bpgenomic: 3,636
Reverse (2119,21)CTTCATGCAGACCGCTTCACTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.776 kcal/mol
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-1.186 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)1061832 - 1937
NM_001278599 ()1061237 - 1342
NM_021913 (AXL)1061859 - 1964
Exon 15 To Exon 17 (Pair 15)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 231 bpgenomic: 4,163
Reverse (2240,22)AGCTGTGTAGGTCTCCATGTTTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers-2.177 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2311855 - 2085
NM_001278599 ()2311233 - 1463
NM_001699 (AXL)2311828 - 2058
Exon 15 To Exon 16 (Pair 8)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 105 bpgenomic: 3,635
Reverse (2118,21)TTCATGCAGACCGCTTCACTCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.776 kcal/mol
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-1.186 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()1051237 - 1341
NM_021913 (AXL)1051859 - 1963
NM_001699 (AXL)1051832 - 1936
Exon 15 To Exon 17 (Pair 16)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 244 bpgenomic: 4,176
Reverse (2253,22)GAATAGAGGAGGAAGCTGTGTANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.718 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTCT
ATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2441855 - 2098
NM_001278599 ()2441233 - 1476
NM_001699 (AXL)2441828 - 2071
Exon 15 To Exon 17 (Pair 17)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 228 bpgenomic: 4,160
Reverse (2241,22)AAGCTGTGTAGGTCTCCATGTTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCC
CAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGC
ACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2281832 - 2059
NM_021913 (AXL)2281859 - 2086
NM_001278599 ()2281237 - 1464
Exon 15 To Exon 16 (Pair 9)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 129 bpgenomic: 3,659
Reverse (2136,23)TTGGGATGGTCAAATTCCTTCATNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.384 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.583 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
CCATCCCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)1291853 - 1981
NM_001278599 ()1291231 - 1359
NM_001699 (AXL)1291826 - 1954
Exon 15 To Exon 16 (Pair 10)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 130 bpgenomic: 3,660
Reverse (2139,22)ACGTTGGGATGGTCAAATTCCTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.384 kcal/mol
Reverse Dimers-1.942 kcal/mol
Forward-Reverse Dimers-2.823 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)1301828 - 1957
NM_021913 (AXL)1301855 - 1984
NM_001278599 ()1301233 - 1362
Exon 15 To Exon 16 (Pair 11)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 116 bpgenomic: 3,646
Reverse (2125,22)AAATTCCTTCATGCAGACCGCTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops0.776 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()1161233 - 1348
NM_021913 (AXL)1161855 - 1970
NM_001699 (AXL)1161828 - 1943
Exon 15 To Exon 16 (Pair 12)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 114 bpgenomic: 3,644
Reverse (2124,22)AATTCCTTCATGCAGACCGCTTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.776 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()1141234 - 1347
NM_021913 (AXL)1141856 - 1969
NM_001699 (AXL)1141829 - 1942
Exon 15 To Exon 16 (Pair 13)
Forward (2038,21)GGTGGCTGTGAAGACGATGAAAmplicon SizecDNA: 102 bpgenomic: 3,632
Reverse (2139,22)ACGTTGGGATGGTCAAATTCCTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.384 kcal/mol
Reverse Dimers-1.942 kcal/mol
Forward-Reverse Dimers-2.823 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCT
GAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)1021883 - 1984
NM_001278599 ()1021261 - 1362
NM_001699 (AXL)1021856 - 1957
Exon 15 To Exon 16 (Pair 14)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 111 bpgenomic: 3,641
Reverse (2121,21)TCCTTCATGCAGACCGCTTCANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.776 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)1111856 - 1966
NM_001278599 ()1111234 - 1344
NM_001699 (AXL)1111829 - 1939
Exon 15 To Exon 16 (Pair 15)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 130 bpgenomic: 3,660
Reverse (2137,22)GTTGGGATGGTCAAATTCCTTCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.384 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.782 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
CCATCCCAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)1301853 - 1982
