Design Results for Aox1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 1 To Exon 4 (Pair 1)
Forward (118,21)AGCTGCTCTTCTACGTGAACGAmplicon SizecDNA: 237 bpgenomic: 11,325
Reverse (354,22)CAGCACCATACAGAGAACAGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.086 kcal/mol in 3' area
Forward Dimers-2.896 kcal/mol
Reverse Loops3.416 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.435 kcal/mol
Amplicon Folding-2.65 kcal/mol outside primersite
Amplicon SequenceAGCTGCTCTTCTACGTGAACGGCCGCAAGGTGATAGAAAAAAATGTCGATCCTGAAACAA
TGCTGTTGCCTTATTTGAGGAAGAAGCTTCGACTCACAGGAACTAAGTATGGCTGTGGAG
GAGGAGGCTGTGGTGCTTGTACAGTGATGATATCACGATACAACCCCATCACCAAGAGGA
TAAGGCATCACCCAGCCAATGCCTGTCTGATTCCCATCTGTTCTCTGTATGGTGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)237118 - 354
Exon 1 To Exon 4 (Pair 2)
Forward (118,21)AGCTGCTCTTCTACGTGAACGAmplicon SizecDNA: 236 bpgenomic: 11,324
Reverse (353,22)AGCACCATACAGAGAACAGATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.086 kcal/mol in 3' area
Forward Dimers-2.896 kcal/mol
Reverse Loops2.748 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.435 kcal/mol
Amplicon Folding-2.65 kcal/mol outside primersite
Amplicon SequenceAGCTGCTCTTCTACGTGAACGGCCGCAAGGTGATAGAAAAAAATGTCGATCCTGAAACAA
TGCTGTTGCCTTATTTGAGGAAGAAGCTTCGACTCACAGGAACTAAGTATGGCTGTGGAG
GAGGAGGCTGTGGTGCTTGTACAGTGATGATATCACGATACAACCCCATCACCAAGAGGA
TAAGGCATCACCCAGCCAATGCCTGTCTGATTCCCATCTGTTCTCTGTATGGTGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)236118 - 353
Exon 2 To Exon 4 (Pair 1)
Forward (181,23)TGTTGCCTTATTTGAGGAAGAAGAmplicon SizecDNA: 176 bpgenomic: 4,272
Reverse (356,21)GGCAGCACCATACAGAGAACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.619 kcal/mol
Forward Dimers-1.906 kcal/mol
Reverse Loops0.916 kcal/mol
Reverse Dimers-1.012 kcal/mol
Forward-Reverse Dimers-2.473 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceTGTTGCCTTATTTGAGGAAGAAGCTTCGACTCACAGGAACTAAGTATGGCTGTGGAGGAG
GAGGCTGTGGTGCTTGTACAGTGATGATATCACGATACAACCCCATCACCAAGAGGATAA
GGCATCACCCAGCCAATGCCTGTCTGATTCCCATCTGTTCTCTGTATGGTGCTGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)176181 - 356
Exon 2 To Exon 4 (Pair 2)
Forward (181,23)TGTTGCCTTATTTGAGGAAGAAGAmplicon SizecDNA: 182 bpgenomic: 4,278
Reverse (362,20)GGTGACGGCAGCACCATACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.619 kcal/mol
Forward Dimers-1.906 kcal/mol
Reverse Loops0.485 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-2.521 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceTGTTGCCTTATTTGAGGAAGAAGCTTCGACTCACAGGAACTAAGTATGGCTGTGGAGGAG
GAGGCTGTGGTGCTTGTACAGTGATGATATCACGATACAACCCCATCACCAAGAGGATAA
GGCATCACCCAGCCAATGCCTGTCTGATTCCCATCTGTTCTCTGTATGGTGCTGCCGTCA
CC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)182181 - 362
Exon 2 To Exon 4 (Pair 3)
Forward (181,23)TGTTGCCTTATTTGAGGAAGAAGAmplicon SizecDNA: 181 bpgenomic: 4,277
Reverse (361,20)GTGACGGCAGCACCATACAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.619 kcal/mol
Forward Dimers-1.906 kcal/mol
