Design Results for AXL

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 12 To Exon 14 (Pair 1)
Forward (1746,21)TCTTGGCTCTCTTCCTTGTCCAmplicon SizecDNA: 205 bpgenomic: 5,611
Reverse (1950,20)TGCCGGTCCACCATCACATCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.35 kcal/mol
Forward Dimers-0.004 kcal/mol
Reverse Loops1.322 kcal/mol
Reverse Dimers-2.894 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-1.489 kcal/mol outside primersite
Amplicon SequenceTCTTGGCTCTCTTCCTTGTCCACCGGCGAAAGAAGGAGACCCGTTATGGAGAAGTGTTTG
AACCAACAGTGGAAAGAGGTGAACTGGTAGTCAGGTACCGCGTGCGCAAGTCCTACAGTC
GTCGGACCACTGAAGCTACCTTGAACAGCCTGGGCATCAGTGAAGAGCTGAAGGAGAAGC
TGCGGGATGTGATGGTGGACCGGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()205969 - 1173
NM_001699 (AXL)2051564 - 1768
NM_021913 (AXL)2051591 - 1795
Exon 12 To Exon 14 (Pair 2)
Forward (1743,22)TCATCTTGGCTCTCTTCCTTGTAmplicon SizecDNA: 208 bpgenomic: 5,614
Reverse (1950,20)TGCCGGTCCACCATCACATCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.3 kcal/mol
Forward Dimers-0.004 kcal/mol
Reverse Loops1.322 kcal/mol
Reverse Dimers-2.894 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-1.489 kcal/mol outside primersite
Amplicon SequenceTCATCTTGGCTCTCTTCCTTGTCCACCGGCGAAAGAAGGAGACCCGTTATGGAGAAGTGT
TTGAACCAACAGTGGAAAGAGGTGAACTGGTAGTCAGGTACCGCGTGCGCAAGTCCTACA
GTCGTCGGACCACTGAAGCTACCTTGAACAGCCTGGGCATCAGTGAAGAGCTGAAGGAGA
AGCTGCGGGATGTGATGGTGGACCGGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2051591 - 1795
NM_001699 (AXL)2051564 - 1768
NM_001278599 ()205969 - 1173
Exon 15 To Exon 17 (Pair 1)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 208 bpgenomic: 4,140
Reverse (2216,22)TGAAAGGTAAGATGACCACAGGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.968 kcal/mol
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
CCAGCACCTGTGGTCATCTTACCTTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2091853 - 2061
NM_001699 (AXL)2091826 - 2034
NM_001278599 ()2091231 - 1439
Exon 15 To Exon 17 (Pair 2)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 203 bpgenomic: 4,135
Reverse (2212,21)AGGTAAGATGACCACAGGTGCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops0.47 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2341234 - 1467
NM_001699 (AXL)2341829 - 2062
NM_021913 (AXL)2341856 - 2089
Exon 15 To Exon 17 (Pair 3)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 178 bpgenomic: 4,110
Reverse (2188,21)GAAGCTCTCTCGTTCAGAACCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.34 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.585 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2101856 - 2065
NM_001278599 ()2101234 - 1443
NM_001699 (AXL)2101829 - 2038
Exon 15 To Exon 16 (Pair 1)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 111 bpgenomic: 3,641
Reverse (2119,21)CTTCATGCAGACCGCTTCACTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.776 kcal/mol
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-1.586 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)1111827 - 1937
NM_001278599 ()1111232 - 1342
NM_021913 (AXL)1111854 - 1964
Exon 15 To Exon 16 (Pair 2)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 109 bpgenomic: 3,639
Reverse (2122,21)TTCCTTCATGCAGACCGCTTCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.776 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)1281855 - 1982
NM_001278599 ()1281233 - 1360
NM_001699 (AXL)1281828 - 1955
Exon 15 To Exon 17 (Pair 4)
Forward (2038,21)GGTGGCTGTGAAGACGATGAAAmplicon SizecDNA: 215 bpgenomic: 4,147
Reverse (2252,22)AATAGAGGAGGAAGCTGTGTAGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCT
GAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGT
CTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCAT
GAAACATGGAGACCTACACAGCTTCCTCCTCTATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2431828 - 2070
