Design Results for AXL

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size200Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 12 To Exon 14 (Pair 1)
Forward (1746,21)TCTTGGCTCTCTTCCTTGTCCAmplicon SizecDNA: 205 bpgenomic: 5,611
Reverse (1950,20)TGCCGGTCCACCATCACATCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.35 kcal/mol
Forward Dimers-0.004 kcal/mol
Reverse Loops1.322 kcal/mol
Reverse Dimers-2.894 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-1.489 kcal/mol outside primersite
Amplicon SequenceTCTTGGCTCTCTTCCTTGTCCACCGGCGAAAGAAGGAGACCCGTTATGGAGAAGTGTTTG
AACCAACAGTGGAAAGAGGTGAACTGGTAGTCAGGTACCGCGTGCGCAAGTCCTACAGTC
GTCGGACCACTGAAGCTACCTTGAACAGCCTGGGCATCAGTGAAGAGCTGAAGGAGAAGC
TGCGGGATGTGATGGTGGACCGGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()205969 - 1173
NM_021913 (AXL)2051591 - 1795
NM_001699 (AXL)2051564 - 1768
Exon 12 To Exon 14 (Pair 2)
Forward (1743,22)TCATCTTGGCTCTCTTCCTTGTAmplicon SizecDNA: 208 bpgenomic: 5,614
Reverse (1950,20)TGCCGGTCCACCATCACATCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.3 kcal/mol
Forward Dimers-0.004 kcal/mol
Reverse Loops1.322 kcal/mol
Reverse Dimers-2.894 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-1.489 kcal/mol outside primersite
Amplicon SequenceTCATCTTGGCTCTCTTCCTTGTCCACCGGCGAAAGAAGGAGACCCGTTATGGAGAAGTGT
TTGAACCAACAGTGGAAAGAGGTGAACTGGTAGTCAGGTACCGCGTGCGCAAGTCCTACA
GTCGTCGGACCACTGAAGCTACCTTGAACAGCCTGGGCATCAGTGAAGAGCTGAAGGAGA
AGCTGCGGGATGTGATGGTGGACCGGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()208966 - 1173
NM_021913 (AXL)2081588 - 1795
NM_001699 (AXL)2081561 - 1768
Exon 15 To Exon 17 (Pair 1)
Forward (2039,21)GTGGCTGTGAAGACGATGAAGAmplicon SizecDNA: 202 bpgenomic: 4,134
Reverse (2240,22)AGCTGTGTAGGTCTCCATGTTTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers-1.739 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCTG
AGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGTC
TGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCATG
AAACATGGAGACCTACACAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2021262 - 1463
NM_001699 (AXL)2021857 - 2058
NM_021913 (AXL)2021884 - 2085
Exon 15 To Exon 17 (Pair 2)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 249 bpgenomic: 4,181
Reverse (2257,20)CCGGGAATAGAGGAGGAAGCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.772 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
CCAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTC
TATTCCCGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2491854 - 2102
NM_001699 (AXL)2491827 - 2075
NM_001278599 ()2491232 - 1480
Exon 15 To Exon 17 (Pair 3)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 209 bpgenomic: 4,141
Reverse (2216,22)TGAAAGGTAAGATGACCACAGGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.968 kcal/mol
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
CCATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTT
CCCAGCACCTGTGGTCATCTTACCTTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2091231 - 1439
NM_001699 (AXL)2091826 - 2034
NM_021913 (AXL)2091853 - 2061
Exon 15 To Exon 17 (Pair 4)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 234 bpgenomic: 4,166
Reverse (2243,21)GGAAGCTGTGTAGGTCTCCATNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.718 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2341828 - 2061
NM_001278599 ()2341233 - 1466
NM_021913 (AXL)2341855 - 2088
Exon 15 To Exon 17 (Pair 5)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 248 bpgenomic: 4,180
Reverse (2258,20)GCCGGGAATAGAGGAGGAAGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.398 kcal/mol
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-2.543 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCC
AGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTCTA
TTCCCGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2481856 - 2103
NM_001278599 ()2481234 - 1481
NM_001699 (AXL)2481829 - 2076
Exon 15 To Exon 17 (Pair 6)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 208 bpgenomic: 4,140
Reverse (2215,22)GAAAGGTAAGATGACCACAGGTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.867 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
CCATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTT
CCCAGCACCTGTGGTCATCTTACCTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2081853 - 2060
NM_001278599 ()2081231 - 1438
NM_001699 (AXL)2081826 - 2033
Exon 15 To Exon 17 (Pair 7)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 228 bpgenomic: 4,160
Reverse (2238,22)CTGTGTAGGTCTCCATGTTTCANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCC
AGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2281856 - 2083
NM_001278599 ()2281234 - 1461
NM_001699 (AXL)2281829 - 2056
Exon 15 To Exon 18 (Pair 1)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 299 bpgenomic: 4,862
Reverse (2309,22)CCATGAACTTCACTAGCATCTGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.586 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.568 kcal/mol
Amplicon Folding-1.612 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCC
AGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTCTA
TTCCCGGCTCGGGGACCAGCCAGTGTACCTGCCCACTCAGATGCTAGTGAAGTTCATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2991234 - 1532
NM_001699 (AXL)2991829 - 2127
NM_021913 (AXL)2991856 - 2154
Exon 15 To Exon 17 (Pair 8)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 227 bpgenomic: 4,159
Reverse (2240,22)AGCTGTGTAGGTCTCCATGTTTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCC
CAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGC
ACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2271859 - 2085
NM_001699 (AXL)2271832 - 2058
NM_001278599 ()2271237 - 1463
Exon 15 To Exon 17 (Pair 9)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 205 bpgenomic: 4,137