Reverse Loops0.869 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-2.521 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceTGTTGCCTTATTTGAGGAAGAAGCTTCGACTCACAGGAACTAAGTATGGCTGTGGAGGAG
GAGGCTGTGGTGCTTGTACAGTGATGATATCACGATACAACCCCATCACCAAGAGGATAA
GGCATCACCCAGCCAATGCCTGTCTGATTCCCATCTGTTCTCTGTATGGTGCTGCCGTCA
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)181181 - 361
Exon 2 To Exon 4 (Pair 4)
Forward (180,23)CTGTTGCCTTATTTGAGGAAGAAAmplicon SizecDNA: 179 bpgenomic: 4,275
Reverse (358,21)ACGGCAGCACCATACAGAGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.619 kcal/mol
Forward Dimers-1.906 kcal/mol
Reverse Loops0.869 kcal/mol
Reverse Dimers-1.012 kcal/mol
Forward-Reverse Dimers-2.521 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceCTGTTGCCTTATTTGAGGAAGAAGCTTCGACTCACAGGAACTAAGTATGGCTGTGGAGGA
GGAGGCTGTGGTGCTTGTACAGTGATGATATCACGATACAACCCCATCACCAAGAGGATA
AGGCATCACCCAGCCAATGCCTGTCTGATTCCCATCTGTTCTCTGTATGGTGCTGCCGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)179180 - 358
Exon 2 To Exon 4 (Pair 5)
Forward (181,23)TGTTGCCTTATTTGAGGAAGAAGAmplicon SizecDNA: 179 bpgenomic: 4,275
Reverse (359,20)GACGGCAGCACCATACAGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.619 kcal/mol
Forward Dimers-1.906 kcal/mol
Reverse Loops0.869 kcal/mol
Reverse Dimers-1.012 kcal/mol
Forward-Reverse Dimers-2.521 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceTGTTGCCTTATTTGAGGAAGAAGCTTCGACTCACAGGAACTAAGTATGGCTGTGGAGGAG
GAGGCTGTGGTGCTTGTACAGTGATGATATCACGATACAACCCCATCACCAAGAGGATAA
GGCATCACCCAGCCAATGCCTGTCTGATTCCCATCTGTTCTCTGTATGGTGCTGCCGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)179181 - 359
Exon 2 To Exon 4 (Pair 6)
Forward (181,23)TGTTGCCTTATTTGAGGAAGAAGAmplicon SizecDNA: 175 bpgenomic: 4,271
Reverse (355,21)GCAGCACCATACAGAGAACAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.619 kcal/mol
Forward Dimers-1.906 kcal/mol
Reverse Loops998.645 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceTGTTGCCTTATTTGAGGAAGAAGCTTCGACTCACAGGAACTAAGTATGGCTGTGGAGGAG
GAGGCTGTGGTGCTTGTACAGTGATGATATCACGATACAACCCCATCACCAAGAGGATAA
GGCATCACCCAGCCAATGCCTGTCTGATTCCCATCTGTTCTCTGTATGGTGCTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)175181 - 355
Exon 2 To Exon 4 (Pair 7)
Forward (181,23)TGTTGCCTTATTTGAGGAAGAAGAmplicon SizecDNA: 178 bpgenomic: 4,274
Reverse (358,21)ACGGCAGCACCATACAGAGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.619 kcal/mol
Forward Dimers-1.906 kcal/mol
Reverse Loops0.869 kcal/mol
Reverse Dimers-1.012 kcal/mol
Forward-Reverse Dimers-2.521 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceTGTTGCCTTATTTGAGGAAGAAGCTTCGACTCACAGGAACTAAGTATGGCTGTGGAGGAG
GAGGCTGTGGTGCTTGTACAGTGATGATATCACGATACAACCCCATCACCAAGAGGATAA
GGCATCACCCAGCCAATGCCTGTCTGATTCCCATCTGTTCTCTGTATGGTGCTGCCGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)178181 - 358
Exon 2 To Exon 4 (Pair 8)
Forward (180,23)CTGTTGCCTTATTTGAGGAAGAAAmplicon SizecDNA: 183 bpgenomic: 4,279
Reverse (362,20)GGTGACGGCAGCACCATACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.619 kcal/mol