NM_001278599 ()2431233 - 1475
NM_021913 (AXL)2431855 - 2097
Exon 15 To Exon 16 (Pair 3)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 125 bpgenomic: 3,655
Reverse (2133,22)GGATGGTCAAATTCCTTCATGCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.752 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.583 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()1291232 - 1360
NM_001699 (AXL)1291827 - 1955
NM_021913 (AXL)1291854 - 1982
Exon 15 To Exon 17 (Pair 5)
Forward (2039,21)GTGGCTGTGAAGACGATGAAGAmplicon SizecDNA: 211 bpgenomic: 4,143
Reverse (2249,21)AGAGGAGGAAGCTGTGTAGGTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCTG
AGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGTC
TGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCATG
AAACATGGAGACCTACACAGCTTCCTCCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2361832 - 2067
NM_001278599 ()2361237 - 1472
NM_021913 (AXL)2361859 - 2094
Exon 15 To Exon 17 (Pair 6)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 245 bpgenomic: 4,177
Reverse (2258,20)GCCGGGAATAGAGGAGGAAGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.398 kcal/mol
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-2.543 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCC
CAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGC
ACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTCTATTC
CCGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2311856 - 2086
NM_001699 (AXL)2311829 - 2059
NM_001278599 ()2311234 - 1464
Exon 15 To Exon 17 (Pair 7)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 229 bpgenomic: 4,161
Reverse (2242,21)GAAGCTGTGTAGGTCTCCATGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCC
CAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGC
ACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2501853 - 2102
NM_001278599 ()2501231 - 1480
NM_001699 (AXL)2501826 - 2075
Exon 15 To Exon 17 (Pair 8)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 234 bpgenomic: 4,166
Reverse (2243,21)GGAAGCTGTGTAGGTCTCCATNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.718 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2401855 - 2094
NM_001699 (AXL)2401828 - 2067
NM_001278599 ()2401233 - 1472
Exon 15 To Exon 17 (Pair 9)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 205 bpgenomic: 4,137
Reverse (2212,21)AGGTAAGATGACCACAGGTGCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.47 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
CCATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTT
CCCAGCACCTGTGGTCATCTTACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2321828 - 2059
NM_001278599 ()2321233 - 1464
NM_021913 (AXL)2321855 - 2086
Exon 15 To Exon 17 (Pair 10)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 231 bpgenomic: 4,163
Reverse (2241,22)AAGCTGTGTAGGTCTCCATGTTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCC
AGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2321856 - 2087
NM_001278599 ()2321234 - 1465
NM_001699 (AXL)2321829 - 2060
Exon 15 To Exon 17 (Pair 11)
Forward (2038,21)GGTGGCTGTGAAGACGATGAAAmplicon SizecDNA: 210 bpgenomic: 4,142
Reverse (2247,21)AGGAGGAAGCTGTGTAGGTCTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCT
GAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGT
CTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCAT
GAAACATGGAGACCTACACAGCTTCCTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2371234 - 1470
NM_001699 (AXL)2371829 - 2065
NM_021913 (AXL)2371856 - 2092
Exon 15 To Exon 17 (Pair 12)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 228 bpgenomic: 4,160
Reverse (2241,22)AAGCTGTGTAGGTCTCCATGTTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCC
CAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGC
ACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2281237 - 1464
NM_001699 (AXL)2281832 - 2059
NM_021913 (AXL)2281859 - 2086
Exon 15 To Exon 16 (Pair 4)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 118 bpgenomic: 3,648
Reverse (2127,22)TCAAATTCCTTCATGCAGACCGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.562 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()1271231 - 1357
NM_001699 (AXL)1271826 - 1952
NM_021913 (AXL)1271853 - 1979
Exon 15 To Exon 17 (Pair 13)
Forward (2039,21)GTGGCTGTGAAGACGATGAAGAmplicon SizecDNA: 209 bpgenomic: 4,141
Reverse (2247,21)AGGAGGAAGCTGTGTAGGTCTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCTG
AGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGTC
TGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCATG
AAACATGGAGACCTACACAGCTTCCTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2381855 - 2092
NM_001699 (AXL)2381828 - 2065
NM_001278599 ()2381233 - 1470
Exon 15 To Exon 16 (Pair 5)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 111 bpgenomic: 3,641
Reverse (2124,22)AATTCCTTCATGCAGACCGCTTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.776 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)1141854 - 1967
NM_001699 (AXL)1141827 - 1940
NM_001278599 ()1141232 - 1345
Exon 15 To Exon 17 (Pair 14)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 233 bpgenomic: 4,165
Reverse (2240,22)AGCTGTGTAGGTCTCCATGTTTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers-2.794 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
CCATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTT
CCCAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2371231 - 1467
NM_001699 (AXL)2371826 - 2062
NM_021913 (AXL)2371853 - 2089
Exon 15 To Exon 18 (Pair 1)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 301 bpgenomic: 4,864
Reverse (2309,22)CCATGAACTTCACTAGCATCTGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.586 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.895 kcal/mol
Amplicon Folding-1.612 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
CCAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTC
TATTCCCGGCTCGGGGACCAGCCAGTGTACCTGCCCACTCAGATGCTAGTGAAGTTCATG
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2991856 - 2154
NM_001699 (AXL)2991829 - 2127
NM_001278599 ()2991234 - 1532
Exon 15 To Exon 16 (Pair 6)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 130 bpgenomic: 3,660
Reverse (2137,22)GTTGGGATGGTCAAATTCCTTCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.384 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.782 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
CCATCCCAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)1281854 - 1981
NM_001278599 ()1281232 - 1359
NM_001699 (AXL)1281827 - 1954
Exon 15 To Exon 18 (Pair 2)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 300 bpgenomic: 4,863
Reverse (2309,22)CCATGAACTTCACTAGCATCTGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.586 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.895 kcal/mol
Amplicon Folding-1.612 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTCT
ATTCCCGGCTCGGGGACCAGCCAGTGTACCTGCCCACTCAGATGCTAGTGAAGTTCATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()3011232 - 1532
NM_001699 (AXL)3011827 - 2127
NM_021913 (AXL)3011854 - 2154
Exon 15 To Exon 16 (Pair 7)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 82 bpgenomic: 3,612
Reverse (2091,20)TCCTCCAGCTCTGACCTCGTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.225 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-2.763 kcal/mol
Amplicon Folding-0.676 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)1061832 - 1937
NM_001278599 ()1061237 - 1342
NM_021913 (AXL)1061859 - 1964
Exon 15 To Exon 17 (Pair 15)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 206 bpgenomic: 4,138