Reverse (2214,22)AAAGGTAAGATGACCACAGGTGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops0.47 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2051828 - 2032
NM_001278599 ()2051233 - 1437
NM_021913 (AXL)2051855 - 2059
Exon 15 To Exon 17 (Pair 10)
Forward (2038,21)GGTGGCTGTGAAGACGATGAAAmplicon SizecDNA: 216 bpgenomic: 4,148
Reverse (2253,22)GAATAGAGGAGGAAGCTGTGTANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCT
GAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGT
CTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCAT
GAAACATGGAGACCTACACAGCTTCCTCCTCTATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2161261 - 1476
NM_021913 (AXL)2161883 - 2098
NM_001699 (AXL)2161856 - 2071
Exon 15 To Exon 17 (Pair 11)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 232 bpgenomic: 4,164
Reverse (2242,21)GAAGCTGTGTAGGTCTCCATGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCC
AGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2321856 - 2087
NM_001278599 ()2321234 - 1465
NM_001699 (AXL)2321829 - 2060
Exon 15 To Exon 17 (Pair 12)
Forward (2038,21)GGTGGCTGTGAAGACGATGAAAmplicon SizecDNA: 207 bpgenomic: 4,139
Reverse (2244,21)AGGAAGCTGTGTAGGTCTCCANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCT
GAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGT
CTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCAT
GAAACATGGAGACCTACACAGCTTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2071261 - 1467
NM_021913 (AXL)2071883 - 2089
NM_001699 (AXL)2071856 - 2062
Exon 15 To Exon 17 (Pair 13)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 212 bpgenomic: 4,144
Reverse (2220,23)TTCATGAAAGGTAAGATGACCACNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.968 kcal/mol in 3' area
Reverse Dimers-2.324 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
CCAGCACCTGTGGTCATCTTACCTTTCATGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2121232 - 1443
NM_021913 (AXL)2121854 - 2065
NM_001699 (AXL)2121827 - 2038
Exon 15 To Exon 17 (Pair 14)
Forward (2039,21)GTGGCTGTGAAGACGATGAAGAmplicon SizecDNA: 214 bpgenomic: 4,146
Reverse (2252,22)AATAGAGGAGGAAGCTGTGTAGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCTG
AGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGTC
TGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCATG
AAACATGGAGACCTACACAGCTTCCTCCTCTATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2141884 - 2097
NM_001278599 ()2141262 - 1475
NM_001699 (AXL)2141857 - 2070
Exon 15 To Exon 17 (Pair 15)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 249 bpgenomic: 4,181
Reverse (2258,20)GCCGGGAATAGAGGAGGAAGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.398 kcal/mol
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-2.543 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTCT
ATTCCCGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2491855 - 2103
NM_001278599 ()2491233 - 1481
NM_001699 (AXL)2491828 - 2076
Exon 15 To Exon 17 (Pair 16)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 234 bpgenomic: 4,166
Reverse (2244,21)AGGAAGCTGTGTAGGTCTCCANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCC
AGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2341856 - 2089
NM_001278599 ()2341234 - 1467
NM_001699 (AXL)2341829 - 2062
Exon 15 To Exon 17 (Pair 17)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 210 bpgenomic: 4,142
Reverse (2219,23)TCATGAAAGGTAAGATGACCACANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops0.968 kcal/mol in 3' area
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2101233 - 1442
NM_021913 (AXL)2101855 - 2064
NM_001699 (AXL)2101828 - 2037
Exon 15 To Exon 17 (Pair 18)
Forward (2039,21)GTGGCTGTGAAGACGATGAAGAmplicon SizecDNA: 215 bpgenomic: 4,147
Reverse (2253,22)GAATAGAGGAGGAAGCTGTGTANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCTG
AGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGTC
TGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCATG
AAACATGGAGACCTACACAGCTTCCTCCTCTATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2151857 - 2071
NM_021913 (AXL)2151884 - 2098
NM_001278599 ()2151262 - 1476
Exon 15 To Exon 17 (Pair 19)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 250 bpgenomic: 4,182
Reverse (2257,20)CCGGGAATAGAGGAGGAAGCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.772 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
CCATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTT
CCCAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCT
CTATTCCCGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2501853 - 2102
NM_001278599 ()2501231 - 1480
NM_001699 (AXL)2501826 - 2075
Exon 15 To Exon 17 (Pair 20)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 204 bpgenomic: 4,136
Reverse (2212,21)AGGTAAGATGACCACAGGTGCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.47 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
CCAGCACCTGTGGTCATCTTACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2041827 - 2030
NM_001278599 ()2041232 - 1435
NM_021913 (AXL)2041854 - 2057
Exon 15 To Exon 17 (Pair 21)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 244 bpgenomic: 4,176
Reverse (2253,22)GAATAGAGGAGGAAGCTGTGTANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.718 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTCT
ATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2441828 - 2071
NM_021913 (AXL)2441855 - 2098
NM_001278599 ()2441233 - 1476
Exon 15 To Exon 17 (Pair 22)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 240 bpgenomic: 4,172
Reverse (2249,21)AGAGGAGGAAGCTGTGTAGGTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.718 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2401828 - 2067
NM_021913 (AXL)2401855 - 2094
NM_001278599 ()2401233 - 1472
Exon 15 To Exon 17 (Pair 23)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 210 bpgenomic: 4,142