NM_001278599 ()1301231 - 1360
NM_001699 (AXL)1301826 - 1955
Exon 15 To Exon 16 (Pair 16)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 115 bpgenomic: 3,645
Reverse (2122,21)TTCCTTCATGCAGACCGCTTCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.776 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)1151826 - 1940
NM_021913 (AXL)1151853 - 1967
NM_001278599 ()1151231 - 1345
Exon 15 To Exon 17 (Pair 18)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 206 bpgenomic: 4,138
Reverse (2219,23)TCATGAAAGGTAAGATGACCACANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.968 kcal/mol in 3' area
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCC
CAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGC
ACCTGTGGTCATCTTACCTTTCATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2061832 - 2037
NM_021913 (AXL)2061859 - 2064
NM_001278599 ()2061237 - 1442
Exon 15 To Exon 16 (Pair 17)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 112 bpgenomic: 3,642
Reverse (2122,21)TTCCTTCATGCAGACCGCTTCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.776 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)1121829 - 1940
NM_021913 (AXL)1121856 - 1967
NM_001278599 ()1121234 - 1345
Exon 15 To Exon 17 (Pair 19)
Forward (2038,21)GGTGGCTGTGAAGACGATGAAAmplicon SizecDNA: 151 bpgenomic: 4,083
Reverse (2188,21)GAAGCTCTCTCGTTCAGAACCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.34 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.585 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCT
GAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGT
CTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)1511856 - 2006
NM_001278599 ()1511261 - 1411
NM_021913 (AXL)1511883 - 2033
Exon 15 To Exon 17 (Pair 20)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 207 bpgenomic: 4,139
Reverse (2216,22)TGAAAGGTAAGATGACCACAGGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops0.968 kcal/mol
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2071828 - 2034
NM_021913 (AXL)2071855 - 2061
NM_001278599 ()2071233 - 1439
Exon 15 To Exon 17 (Pair 21)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 225 bpgenomic: 4,157
Reverse (2238,22)CTGTGTAGGTCTCCATGTTTCANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCC
CAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGC
ACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2251832 - 2056
NM_001278599 ()2251237 - 1461
NM_021913 (AXL)2251859 - 2083
Exon 15 To Exon 16 (Pair 18)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 125 bpgenomic: 3,655
Reverse (2134,22)GGGATGGTCAAATTCCTTCATGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.752 kcal/mol in 3' area
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.583 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)1251828 - 1952
NM_001278599 ()1251233 - 1357
NM_021913 (AXL)1251855 - 1979
Exon 15 To Exon 17 (Pair 22)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 203 bpgenomic: 4,135
Reverse (2216,22)TGAAAGGTAAGATGACCACAGGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.968 kcal/mol
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCC
CAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGC
ACCTGTGGTCATCTTACCTTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2031832 - 2034
NM_021913 (AXL)2031859 - 2061
NM_001278599 ()2031237 - 1439
Exon 15 To Exon 17 (Pair 23)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 232 bpgenomic: 4,164
Reverse (2240,22)AGCTGTGTAGGTCTCCATGTTTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers-2.651 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
CCAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2321854 - 2085
NM_001278599 ()2321232 - 1463
NM_001699 (AXL)2321827 - 2058
Exon 15 To Exon 17 (Pair 24)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 201 bpgenomic: 4,133
Reverse (2214,22)AAAGGTAAGATGACCACAGGTGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.47 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCC
CAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGC
ACCTGTGGTCATCTTACCTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2011832 - 2032
NM_021913 (AXL)2011859 - 2059
NM_001278599 ()2011237 - 1437
Exon 15 To Exon 17 (Pair 25)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 248 bpgenomic: 4,180
Reverse (2258,20)GCCGGGAATAGAGGAGGAAGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.398 kcal/mol
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-2.543 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCC
AGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTCTA
TTCCCGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2481856 - 2103
NM_001278599 ()2481234 - 1481
NM_001699 (AXL)2481829 - 2076
Exon 15 To Exon 16 (Pair 19)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 125 bpgenomic: 3,655
Reverse (2133,22)GGATGGTCAAATTCCTTCATGCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.752 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.583 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)1251827 - 1951
NM_021913 (AXL)1251854 - 1978
NM_001278599 ()1251232 - 1356
Exon 15 To Exon 17 (Pair 26)
Forward (2038,21)GGTGGCTGTGAAGACGATGAAAmplicon SizecDNA: 206 bpgenomic: 4,138
Reverse (2243,21)GGAAGCTGTGTAGGTCTCCATNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCT
GAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGT
CTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCAT
GAAACATGGAGACCTACACAGCTTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2061261 - 1466
NM_021913 (AXL)2061883 - 2088
NM_001699 (AXL)2061856 - 2061
Exon 15 To Exon 17 (Pair 27)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 234 bpgenomic: 4,166
Reverse (2243,21)GGAAGCTGTGTAGGTCTCCATNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.718 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2341233 - 1466
NM_021913 (AXL)2341855 - 2088
NM_001699 (AXL)2341828 - 2061
Exon 15 To Exon 17 (Pair 28)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 210 bpgenomic: 4,142
Reverse (2219,23)TCATGAAAGGTAAGATGACCACANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops0.968 kcal/mol in 3' area
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2101233 - 1442
NM_021913 (AXL)2101855 - 2064
NM_001699 (AXL)2101828 - 2037
Exon 15 To Exon 17 (Pair 29)
Forward (2039,21)GTGGCTGTGAAGACGATGAAGAmplicon SizecDNA: 214 bpgenomic: 4,146
Reverse (2252,22)AATAGAGGAGGAAGCTGTGTAGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCTG
AGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGTC
TGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCATG
AAACATGGAGACCTACACAGCTTCCTCCTCTATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2141884 - 2097
NM_001278599 ()2141262 - 1475
NM_001699 (AXL)2141857 - 2070
Exon 15 To Exon 16 (Pair 20)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 126 bpgenomic: 3,656
Reverse (2136,23)TTGGGATGGTCAAATTCCTTCATNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.384 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.583 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)1261829 - 1954
NM_001278599 ()1261234 - 1359
NM_021913 (AXL)1261856 - 1981
Exon 15 To Exon 17 (Pair 31)
Forward (2038,21)GGTGGCTGTGAAGACGATGAAAmplicon SizecDNA: 150 bpgenomic: 4,082
Reverse (2187,21)AAGCTCTCTCGTTCAGAACCCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.34 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.585 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCT
GAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGT
CTGTTTCCAGGGTTCTGAACGAGAGAGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)1501883 - 2032
NM_001278599 ()1501261 - 1410
NM_001699 (AXL)1501856 - 2005
Exon 15 To Exon 17 (Pair 32)
Forward (2039,21)GTGGCTGTGAAGACGATGAAGAmplicon SizecDNA: 211 bpgenomic: 4,143
Reverse (2249,21)AGAGGAGGAAGCTGTGTAGGTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCTG
AGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGTC
TGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCATG
AAACATGGAGACCTACACAGCTTCCTCCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2111884 - 2094
NM_001278599 ()2111262 - 1472
NM_001699 (AXL)2111857 - 2067
Exon 15 To Exon 16 (Pair 21)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 118 bpgenomic: 3,648
Reverse (2127,22)TCAAATTCCTTCATGCAGACCGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.562 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()1181233 - 1350
NM_021913 (AXL)1181855 - 1972
NM_001699 (AXL)1181828 - 1945
Exon 15 To Exon 16 (Pair 22)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 129 bpgenomic: 3,659
Reverse (2139,22)ACGTTGGGATGGTCAAATTCCTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.384 kcal/mol
Reverse Dimers-1.942 kcal/mol
Forward-Reverse Dimers-2.823 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)1291856 - 1984
NM_001278599 ()1291234 - 1362
NM_001699 (AXL)1291829 - 1957
Exon 15 To Exon 17 (Pair 33)
Forward (2038,21)GGTGGCTGTGAAGACGATGAAAmplicon SizecDNA: 210 bpgenomic: 4,142