Reverse (2214,22)AAAGGTAAGATGACCACAGGTGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.47 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
CCAGCACCTGTGGTCATCTTACCTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2311855 - 2085
NM_001699 (AXL)2311828 - 2058
NM_001278599 ()2311233 - 1463
Exon 15 To Exon 16 (Pair 8)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 113 bpgenomic: 3,643
Reverse (2122,21)TTCCTTCATGCAGACCGCTTCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops0.776 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)1051859 - 1963
NM_001278599 ()1051237 - 1341
NM_001699 (AXL)1051832 - 1936
Exon 15 To Exon 17 (Pair 16)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 248 bpgenomic: 4,180
Reverse (2257,20)CCGGGAATAGAGGAGGAAGCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.772 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-2.169 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTCT
ATTCCCGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2441855 - 2098
NM_001278599 ()2441233 - 1476
NM_001699 (AXL)2441828 - 2071
Exon 15 To Exon 17 (Pair 17)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 206 bpgenomic: 4,138
Reverse (2215,22)GAAAGGTAAGATGACCACAGGTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops0.867 kcal/mol in 3' area
Reverse Dimers-1.534 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2281859 - 2086
NM_001699 (AXL)2281832 - 2059
NM_001278599 ()2281237 - 1464
Exon 15 To Exon 16 (Pair 9)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 109 bpgenomic: 3,639
Reverse (2118,21)TTCATGCAGACCGCTTCACTCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops0.776 kcal/mol
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-1.186 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)1291853 - 1981
NM_001699 (AXL)1291826 - 1954
NM_001278599 ()1291231 - 1359
Exon 15 To Exon 16 (Pair 10)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 108 bpgenomic: 3,638
Reverse (2118,21)TTCATGCAGACCGCTTCACTCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.776 kcal/mol
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-1.186 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)1301855 - 1984
NM_001699 (AXL)1301828 - 1957
NM_001278599 ()1301233 - 1362
Exon 15 To Exon 16 (Pair 11)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 124 bpgenomic: 3,654
Reverse (2134,22)GGGATGGTCAAATTCCTTCATGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.752 kcal/mol in 3' area
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.583 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)1161855 - 1970
NM_001278599 ()1161233 - 1348
NM_001699 (AXL)1161828 - 1943
Exon 15 To Exon 16 (Pair 12)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 117 bpgenomic: 3,647
Reverse (2127,22)TCAAATTCCTTCATGCAGACCGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.562 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()1141234 - 1347
NM_001699 (AXL)1141829 - 1942
NM_021913 (AXL)1141856 - 1969
Exon 15 To Exon 16 (Pair 13)
Forward (2038,21)GGTGGCTGTGAAGACGATGAAAmplicon SizecDNA: 85 bpgenomic: 3,615
Reverse (2122,21)TTCCTTCATGCAGACCGCTTCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.776 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-1.868 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCT
GAGTGAAGCGGTCTGCATGAAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)1021856 - 1957
NM_001278599 ()1021261 - 1362
NM_021913 (AXL)1021883 - 1984
Exon 15 To Exon 16 (Pair 14)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 114 bpgenomic: 3,644
Reverse (2121,21)TCCTTCATGCAGACCGCTTCANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.776 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)1111856 - 1966
NM_001699 (AXL)1111829 - 1939