Reverse (2220,23)TTCATGAAAGGTAAGATGACCACNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.968 kcal/mol in 3' area
Reverse Dimers-2.324 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCC
AGCACCTGTGGTCATCTTACCTTTCATGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2101234 - 1443
NM_021913 (AXL)2101856 - 2065
NM_001699 (AXL)2101829 - 2038
Exon 15 To Exon 17 (Pair 24)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 245 bpgenomic: 4,177
Reverse (2258,20)GCCGGGAATAGAGGAGGAAGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.398 kcal/mol
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-2.543 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCC
CAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGC
ACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTCTATTC
CCGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2451832 - 2076
NM_001278599 ()2451237 - 1481
NM_021913 (AXL)2451859 - 2103
Exon 15 To Exon 17 (Pair 25)
Forward (2038,21)GGTGGCTGTGAAGACGATGAAAmplicon SizecDNA: 206 bpgenomic: 4,138
Reverse (2243,21)GGAAGCTGTGTAGGTCTCCATNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCT
GAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGT
CTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCAT
GAAACATGGAGACCTACACAGCTTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2061856 - 2061
NM_001278599 ()2061261 - 1466
NM_021913 (AXL)2061883 - 2088
Exon 15 To Exon 17 (Pair 26)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 230 bpgenomic: 4,162
Reverse (2240,22)AGCTGTGTAGGTCTCCATGTTTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCC
AGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2301234 - 1463
NM_021913 (AXL)2301856 - 2085
NM_001699 (AXL)2301829 - 2058
Exon 15 To Exon 17 (Pair 27)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 205 bpgenomic: 4,137
Reverse (2212,21)AGGTAAGATGACCACAGGTGCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.47 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
CCATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTT
CCCAGCACCTGTGGTCATCTTACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2051826 - 2030
NM_021913 (AXL)2051853 - 2057
NM_001278599 ()2051231 - 1435
Exon 15 To Exon 17 (Pair 28)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 252 bpgenomic: 4,184
Reverse (2260,20)GAGCCGGGAATAGAGGAGGANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.398 kcal/mol in 3' area
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-2.543 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
CCAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTC
TATTCCCGGCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2521827 - 2078
NM_021913 (AXL)2521854 - 2105
NM_001278599 ()2521232 - 1483
Exon 15 To Exon 17 (Pair 29)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 211 bpgenomic: 4,143
Reverse (2219,23)TCATGAAAGGTAAGATGACCACANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.968 kcal/mol in 3' area
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
CCAGCACCTGTGGTCATCTTACCTTTCATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2111854 - 2064
NM_001278599 ()2111232 - 1442
NM_001699 (AXL)2111827 - 2037
Exon 15 To Exon 17 (Pair 30)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 206 bpgenomic: 4,138
Reverse (2216,22)TGAAAGGTAAGATGACCACAGGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.968 kcal/mol
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCC
AGCACCTGTGGTCATCTTACCTTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2061829 - 2034
NM_021913 (AXL)2061856 - 2061
NM_001278599 ()2061234 - 1439
Exon 15 To Exon 17 (Pair 31)
Forward (2038,21)GGTGGCTGTGAAGACGATGAAAmplicon SizecDNA: 205 bpgenomic: 4,137
Reverse (2242,21)GAAGCTGTGTAGGTCTCCATGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCT
GAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGT
CTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCAT
GAAACATGGAGACCTACACAGCTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2051856 - 2060
NM_001278599 ()2051261 - 1465
NM_021913 (AXL)2051883 - 2087
Exon 15 To Exon 17 (Pair 32)
Forward (2038,21)GGTGGCTGTGAAGACGATGAAAmplicon SizecDNA: 221 bpgenomic: 4,153
Reverse (2258,20)GCCGGGAATAGAGGAGGAAGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.398 kcal/mol
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-1.56 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCT
GAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGT
CTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCAT
GAAACATGGAGACCTACACAGCTTCCTCCTCTATTCCCGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2211883 - 2103
NM_001278599 ()2211261 - 1481
NM_001699 (AXL)2211856 - 2076
Exon 15 To Exon 18 (Pair 2)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 300 bpgenomic: 4,863
Reverse (2309,22)CCATGAACTTCACTAGCATCTGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.586 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.895 kcal/mol
Amplicon Folding-1.612 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTCT
ATTCCCGGCTCGGGGACCAGCCAGTGTACCTGCCCACTCAGATGCTAGTGAAGTTCATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)3001855 - 2154
NM_001278599 ()3001233 - 1532
NM_001699 (AXL)3001828 - 2127
Exon 15 To Exon 17 (Pair 33)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 250 bpgenomic: 4,182
Reverse (2258,20)GCCGGGAATAGAGGAGGAAGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.398 kcal/mol
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-2.543 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
CCAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTC
TATTCCCGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2501232 - 1481
NM_021913 (AXL)2501854 - 2103
NM_001699 (AXL)2501827 - 2076
Exon 15 To Exon 17 (Pair 34)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 206 bpgenomic: 4,138