Reverse (2247,21)AGGAGGAAGCTGTGTAGGTCTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCT
GAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGT
CTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCAT
GAAACATGGAGACCTACACAGCTTCCTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2101856 - 2065
NM_001278599 ()2101261 - 1470
NM_021913 (AXL)2101883 - 2092
Exon 15 To Exon 17 (Pair 34)
Forward (2038,21)GGTGGCTGTGAAGACGATGAAAmplicon SizecDNA: 212 bpgenomic: 4,144
Reverse (2249,21)AGAGGAGGAAGCTGTGTAGGTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCT
GAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGT
CTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCAT
GAAACATGGAGACCTACACAGCTTCCTCCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2121883 - 2094
NM_001278599 ()2121261 - 1472
NM_001699 (AXL)2121856 - 2067
Exon 15 To Exon 16 (Pair 24)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 126 bpgenomic: 3,656
Reverse (2133,22)GGATGGTCAAATTCCTTCATGCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.752 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.583 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
CCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)1261826 - 1951
NM_021913 (AXL)1261853 - 1978
NM_001278599 ()1261231 - 1356
Exon 15 To Exon 17 (Pair 35)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 230 bpgenomic: 4,162
Reverse (2243,21)GGAAGCTGTGTAGGTCTCCATNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCC
CAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGC
ACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2301832 - 2061
NM_021913 (AXL)2301859 - 2088
NM_001278599 ()2301237 - 1466
Exon 15 To Exon 17 (Pair 36)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 235 bpgenomic: 4,167
Reverse (2244,21)AGGAAGCTGTGTAGGTCTCCANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.718 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2351233 - 1467
NM_021913 (AXL)2351855 - 2089
NM_001699 (AXL)2351828 - 2062
Exon 15 To Exon 17 (Pair 37)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 228 bpgenomic: 4,160
Reverse (2238,22)CTGTGTAGGTCTCCATGTTTCANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCC
AGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2281829 - 2056
NM_001278599 ()2281234 - 1461
NM_021913 (AXL)2281856 - 2083
Exon 15 To Exon 17 (Pair 38)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 202 bpgenomic: 4,134
Reverse (2212,21)AGGTAAGATGACCACAGGTGCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.47 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCC
AGCACCTGTGGTCATCTTACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2021234 - 1435
NM_021913 (AXL)2021856 - 2057
NM_001699 (AXL)2021829 - 2030
Exon 15 To Exon 16 (Pair 25)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 126 bpgenomic: 3,656
Reverse (2134,22)GGGATGGTCAAATTCCTTCATGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.752 kcal/mol in 3' area
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.583 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)1261854 - 1979
NM_001278599 ()1261232 - 1357
NM_001699 (AXL)1261827 - 1952
Exon 15 To Exon 16 (Pair 26)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 119 bpgenomic: 3,649
Reverse (2127,22)TCAAATTCCTTCATGCAGACCGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.562 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)1191827 - 1945
NM_001278599 ()1191232 - 1350
NM_021913 (AXL)1191854 - 1972
Exon 15 To Exon 17 (Pair 39)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 204 bpgenomic: 4,136
Reverse (2212,21)AGGTAAGATGACCACAGGTGCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.47 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
CCAGCACCTGTGGTCATCTTACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2041232 - 1435
NM_021913 (AXL)2041854 - 2057
NM_001699 (AXL)2041827 - 2030
Exon 15 To Exon 17 (Pair 40)
Forward (2038,21)GGTGGCTGTGAAGACGATGAAAmplicon SizecDNA: 207 bpgenomic: 4,139
Reverse (2244,21)AGGAAGCTGTGTAGGTCTCCANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCT
GAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGT
CTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCAT
GAAACATGGAGACCTACACAGCTTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2071856 - 2062
NM_001278599 ()2071261 - 1467
NM_021913 (AXL)2071883 - 2089
Exon 15 To Exon 17 (Pair 41)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 208 bpgenomic: 4,140