NM_001278599 ()1111234 - 1344
Exon 15 To Exon 16 (Pair 15)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 123 bpgenomic: 3,653
Reverse (2133,22)GGATGGTCAAATTCCTTCATGCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.752 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.583 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)1301853 - 1982
NM_001278599 ()1301231 - 1360
NM_001699 (AXL)1301826 - 1955
Exon 15 To Exon 16 (Pair 16)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 112 bpgenomic: 3,642
Reverse (2121,21)TCCTTCATGCAGACCGCTTCANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops0.776 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()1151231 - 1345
NM_001699 (AXL)1151826 - 1940
NM_021913 (AXL)1151853 - 1967
Exon 15 To Exon 17 (Pair 18)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 230 bpgenomic: 4,162
Reverse (2238,22)CTGTGTAGGTCTCCATGTTTCANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.671 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTC
CCAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2061237 - 1442
NM_001699 (AXL)2061832 - 2037
NM_021913 (AXL)2061859 - 2064
Exon 15 To Exon 16 (Pair 17)
Forward (2008,20)CCAGCTCAACCAGGACGACTAmplicon SizecDNA: 118 bpgenomic: 3,648
Reverse (2125,22)AAATTCCTTCATGCAGACCGCTNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.43 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.776 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCAT
CTGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)1121856 - 1967
NM_001699 (AXL)1121829 - 1940
NM_001278599 ()1121234 - 1345
Exon 15 To Exon 17 (Pair 19)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 233 bpgenomic: 4,165
Reverse (2243,21)GGAAGCTGTGTAGGTCTCCATNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.038 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCA
TCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCC
AGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)1781829 - 2006
NM_001278599 ()1781234 - 1411
NM_021913 (AXL)1781856 - 2033
Exon 15 To Exon 17 (Pair 20)
Forward (2014,20)CAACCAGGACGACTCCATCCAmplicon SizecDNA: 247 bpgenomic: 4,179
Reverse (2260,20)GAGCCGGGAATAGAGGAGGANr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops1.398 kcal/mol in 3' area
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-2.543 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCAC
GAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCC
CAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGC
ACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTCTATTC
CCGGCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2071855 - 2061
NM_001278599 ()2071233 - 1439
NM_001699 (AXL)2071828 - 2034
Exon 15 To Exon 17 (Pair 21)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 243 bpgenomic: 4,175
Reverse (2252,22)AATAGAGGAGGAAGCTGTGTAGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.256 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.718 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTCCTCCTCT
ATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2251859 - 2083
NM_001699 (AXL)2251832 - 2056
NM_001278599 ()2251237 - 1461
Exon 15 To Exon 16 (Pair 18)
Forward (2011,20)GCTCAACCAGGACGACTCCAAmplicon SizecDNA: 112 bpgenomic: 3,642
Reverse (2122,21)TTCCTTCATGCAGACCGCTTCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.702 kcal/mol
Reverse Loops0.776 kcal/mol in 3' area
Reverse Dimers-1.674 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCTG
CACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)1251855 - 1979
NM_001278599 ()1251233 - 1357
NM_001699 (AXL)1251828 - 1952
Exon 15 To Exon 17 (Pair 22)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 178 bpgenomic: 4,110