Reverse (2219,23)TCATGAAAGGTAAGATGACCACANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.968 kcal/mol in 3' area
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCC
CAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGC
ACCTGTGGTCATCTTACCTTTCATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2061832 - 2037
NM_001278599 ()2061237 - 1442
NM_021913 (AXL)2061859 - 2064
Exon 15 To Exon 17 (Pair 35)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 233 bpgenomic: 4,165
Reverse (2243,21)GGAAGCTGTGTAGGTCTCCATNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCC
AGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2331856 - 2088
NM_001278599 ()2331234 - 1466
NM_001699 (AXL)2331829 - 2061
Exon 15 To Exon 17 (Pair 36)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 203 bpgenomic: 4,135
Reverse (2216,22)TGAAAGGTAAGATGACCACAGGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.968 kcal/mol
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCC
CAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGC
ACCTGTGGTCATCTTACCTTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2031237 - 1439
NM_021913 (AXL)2031859 - 2061
NM_001699 (AXL)2031832 - 2034
Exon 15 To Exon 17 (Pair 37)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 230 bpgenomic: 4,162
Reverse (2243,21)GGAAGCTGTGTAGGTCTCCATNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCC
CAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGC
ACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2301832 - 2061
NM_001278599 ()2301237 - 1466
NM_021913 (AXL)2301859 - 2088
Exon 15 To Exon 17 (Pair 38)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 229 bpgenomic: 4,161
Reverse (2242,21)GAAGCTGTGTAGGTCTCCATGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCC
CAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGC
ACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2291832 - 2060
NM_001278599 ()2291237 - 1465
NM_021913 (AXL)2291859 - 2087
Exon 15 To Exon 17 (Pair 39)
Forward (2039,21)GTGGCTGTGAAGACGATGAAGAmplicon SizecDNA: 203 bpgenomic: 4,135
Reverse (2241,22)AAGCTGTGTAGGTCTCCATGTTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCTG
AGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGTC
TGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCATG
AAACATGGAGACCTACACAGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2031857 - 2059
NM_001278599 ()2031262 - 1464
NM_021913 (AXL)2031884 - 2086
Exon 15 To Exon 17 (Pair 40)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 207 bpgenomic: 4,139
Reverse (2220,23)TTCATGAAAGGTAAGATGACCACNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.968 kcal/mol in 3' area
Reverse Dimers-2.324 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCC
CAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGC
ACCTGTGGTCATCTTACCTTTCATGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2071859 - 2065
NM_001278599 ()2071237 - 1443
NM_001699 (AXL)2071832 - 2038
Exon 15 To Exon 17 (Pair 41)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 203 bpgenomic: 4,135
Reverse (2212,21)AGGTAAGATGACCACAGGTGCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops0.47 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2031828 - 2030
NM_021913 (AXL)2031855 - 2057
NM_001278599 ()2031233 - 1435
Exon 15 To Exon 17 (Pair 42)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 233 bpgenomic: 4,165
Reverse (2242,21)GAAGCTGTGTAGGTCTCCATGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.718 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2331233 - 1465
NM_021913 (AXL)2331855 - 2087
NM_001699 (AXL)2331828 - 2060
Exon 15 To Exon 17 (Pair 43)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 230 bpgenomic: 4,162
Reverse (2238,22)CTGTGTAGGTCTCCATGTTTCANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
CCAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2301854 - 2083
NM_001278599 ()2301232 - 1461
NM_001699 (AXL)2301827 - 2056
Exon 15 To Exon 17 (Pair 44)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 232 bpgenomic: 4,164
Reverse (2240,22)AGCTGTGTAGGTCTCCATGTTTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers-2.651 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
CCAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2321827 - 2058
NM_001278599 ()2321232 - 1463
NM_021913 (AXL)2321854 - 2085
Exon 15 To Exon 17 (Pair 45)
Forward (2039,21)GTGGCTGTGAAGACGATGAAGAmplicon SizecDNA: 211 bpgenomic: 4,143
Reverse (2249,21)AGAGGAGGAAGCTGTGTAGGTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCTG
AGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGTC
TGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCATG
AAACATGGAGACCTACACAGCTTCCTCCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2111857 - 2067
NM_001278599 ()2111262 - 1472
NM_021913 (AXL)2111884 - 2094
Exon 15 To Exon 17 (Pair 46)
Forward (2039,21)GTGGCTGTGAAGACGATGAAGAmplicon SizecDNA: 209 bpgenomic: 4,141
Reverse (2247,21)AGGAGGAAGCTGTGTAGGTCTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCTG
AGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGTC
TGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCATG
AAACATGGAGACCTACACAGCTTCCTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2091857 - 2065
NM_001278599 ()2091262 - 1470
NM_021913 (AXL)2091884 - 2092
Exon 15 To Exon 17 (Pair 47)
Forward (2039,21)GTGGCTGTGAAGACGATGAAGAmplicon SizecDNA: 212 bpgenomic: 4,144
Reverse (2250,21)TAGAGGAGGAAGCTGTGTAGGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCTG
AGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGTC
TGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCATG
AAACATGGAGACCTACACAGCTTCCTCCTCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2121857 - 2068
NM_021913 (AXL)2121884 - 2095
NM_001278599 ()2121262 - 1473