Reverse (2215,22)GAAAGGTAAGATGACCACAGGTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.867 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
CCATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTT
CCCAGCACCTGTGGTCATCTTACCTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2081826 - 2033
NM_001278599 ()2081231 - 1438
NM_021913 (AXL)2081853 - 2060
Exon 15 To Exon 16 (Pair 27)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 112 bpgenomic: 3,642
Reverse (2125,22)AAATTCCTTCATGCAGACCGCTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.776 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)1121832 - 1943
NM_021913 (AXL)1121859 - 1970
NM_001278599 ()1121237 - 1348
Exon 15 To Exon 17 (Pair 42)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 251 bpgenomic: 4,183
Reverse (2258,20)GCCGGGAATAGAGGAGGAAGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.398 kcal/mol
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-2.543 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
CCATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTT
CCCAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCT
CTATTCCCGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2511231 - 1481
NM_021913 (AXL)2511853 - 2103
NM_001699 (AXL)2511826 - 2076
Exon 15 To Exon 17 (Pair 43)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 205 bpgenomic: 4,137
Reverse (2212,21)AGGTAAGATGACCACAGGTGCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.47 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
CCATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTT
CCCAGCACCTGTGGTCATCTTACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2051826 - 2030
NM_021913 (AXL)2051853 - 2057
NM_001278599 ()2051231 - 1435
Exon 15 To Exon 16 (Pair 28)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 127 bpgenomic: 3,657
Reverse (2137,22)GTTGGGATGGTCAAATTCCTTCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.384 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.583 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)1271856 - 1982
NM_001278599 ()1271234 - 1360
NM_001699 (AXL)1271829 - 1955
Exon 15 To Exon 16 (Pair 29)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 112 bpgenomic: 3,642
Reverse (2119,21)CTTCATGCAGACCGCTTCACTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.776 kcal/mol
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-1.586 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)1121853 - 1964
NM_001278599 ()1121231 - 1342
NM_001699 (AXL)1121826 - 1937
Exon 15 To Exon 17 (Pair 44)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 231 bpgenomic: 4,163
Reverse (2238,22)CTGTGTAGGTCTCCATGTTTCANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
CCATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTT
CCCAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2311853 - 2083
NM_001278599 ()2311231 - 1461
NM_001699 (AXL)2311826 - 2056
Exon 15 To Exon 17 (Pair 45)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 207 bpgenomic: 4,139
Reverse (2215,22)GAAAGGTAAGATGACCACAGGTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.867 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
CCAGCACCTGTGGTCATCTTACCTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2071827 - 2033
NM_001278599 ()2071232 - 1438
NM_021913 (AXL)2071854 - 2060
Exon 15 To Exon 17 (Pair 46)
Forward (2038,21)GGTGGCTGTGAAGACGATGAAAmplicon SizecDNA: 216 bpgenomic: 4,148
Reverse (2253,22)GAATAGAGGAGGAAGCTGTGTANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCT
GAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGT
CTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCAT
GAAACATGGAGACCTACACAGCTTCCTCCTCTATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2161261 - 1476
NM_021913 (AXL)2161883 - 2098
NM_001699 (AXL)2161856 - 2071
Exon 15 To Exon 16 (Pair 30)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 124 bpgenomic: 3,654
Reverse (2134,22)GGGATGGTCAAATTCCTTCATGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.752 kcal/mol in 3' area
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.583 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)1241856 - 1979
NM_001278599 ()1241234 - 1357
NM_001699 (AXL)1241829 - 1952
Exon 15 To Exon 16 (Pair 31)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 111 bpgenomic: 3,641
Reverse (2124,22)AATTCCTTCATGCAGACCGCTTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.776 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()1111237 - 1347
NM_021913 (AXL)1111859 - 1969
NM_001699 (AXL)1111832 - 1942