Reverse (2187,21)AAGCTCTCTCGTTCAGAACCCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.34 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.83 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2031832 - 2034
NM_001278599 ()2031237 - 1439
NM_021913 (AXL)2031859 - 2061
Exon 15 To Exon 17 (Pair 23)
Forward (2038,21)GGTGGCTGTGAAGACGATGAAAmplicon SizecDNA: 221 bpgenomic: 4,153
Reverse (2258,20)GCCGGGAATAGAGGAGGAAGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.398 kcal/mol
Reverse Dimers-2.704 kcal/mol
Forward-Reverse Dimers-1.56 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCT
GAGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGT
CTGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCAT
GAAACATGGAGACCTACACAGCTTCCTCCTCTATTCCCGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2501232 - 1481
NM_001699 (AXL)2501827 - 2076
NM_021913 (AXL)2501854 - 2103
Exon 15 To Exon 17 (Pair 24)
Forward (2039,21)GTGGCTGTGAAGACGATGAAGAmplicon SizecDNA: 204 bpgenomic: 4,136
Reverse (2242,21)GAAGCTGTGTAGGTCTCCATGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.032 kcal/mol outside primersite
Amplicon SequenceGTGGCTGTGAAGACGATGAAGATTGCCATCTGCACGAGGTCAGAGCTGGAGGATTTCCTG
AGTGAAGCGGTCTGCATGAAGGAATTTGACCATCCCAACGTCATGAGGCTCATCGGTGTC
TGTTTCCAGGGTTCTGAACGAGAGAGCTTCCCAGCACCTGTGGTCATCTTACCTTTCATG
AAACATGGAGACCTACACAGCTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2291859 - 2087
NM_001699 (AXL)2291832 - 2060
NM_001278599 ()2291237 - 1465
Exon 15 To Exon 17 (Pair 25)
Forward (2010,20)AGCTCAACCAGGACGACTCCAmplicon SizecDNA: 233 bpgenomic: 4,165
Reverse (2242,21)GAAGCTGTGTAGGTCTCCATGNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-1.83 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.718 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATCT
GCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGACC
ATCCCAACGTCATGAGGCTCATCGGTGTCTGTTTCCAGGGTTCTGAACGAGAGAGCTTCC
CAGCACCTGTGGTCATCTTACCTTTCATGAAACATGGAGACCTACACAGCTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2481234 - 1481
NM_001699 (AXL)2481829 - 2076
NM_021913 (AXL)2481856 - 2103
Exon 15 To Exon 16 (Pair 19)
Forward (2009,20)CAGCTCAACCAGGACGACTCAmplicon SizecDNA: 129 bpgenomic: 3,659
Reverse (2137,22)GTTGGGATGGTCAAATTCCTTCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.921 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.384 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.583 kcal/mol
Amplicon Folding-0.708 kcal/mol outside primersite
Amplicon SequenceCAGCTCAACCAGGACGACTCCATCCTCAAGGTGGCTGTGAAGACGATGAAGATTGCCATC
TGCACGAGGTCAGAGCTGGAGGATTTCCTGAGTGAAGCGGTCTGCATGAAGGAATTTGAC
CATCCCAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)1251827 - 1951
NM_001278599 ()1251232 - 1356
NM_021913 (AXL)1251854 - 1978
Exon 18 To Exon 20 (Pair 1)
Forward (2336,23)CTGAGTACCAAGAGATTCATACAAmplicon SizecDNA: 245 bpgenomic: 3,869
Reverse (2580,21)GTGGCAATCTCCCACATTGTCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.679 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops0.633 kcal/mol
Reverse Dimers-1.399 kcal/mol
Forward-Reverse Dimers-2.504 kcal/mol
Amplicon Folding-2.985 kcal/mol outside primersite
Amplicon SequenceCTGAGTACCAAGAGATTCATACACCGGGACCTGGCGGCCAGGAACTGCATGCTGAATGAG
AACATGTCCGTGTGTGTGGCGGACTTCGGGCTCTCCAAGAAGATCTACAATGGGGACTAC
TACCGCCAGGGACGTATCGCCAAGATGCCAGTCAAGTGGATTGCCATTGAGAGTCTAGCT
GACCGTGTCTACACCAGCAAGAGCGATGTGTGGTCCTTCGGGGTGACAATGTGGGAGATT
GCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2572169 - 2425
NM_001278599 ()2571547 - 1803
NM_001699 (AXL)2572142 - 2398
Exon 18 To Exon 20 (Pair 2)
Forward (2324,21)GGCATGGAGTATCTGAGTACCAmplicon SizecDNA: 253 bpgenomic: 3,877
Reverse (2576,21)CAATCTCCCACATTGTCACCCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.447 kcal/mol
Forward Dimers-0.658 kcal/mol
Reverse Loops1.787 kcal/mol
Reverse Dimers-1.203 kcal/mol