Exon 15 To Exon 17 (Pair 48)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 207 bpgenomic: 4,139
Reverse (2214,22)AAAGGTAAGATGACCACAGGTGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.47 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
CCATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTT
CCCAGCACCTGTGGTCATCTTACCTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2071826 - 2032
NM_021913 (AXL)2071853 - 2059
NM_001278599 ()2071231 - 1437
Exon 15 To Exon 17 (Pair 49)
Forward (2038,21)GGTGGCTGTGAAGACGATGAAAmplicon SizecDNA: 213 bpgenomic: 4,145
Reverse (2250,21)TAGAGGAGGAAGCTGTGTAGGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCT
GAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGT
CTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCAT
GAAACATGGAGACCTACACAGCTTCCTCCTCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2131856 - 2068
NM_021913 (AXL)2131883 - 2095
NM_001278599 ()2131261 - 1473
Exon 15 To Exon 17 (Pair 50)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 235 bpgenomic: 4,167
Reverse (2244,21)AGGAAGCTGTGTAGGTCTCCANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.718 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2351855 - 2089
NM_001278599 ()2351233 - 1467
NM_001699 (AXL)2351828 - 2062
Exon 15 To Exon 17 (Pair 51)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 206 bpgenomic: 4,138
Reverse (2214,22)AAAGGTAAGATGACCACAGGTGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.47 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
CCAGCACCTGTGGTCATCTTACCTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2061827 - 2032
NM_001278599 ()2061232 - 1437
NM_021913 (AXL)2061854 - 2059
Exon 15 To Exon 17 (Pair 52)
Forward (2039,21)GTGGCTGTGAAGACGATGAAGAmplicon SizecDNA: 206 bpgenomic: 4,138
Reverse (2244,21)AGGAAGCTGTGTAGGTCTCCANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCTG
AGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGTC
TGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCATG
AAACATGGAGACCTACACAGCTTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2061857 - 2062
NM_001278599 ()2061262 - 1467
NM_021913 (AXL)2061884 - 2089
Exon 15 To Exon 17 (Pair 53)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 229 bpgenomic: 4,161
Reverse (2238,22)CTGTGTAGGTCTCCATGTTTCANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2291233 - 1461
NM_021913 (AXL)2291855 - 2083
NM_001699 (AXL)2291828 - 2056
Exon 15 To Exon 17 (Pair 54)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 231 bpgenomic: 4,163
Reverse (2241,22)AAGCTGTGTAGGTCTCCATGTTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCC
AGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2311829 - 2059
NM_001278599 ()2311234 - 1464
NM_021913 (AXL)2311856 - 2086
Exon 15 To Exon 17 (Pair 55)
Forward (2038,21)GGTGGCTGTGAAGACGATGAAAmplicon SizecDNA: 215 bpgenomic: 4,147
Reverse (2252,22)AATAGAGGAGGAAGCTGTGTAGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCT
GAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGT
CTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCAT
GAAACATGGAGACCTACACAGCTTCCTCCTCTATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2151856 - 2070
NM_001278599 ()2151261 - 1475
NM_021913 (AXL)2151883 - 2097
Exon 15 To Exon 17 (Pair 56)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 231 bpgenomic: 4,163
Reverse (2244,21)AGGAAGCTGTGTAGGTCTCCANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCC
CAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGC
ACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2311859 - 2089
NM_001278599 ()2311237 - 1467
NM_001699 (AXL)2311832 - 2062
Exon 15 To Exon 17 (Pair 57)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 250 bpgenomic: 4,182
Reverse (2260,20)GAGCCGGGAATAGAGGAGGANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.398 kcal/mol in 3' area
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-2.543 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCC
AGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTCTA
TTCCCGGCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2501829 - 2078
NM_021913 (AXL)2501856 - 2105
NM_001278599 ()2501234 - 1483
Exon 15 To Exon 17 (Pair 58)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 228 bpgenomic: 4,160
Reverse (2241,22)AAGCTGTGTAGGTCTCCATGTTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCC
CAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGC
ACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2281237 - 1464
NM_021913 (AXL)2281859 - 2086
NM_001699 (AXL)2281832 - 2059
Exon 15 To Exon 17 (Pair 59)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 253 bpgenomic: 4,185
Reverse (2260,20)GAGCCGGGAATAGAGGAGGANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.398 kcal/mol in 3' area
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-2.543 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
CCATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTT
CCCAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCT
CTATTCCCGGCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2531853 - 2105
NM_001278599 ()2531231 - 1483
NM_001699 (AXL)2531826 - 2078
Exon 15 To Exon 17 (Pair 60)
Forward (2039,21)GTGGCTGTGAAGACGATGAAGAmplicon SizecDNA: 220 bpgenomic: 4,152
Reverse (2258,20)GCCGGGAATAGAGGAGGAAGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.398 kcal/mol
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-1.56 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCTG
AGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGTC
TGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCATG
AAACATGGAGACCTACACAGCTTCCTCCTCTATTCCCGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2201884 - 2103
NM_001278599 ()2201262 - 1481
NM_001699 (AXL)2201857 - 2076
Exon 15 To Exon 18 (Pair 3)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 301 bpgenomic: 4,864