Exon 15 To Exon 17 (Pair 47)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 206 bpgenomic: 4,138
Reverse (2214,22)AAAGGTAAGATGACCACAGGTGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.47 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
CCAGCACCTGTGGTCATCTTACCTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2061827 - 2032
NM_021913 (AXL)2061854 - 2059
NM_001278599 ()2061232 - 1437
Exon 15 To Exon 17 (Pair 48)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 212 bpgenomic: 4,144
Reverse (2220,23)TTCATGAAAGGTAAGATGACCACNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.968 kcal/mol in 3' area
Reverse Dimers-2.324 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
CCAGCACCTGTGGTCATCTTACCTTTCATGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2121827 - 2038
NM_001278599 ()2121232 - 1443
NM_021913 (AXL)2121854 - 2065
Exon 15 To Exon 17 (Pair 49)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 178 bpgenomic: 4,110
Reverse (2188,21)GAAGCTCTCTCGTTCAGAACCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.34 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.585 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)1781829 - 2006
NM_021913 (AXL)1781856 - 2033
NM_001278599 ()1781234 - 1411
Exon 15 To Exon 17 (Pair 50)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 211 bpgenomic: 4,143
Reverse (2219,23)TCATGAAAGGTAAGATGACCACANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.968 kcal/mol in 3' area
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
CCAGCACCTGTGGTCATCTTACCTTTCATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2111827 - 2037
NM_001278599 ()2111232 - 1442
NM_021913 (AXL)2111854 - 2064
Exon 15 To Exon 17 (Pair 51)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 248 bpgenomic: 4,180
Reverse (2257,20)CCGGGAATAGAGGAGGAAGCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.772 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTCT
ATTCCCGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2481233 - 1480
NM_021913 (AXL)2481855 - 2102
NM_001699 (AXL)2481828 - 2075
Exon 15 To Exon 17 (Pair 52)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 202 bpgenomic: 4,134
Reverse (2215,22)GAAAGGTAAGATGACCACAGGTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.867 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCC
CAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGC
ACCTGTGGTCATCTTACCTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2021832 - 2033
NM_021913 (AXL)2021859 - 2060
NM_001278599 ()2021237 - 1438
Exon 15 To Exon 17 (Pair 53)
Forward (2039,21)GTGGCTGTGAAGACGATGAAGAmplicon SizecDNA: 220 bpgenomic: 4,152
Reverse (2258,20)GCCGGGAATAGAGGAGGAAGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.398 kcal/mol
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-1.56 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCTG
AGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGTC
TGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCATG
AAACATGGAGACCTACACAGCTTCCTCCTCTATTCCCGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2201262 - 1481
NM_021913 (AXL)2201884 - 2103
NM_001699 (AXL)2201857 - 2076
Exon 15 To Exon 17 (Pair 54)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 177 bpgenomic: 4,109
Reverse (2187,21)AAGCTCTCTCGTTCAGAACCCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.34 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.585 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)1771829 - 2005
NM_021913 (AXL)1771856 - 2032
NM_001278599 ()1771234 - 1410
Exon 15 To Exon 17 (Pair 55)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 231 bpgenomic: 4,163
Reverse (2244,21)AGGAAGCTGTGTAGGTCTCCANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCC
CAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGC
ACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2311832 - 2062
NM_001278599 ()2311237 - 1467
NM_021913 (AXL)2311859 - 2089
Exon 15 To Exon 17 (Pair 56)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 229 bpgenomic: 4,161
Reverse (2238,22)CTGTGTAGGTCTCCATGTTTCANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2291828 - 2056
NM_001278599 ()2291233 - 1461
NM_021913 (AXL)2291855 - 2083
Exon 15 To Exon 17 (Pair 57)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 204 bpgenomic: 4,136
Reverse (2214,22)AAAGGTAAGATGACCACAGGTGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.47 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCC
AGCACCTGTGGTCATCTTACCTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2041829 - 2032
NM_001278599 ()2041234 - 1437
NM_021913 (AXL)2041856 - 2059
Exon 15 To Exon 17 (Pair 58)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 203 bpgenomic: 4,135
Reverse (2212,21)AGGTAAGATGACCACAGGTGCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops0.47 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2031233 - 1435
NM_021913 (AXL)2031855 - 2057
NM_001699 (AXL)2031828 - 2030
Exon 15 To Exon 16 (Pair 32)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 127 bpgenomic: 3,657
Reverse (2136,23)TTGGGATGGTCAAATTCCTTCATNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.384 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.583 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)1271828 - 1954
NM_021913 (AXL)1271855 - 1981
NM_001278599 ()1271233 - 1359
Exon 15 To Exon 17 (Pair 59)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 207 bpgenomic: 4,139
Reverse (2214,22)AAAGGTAAGATGACCACAGGTGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.47 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
CCATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTT
CCCAGCACCTGTGGTCATCTTACCTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2071853 - 2059
NM_001278599 ()2071231 - 1437
NM_001699 (AXL)2071826 - 2032
Exon 15 To Exon 17 (Pair 60)
Forward (2039,21)GTGGCTGTGAAGACGATGAAGAmplicon SizecDNA: 205 bpgenomic: 4,137
Reverse (2243,21)GGAAGCTGTGTAGGTCTCCATNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCTG
AGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGTC
TGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCATG
AAACATGGAGACCTACACAGCTTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2051884 - 2088
NM_001278599 ()2051262 - 1466
NM_001699 (AXL)2051857 - 2061
Exon 15 To Exon 17 (Pair 61)
Forward (2039,21)GTGGCTGTGAAGACGATGAAGAmplicon SizecDNA: 149 bpgenomic: 4,081
Reverse (2187,21)AAGCTCTCTCGTTCAGAACCCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.34 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.585 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCTG
AGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGTC
TGTTTCCAGGGTTCTGAACGAGAGAGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()1491262 - 1410
NM_021913 (AXL)1491884 - 2032
NM_001699 (AXL)1491857 - 2005
Exon 15 To Exon 16 (Pair 33)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 111 bpgenomic: 3,641
Reverse (2118,21)TTCATGCAGACCGCTTCACTCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.776 kcal/mol
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-1.586 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()1111231 - 1341
NM_021913 (AXL)1111853 - 1963
NM_001699 (AXL)1111826 - 1936
Exon 15 To Exon 17 (Pair 62)
Forward (2039,21)GTGGCTGTGAAGACGATGAAGAmplicon SizecDNA: 215 bpgenomic: 4,147
Reverse (2253,22)GAATAGAGGAGGAAGCTGTGTANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCTG
AGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGTC
TGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCATG
AAACATGGAGACCTACACAGCTTCCTCCTCTATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2151884 - 2098
NM_001278599 ()2151262 - 1476
NM_001699 (AXL)2151857 - 2071
Exon 15 To Exon 17 (Pair 63)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 233 bpgenomic: 4,165
Reverse (2242,21)GAAGCTGTGTAGGTCTCCATGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.718 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2331828 - 2060
NM_001278599 ()2331233 - 1465
NM_021913 (AXL)2331855 - 2087
Exon 15 To Exon 17 (Pair 64)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 250 bpgenomic: 4,182
Reverse (2258,20)GCCGGGAATAGAGGAGGAAGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.398 kcal/mol
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-2.543 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
CCAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTC
TATTCCCGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2501827 - 2076
NM_001278599 ()2501232 - 1481
NM_021913 (AXL)2501854 - 2103
Exon 15 To Exon 16 (Pair 34)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 110 bpgenomic: 3,640
Reverse (2118,21)TTCATGCAGACCGCTTCACTCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.776 kcal/mol
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-1.586 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)1101854 - 1963
NM_001278599 ()1101232 - 1341
NM_001699 (AXL)1101827 - 1936
 

See below for some more details.

Program Output:

Loading ...