Forward-Reverse Dimers-1.591 kcal/mol
Amplicon Folding-2.985 kcal/mol outside primersite
Amplicon SequenceGGCATGGAGTATCTGAGTACCAAGAGATTCATACACCGGGACCTGGCGGCCAGGAACTGC
ATGCTGAATGAGAACATGTCCGTGTGTGTGGCGGACTTCGGGCTCTCCAAGAAGATCTAC
AATGGGGACTACTACCGCCAGGGACGTATCGCCAAGATGCCAGTCAAGTGGATTGCCATT
GAGAGTCTAGCTGACCGTGTCTACACCAGCAAGAGCGATGTGTGGTCCTTCGGGGTGACA
ATGTGGGAGATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2531547 - 1799
NM_001699 (AXL)2532142 - 2394
NM_021913 (AXL)2532169 - 2421
Exon 18 To Exon 20 (Pair 3)
Forward (2337,23)TGAGTACCAAGAGATTCATACACAmplicon SizecDNA: 244 bpgenomic: 3,868
Reverse (2580,21)GTGGCAATCTCCCACATTGTCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.679 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops0.633 kcal/mol
Reverse Dimers-1.399 kcal/mol
Forward-Reverse Dimers-2.504 kcal/mol
Amplicon Folding-2.985 kcal/mol outside primersite
Amplicon SequenceTGAGTACCAAGAGATTCATACACCGGGACCTGGCGGCCAGGAACTGCATGCTGAATGAGA
ACATGTCCGTGTGTGTGGCGGACTTCGGGCTCTCCAAGAAGATCTACAATGGGGACTACT
ACCGCCAGGGACGTATCGCCAAGATGCCAGTCAAGTGGATTGCCATTGAGAGTCTAGCTG
ACCGTGTCTACACCAGCAAGAGCGATGTGTGGTCCTTCGGGGTGACAATGTGGGAGATTG
CCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001278599 ()2611543 - 1803
NM_001699 (AXL)2612138 - 2398
NM_021913 (AXL)2612165 - 2425
Exon 18 To Exon 20 (Pair 4)
Forward (2336,23)CTGAGTACCAAGAGATTCATACAAmplicon SizecDNA: 241 bpgenomic: 3,865
Reverse (2576,21)CAATCTCCCACATTGTCACCCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.679 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops1.787 kcal/mol
Reverse Dimers-1.203 kcal/mol
Forward-Reverse Dimers-2.504 kcal/mol
Amplicon Folding-2.985 kcal/mol outside primersite
Amplicon SequenceCTGAGTACCAAGAGATTCATACACCGGGACCTGGCGGCCAGGAACTGCATGCTGAATGAG
AACATGTCCGTGTGTGTGGCGGACTTCGGGCTCTCCAAGAAGATCTACAATGGGGACTAC
TACCGCCAGGGACGTATCGCCAAGATGCCAGTCAAGTGGATTGCCATTGAGAGTCTAGCT
GACCGTGTCTACACCAGCAAGAGCGATGTGTGGTCCTTCGGGGTGACAATGTGGGAGATT
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2482174 - 2421
NM_001699 (AXL)2482147 - 2394
NM_001278599 ()2481552 - 1799
Exon 18 To Exon 20 (Pair 5)
Forward (2335,23)TCTGAGTACCAAGAGATTCATACAmplicon SizecDNA: 246 bpgenomic: 3,870
Reverse (2580,21)GTGGCAATCTCCCACATTGTCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.679 kcal/mol
Forward Dimers-0.389 kcal/mol
Reverse Loops0.633 kcal/mol
Reverse Dimers-1.399 kcal/mol
Forward-Reverse Dimers-2.504 kcal/mol
Amplicon Folding-2.985 kcal/mol outside primersite
Amplicon SequenceTCTGAGTACCAAGAGATTCATACACCGGGACCTGGCGGCCAGGAACTGCATGCTGAATGA
GAACATGTCCGTGTGTGTGGCGGACTTCGGGCTCTCCAAGAAGATCTACAATGGGGACTA
CTACCGCCAGGGACGTATCGCCAAGATGCCAGTCAAGTGGATTGCCATTGAGAGTCTAGC
TGACCGTGTCTACACCAGCAAGAGCGATGTGTGGTCCTTCGGGGTGACAATGTGGGAGAT
TGCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001699 (AXL)2522147 - 2398
NM_001278599 ()2521552 - 1803
NM_021913 (AXL)2522174 - 2425
Exon 18 To Exon 20 (Pair 6)
Forward (2320,21)CAGTGGCATGGAGTATCTGAGAmplicon SizecDNA: 261 bpgenomic: 3,885
Reverse (2580,21)GTGGCAATCTCCCACATTGTCNr. of Isoforms 3 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.447 kcal/mol in 3' area
Forward Dimers-0.793 kcal/mol
Reverse Loops0.633 kcal/mol
Reverse Dimers-1.399 kcal/mol
Forward-Reverse Dimers-2.185 kcal/mol
Amplicon Folding-2.985 kcal/mol outside primersite
Amplicon SequenceCAGTGGCATGGAGTATCTGAGTACCAAGAGATTCATACACCGGGACCTGGCGGCCAGGAA
CTGCATGCTGAATGAGAACATGTCCGTGTGTGTGGCGGACTTCGGGCTCTCCAAGAAGAT
CTACAATGGGGACTACTACCGCCAGGGACGTATCGCCAAGATGCCAGTCAAGTGGATTGC
CATTGAGAGTCTAGCTGACCGTGTCTACACCAGCAAGAGCGATGTGTGGTCCTTCGGGGT
GACAATGTGGGAGATTGCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021913 (AXL)2582164 - 2421
NM_001278599 ()2581542 - 1799
NM_001699 (AXL)2582137 - 2394
 

See below for some more details.

Program Output:

Loading ...