Reverse (2309,22)CCATGAACTTCACTAGCATCTGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.586 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.895 kcal/mol
Amplicon Folding-1.612 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
CCAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTC
TATTCCCGGCTCGGGGACCAGCCAGTGTACCTGCCCACTCAGATGCTAGTGAAGTTCATG
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)3011827 - 2127
NM_021913 (AXL)3011854 - 2154
NM_001278599 ()3011232 - 1532
Exon 15 To Exon 17 (Pair 61)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 202 bpgenomic: 4,134
Reverse (2215,22)GAAAGGTAAGATGACCACAGGTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.867 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCC
CAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGC
ACCTGTGGTCATCTTACCTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2021832 - 2033
NM_021913 (AXL)2021859 - 2060
NM_001278599 ()2021237 - 1438
Exon 15 To Exon 17 (Pair 62)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 251 bpgenomic: 4,183
Reverse (2260,20)GAGCCGGGAATAGAGGAGGANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.398 kcal/mol in 3' area
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-2.543 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTCT
ATTCCCGGCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2511828 - 2078
NM_001278599 ()2511233 - 1483
NM_021913 (AXL)2511855 - 2105
Exon 15 To Exon 17 (Pair 63)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 207 bpgenomic: 4,139
Reverse (2216,22)TGAAAGGTAAGATGACCACAGGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops0.968 kcal/mol
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2071828 - 2034
NM_001278599 ()2071233 - 1439
NM_021913 (AXL)2071855 - 2061
Exon 15 To Exon 17 (Pair 64)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 238 bpgenomic: 4,170
Reverse (2247,21)AGGAGGAAGCTGTGTAGGTCTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.718 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2381828 - 2065
NM_001278599 ()2381233 - 1470
NM_021913 (AXL)2381855 - 2092
Exon 15 To Exon 17 (Pair 65)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 231 bpgenomic: 4,163
Reverse (2238,22)CTGTGTAGGTCTCCATGTTTCANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
CCATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTT
CCCAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2311826 - 2056
NM_001278599 ()2311231 - 1461
NM_021913 (AXL)2311853 - 2083
Exon 15 To Exon 17 (Pair 66)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 202 bpgenomic: 4,134
Reverse (2212,21)AGGTAAGATGACCACAGGTGCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.47 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCC
AGCACCTGTGGTCATCTTACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2021234 - 1435
NM_021913 (AXL)2021856 - 2057
NM_001699 (AXL)2021829 - 2030
Exon 15 To Exon 17 (Pair 67)
Forward (2038,21)GGTGGCTGTGAAGACGATGAAAmplicon SizecDNA: 203 bpgenomic: 4,135
Reverse (2240,22)AGCTGTGTAGGTCTCCATGTTTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers-1.739 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCT
GAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGT
CTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCAT
GAAACATGGAGACCTACACAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2031883 - 2085
NM_001278599 ()2031261 - 1463
NM_001699 (AXL)2031856 - 2058
Exon 15 To Exon 17 (Pair 68)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 209 bpgenomic: 4,141
Reverse (2219,23)TCATGAAAGGTAAGATGACCACANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.968 kcal/mol in 3' area
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCC
AGCACCTGTGGTCATCTTACCTTTCATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2091234 - 1442
NM_021913 (AXL)2091856 - 2064
NM_001699 (AXL)2091829 - 2037
Exon 15 To Exon 17 (Pair 69)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 213 bpgenomic: 4,145
Reverse (2220,23)TTCATGAAAGGTAAGATGACCACNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.968 kcal/mol in 3' area
Reverse Dimers-2.324 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
CCATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTT
CCCAGCACCTGTGGTCATCTTACCTTTCATGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2131826 - 2038
NM_001278599 ()2131231 - 1443
NM_021913 (AXL)2131853 - 2065
Exon 15 To Exon 17 (Pair 70)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 232 bpgenomic: 4,164
Reverse (2241,22)AAGCTGTGTAGGTCTCCATGTTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.718 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2321233 - 1464
NM_021913 (AXL)2321855 - 2086
NM_001699 (AXL)2321828 - 2059
Exon 15 To Exon 17 (Pair 71)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 243 bpgenomic: 4,175
Reverse (2252,22)AATAGAGGAGGAAGCTGTGTAGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.718 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTCT
ATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2431233 - 1475
NM_021913 (AXL)2431855 - 2097
NM_001699 (AXL)2431828 - 2070
Exon 15 To Exon 17 (Pair 72)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 233 bpgenomic: 4,165
Reverse (2240,22)AGCTGTGTAGGTCTCCATGTTTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers-2.794 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
CCATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTT
CCCAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2331826 - 2058
NM_021913 (AXL)2331853 - 2085
NM_001278599 ()2331231 - 1463
Exon 15 To Exon 17 (Pair 73)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 248 bpgenomic: 4,180
Reverse (2257,20)CCGGGAATAGAGGAGGAAGCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.772 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTCT
ATTCCCGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2481828 - 2075
NM_001278599 ()2481233 - 1480
NM_021913 (AXL)2481855 - 2102
Exon 15 To Exon 17 (Pair 74)
Forward (2038,21)GGTGGCTGTGAAGACGATGAAAmplicon SizecDNA: 212 bpgenomic: 4,144
Reverse (2249,21)AGAGGAGGAAGCTGTGTAGGTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCT
GAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGT
CTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCAT
GAAACATGGAGACCTACACAGCTTCCTCCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2121261 - 1472
NM_021913 (AXL)2121883 - 2094
NM_001699 (AXL)2121856 - 2067
Exon 15 To Exon 17 (Pair 75)
Forward (2039,21)GTGGCTGTGAAGACGATGAAGAmplicon SizecDNA: 205 bpgenomic: 4,137
Reverse (2243,21)GGAAGCTGTGTAGGTCTCCATNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCTG
AGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGTC
TGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCATG
AAACATGGAGACCTACACAGCTTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2051262 - 1466
NM_021913 (AXL)2051884 - 2088
NM_001699 (AXL)2051857 - 2061
Exon 15 To Exon 17 (Pair 76)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 208 bpgenomic: 4,140
Reverse (2216,22)TGAAAGGTAAGATGACCACAGGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.968 kcal/mol
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
CCAGCACCTGTGGTCATCTTACCTTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2081232 - 1439
NM_021913 (AXL)2081854 - 2061
NM_001699 (AXL)2081827 - 2034
Exon 15 To Exon 17 (Pair 77)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 207 bpgenomic: 4,139
Reverse (2215,22)GAAAGGTAAGATGACCACAGGTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.867 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
CCAGCACCTGTGGTCATCTTACCTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2071827 - 2033
NM_021913 (AXL)2071854 - 2060
NM_001278599 ()2071232 - 1438
Exon 15 To Exon 17 (Pair 78)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 225 bpgenomic: 4,157
Reverse (2238,22)CTGTGTAGGTCTCCATGTTTCANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCC
CAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGC
ACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2251832 - 2056
NM_001278599 ()2251237 - 1461
NM_021913 (AXL)2251859 - 2083
Exon 15 To Exon 17 (Pair 79)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 241 bpgenomic: 4,173
Reverse (2250,21)TAGAGGAGGAAGCTGTGTAGGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.718 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTCT
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2411828 - 2068
NM_021913 (AXL)2411855 - 2095
NM_001278599 ()2411233 - 1473
Exon 15 To Exon 17 (Pair 80)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 205 bpgenomic: 4,137
Reverse (2215,22)GAAAGGTAAGATGACCACAGGTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.867 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCC
AGCACCTGTGGTCATCTTACCTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2051856 - 2060
NM_001278599 ()2051234 - 1438
NM_001699 (AXL)2051829 - 2033
Exon 15 To Exon 17 (Pair 81)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 204 bpgenomic: 4,136
Reverse (2214,22)AAAGGTAAGATGACCACAGGTGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.47 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCC
AGCACCTGTGGTCATCTTACCTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2041829 - 2032
NM_001278599 ()2041234 - 1437
NM_021913 (AXL)2041856 - 2059
Exon 15 To Exon 17 (Pair 82)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 211 bpgenomic: 4,143
Reverse (2220,23)TTCATGAAAGGTAAGATGACCACNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops0.968 kcal/mol in 3' area
Reverse Dimers-2.324 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2111233 - 1443
NM_021913 (AXL)2111855 - 2065
NM_001699 (AXL)2111828 - 2038
Exon 15 To Exon 17 (Pair 83)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 212 bpgenomic: 4,144
Reverse (2219,23)TCATGAAAGGTAAGATGACCACANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.968 kcal/mol in 3' area
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
CCATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTT
CCCAGCACCTGTGGTCATCTTACCTTTCATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2121231 - 1442
NM_021913 (AXL)2121853 - 2064
NM_001699 (AXL)2121826 - 2037
Exon 15 To Exon 17 (Pair 84)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 231 bpgenomic: 4,163
Reverse (2240,22)AGCTGTGTAGGTCTCCATGTTTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers-2.177 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2311828 - 2058
NM_001278599 ()2311233 - 1463
NM_021913 (AXL)2311855 - 2085
Exon 15 To Exon 17 (Pair 85)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 206 bpgenomic: 4,138
Reverse (2215,22)GAAAGGTAAGATGACCACAGGTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops0.867 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2061855 - 2060
NM_001278599 ()2061233 - 1438
NM_001699 (AXL)2061828 - 2033
Exon 15 To Exon 17 (Pair 86)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 251 bpgenomic: 4,183
Reverse (2258,20)GCCGGGAATAGAGGAGGAAGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.398 kcal/mol
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-2.543 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
CCATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTT
CCCAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCT
CTATTCCCGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2511826 - 2076
NM_021913 (AXL)2511853 - 2103
NM_001278599 ()2511231 - 1481
Exon 15 To Exon 17 (Pair 87)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 247 bpgenomic: 4,179
Reverse (2260,20)GAGCCGGGAATAGAGGAGGANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.398 kcal/mol in 3' area
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-2.543 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCC
CAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGC
ACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTCTATTC
CCGGCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2471237 - 1483
NM_021913 (AXL)2471859 - 2105
NM_001699 (AXL)2471832 - 2078
Exon 15 To Exon 17 (Pair 88)
Forward (2039,21)GTGGCTGTGAAGACGATGAAGAmplicon SizecDNA: 204 bpgenomic: 4,136
Reverse (2242,21)GAAGCTGTGTAGGTCTCCATGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCTG
AGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGTC
TGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCATG
AAACATGGAGACCTACACAGCTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2041884 - 2087
NM_001278599 ()2041262 - 1465
NM_001699 (AXL)2041857 - 2060
Exon 15 To Exon 17 (Pair 89)
Forward (2038,21)GGTGGCTGTGAAGACGATGAAAmplicon SizecDNA: 210 bpgenomic: 4,142
Reverse (2247,21)AGGAGGAAGCTGTGTAGGTCTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCT
GAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGT
CTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCAT
GAAACATGGAGACCTACACAGCTTCCTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2101883 - 2092
NM_001278599 ()2101261 - 1470
NM_001699 (AXL)2101856 - 2065
Exon 15 To Exon 17 (Pair 90)
Forward (2038,21)GGTGGCTGTGAAGACGATGAAAmplicon SizecDNA: 204 bpgenomic: 4,136
Reverse (2241,22)AAGCTGTGTAGGTCTCCATGTTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCT
GAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGT
CTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCAT
GAAACATGGAGACCTACACAGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2041883 - 2086
NM_001278599 ()2041261 - 1464
NM_001699 (AXL)2041856 - 2059
Exon 18 To Exon 20 (Pair 1)
Forward (2335,23)TCTGAGTACCAAGAGATTCATACAmplicon SizecDNA: 242 bpgenomic: 3,866
Reverse (2576,21)CAATCTCCCACATTGTCACCCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.679 kcal/mol
Forward Dimers-0.389 kcal/mol
Reverse Loops1.787 kcal/mol
Reverse Dimers-1.203 kcal/mol
Forward-Reverse Dimers-2.504 kcal/mol
Amplicon Folding-2.985 kcal/mol outside primersite
Amplicon SequenceTCTGAGTACCAAGAGATTCATACACCGGGACCTGGCGGCCAGGAACTGCATGCTGAATGA
GAACATGTCCGTGTGTGTGGCGGACTTCGGGCTCTCCAAGAAGATCTACAATGGGGACTA
CTACCGCCAGGGACGTATCGCCAAGATGCCAGTCAAGTGGATTGCCATTGAGAGTCTAGC
TGACCGTGTCTACACCAGCAAGAGCGATGTGTGGTCCTTCGGGGTGACAATGTGGGAGAT
TG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2421558 - 1799
NM_001699 (AXL)2422153 - 2394
NM_021913 (AXL)2422180 - 2421
Exon 18 To Exon 20 (Pair 2)
Forward (2340,22)GTACCAAGAGATTCATACACCGAmplicon SizecDNA: 237 bpgenomic: 3,861
Reverse (2576,21)CAATCTCCCACATTGTCACCCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.679 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops1.787 kcal/mol
Reverse Dimers-1.203 kcal/mol
Forward-Reverse Dimers-2.504 kcal/mol
Amplicon Folding-2.985 kcal/mol outside primersite
Amplicon SequenceGTACCAAGAGATTCATACACCGGGACCTGGCGGCCAGGAACTGCATGCTGAATGAGAACA
TGTCCGTGTGTGTGGCGGACTTCGGGCTCTCCAAGAAGATCTACAATGGGGACTACTACC
GCCAGGGACGTATCGCCAAGATGCCAGTCAAGTGGATTGCCATTGAGAGTCTAGCTGACC
GTGTCTACACCAGCAAGAGCGATGTGTGGTCCTTCGGGGTGACAATGTGGGAGATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2372158 - 2394
NM_021913 (AXL)2372185 - 2421
NM_001278599 ()2371563 - 1799
Exon 18 To Exon 20 (Pair 3)
Forward (2319,21)CCAGTGGCATGGAGTATCTGAAmplicon SizecDNA: 262 bpgenomic: 3,886
Reverse (2580,21)GTGGCAATCTCCCACATTGTCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.818 kcal/mol
Forward Dimers-2.024 kcal/mol
Reverse Loops0.633 kcal/mol
Reverse Dimers-1.399 kcal/mol
Forward-Reverse Dimers-2.185 kcal/mol
Amplicon Folding-2.985 kcal/mol outside primersite
Amplicon SequenceCCAGTGGCATGGAGTATCTGAGTACCAAGAGATTCATACACCGGGACCTGGCGGCCAGGA
ACTGCATGCTGAATGAGAACATGTCCGTGTGTGTGGCGGACTTCGGGCTCTCCAAGAAGA
TCTACAATGGGGACTACTACCGCCAGGGACGTATCGCCAAGATGCCAGTCAAGTGGATTG
CCATTGAGAGTCTAGCTGACCGTGTCTACACCAGCAAGAGCGATGTGTGGTCCTTCGGGG
TGACAATGTGGGAGATTGCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2622137 - 2398
NM_021913 (AXL)2622164 - 2425
NM_001278599 ()2621542 - 1803
Exon 18 To Exon 20 (Pair 4)
Forward (2340,22)GTACCAAGAGATTCATACACCGAmplicon SizecDNA: 241 bpgenomic: 3,865
Reverse (2580,21)GTGGCAATCTCCCACATTGTCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.679 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops0.633 kcal/mol
Reverse Dimers-1.399 kcal/mol
Forward-Reverse Dimers-2.504 kcal/mol
Amplicon Folding-2.985 kcal/mol outside primersite
Amplicon SequenceGTACCAAGAGATTCATACACCGGGACCTGGCGGCCAGGAACTGCATGCTGAATGAGAACA
TGTCCGTGTGTGTGGCGGACTTCGGGCTCTCCAAGAAGATCTACAATGGGGACTACTACC
GCCAGGGACGTATCGCCAAGATGCCAGTCAAGTGGATTGCCATTGAGAGTCTAGCTGACC
GTGTCTACACCAGCAAGAGCGATGTGTGGTCCTTCGGGGTGACAATGTGGGAGATTGCCA
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2412185 - 2425
NM_001278599 ()2411563 - 1803
NM_001699 (AXL)2412158 - 2398
Exon 18 To Exon 20 (Pair 5)
Forward (2337,23)TGAGTACCAAGAGATTCATACACAmplicon SizecDNA: 240 bpgenomic: 3,864
Reverse (2576,21)CAATCTCCCACATTGTCACCCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.679 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops1.787 kcal/mol
Reverse Dimers-1.203 kcal/mol
Forward-Reverse Dimers-2.504 kcal/mol
Amplicon Folding-2.985 kcal/mol outside primersite
Amplicon SequenceTGAGTACCAAGAGATTCATACACCGGGACCTGGCGGCCAGGAACTGCATGCTGAATGAGA
ACATGTCCGTGTGTGTGGCGGACTTCGGGCTCTCCAAGAAGATCTACAATGGGGACTACT
ACCGCCAGGGACGTATCGCCAAGATGCCAGTCAAGTGGATTGCCATTGAGAGTCTAGCTG
ACCGTGTCTACACCAGCAAGAGCGATGTGTGGTCCTTCGGGGTGACAATGTGGGAGATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2402155 - 2394
NM_021913 (AXL)2402182 - 2421
NM_001278599 ()2401560 - 1799
 

See below for some more details.

Program Output:

Loading ...