Forward Dimers-1.906 kcal/mol
Reverse Loops0.485 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-2.521 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceCTGTTGCCTTATTTGAGGAAGAAGCTTCGACTCACAGGAACTAAGTATGGCTGTGGAGGA
GGAGGCTGTGGTGCTTGTACAGTGATGATATCACGATACAACCCCATCACCAAGAGGATA
AGGCATCACCCAGCCAATGCCTGTCTGATTCCCATCTGTTCTCTGTATGGTGCTGCCGTC
ACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)183180 - 362
Exon 2 To Exon 4 (Pair 9)
Forward (181,23)TGTTGCCTTATTTGAGGAAGAAGAmplicon SizecDNA: 174 bpgenomic: 4,270
Reverse (354,22)CAGCACCATACAGAGAACAGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.619 kcal/mol
Forward Dimers-1.906 kcal/mol
Reverse Loops3.416 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceTGTTGCCTTATTTGAGGAAGAAGCTTCGACTCACAGGAACTAAGTATGGCTGTGGAGGAG
GAGGCTGTGGTGCTTGTACAGTGATGATATCACGATACAACCCCATCACCAAGAGGATAA
GGCATCACCCAGCCAATGCCTGTCTGATTCCCATCTGTTCTCTGTATGGTGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)174181 - 354
Exon 2 To Exon 4 (Pair 10)
Forward (180,23)CTGTTGCCTTATTTGAGGAAGAAAmplicon SizecDNA: 176 bpgenomic: 4,272
Reverse (355,21)GCAGCACCATACAGAGAACAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.619 kcal/mol
Forward Dimers-1.906 kcal/mol
Reverse Loops998.645 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.083 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceCTGTTGCCTTATTTGAGGAAGAAGCTTCGACTCACAGGAACTAAGTATGGCTGTGGAGGA
GGAGGCTGTGGTGCTTGTACAGTGATGATATCACGATACAACCCCATCACCAAGAGGATA
AGGCATCACCCAGCCAATGCCTGTCTGATTCCCATCTGTTCTCTGTATGGTGCTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)176180 - 355
Exon 2 To Exon 4 (Pair 11)
Forward (180,23)CTGTTGCCTTATTTGAGGAAGAAAmplicon SizecDNA: 177 bpgenomic: 4,273
Reverse (356,21)GGCAGCACCATACAGAGAACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.619 kcal/mol
Forward Dimers-1.906 kcal/mol
Reverse Loops0.916 kcal/mol
Reverse Dimers-1.012 kcal/mol
Forward-Reverse Dimers-2.473 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceCTGTTGCCTTATTTGAGGAAGAAGCTTCGACTCACAGGAACTAAGTATGGCTGTGGAGGA
GGAGGCTGTGGTGCTTGTACAGTGATGATATCACGATACAACCCCATCACCAAGAGGATA
AGGCATCACCCAGCCAATGCCTGTCTGATTCCCATCTGTTCTCTGTATGGTGCTGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)177180 - 356
Exon 2 To Exon 4 (Pair 12)
Forward (181,23)TGTTGCCTTATTTGAGGAAGAAGAmplicon SizecDNA: 173 bpgenomic: 4,269
Reverse (353,22)AGCACCATACAGAGAACAGATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.619 kcal/mol
Forward Dimers-1.906 kcal/mol
Reverse Loops2.748 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceTGTTGCCTTATTTGAGGAAGAAGCTTCGACTCACAGGAACTAAGTATGGCTGTGGAGGAG
GAGGCTGTGGTGCTTGTACAGTGATGATATCACGATACAACCCCATCACCAAGAGGATAA
GGCATCACCCAGCCAATGCCTGTCTGATTCCCATCTGTTCTCTGTATGGTGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)173181 - 353
Exon 2 To Exon 4 (Pair 13)
Forward (180,23)CTGTTGCCTTATTTGAGGAAGAAAmplicon SizecDNA: 182 bpgenomic: 4,278
Reverse (361,20)GTGACGGCAGCACCATACAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.619 kcal/mol
Forward Dimers-1.906 kcal/mol
Reverse Loops0.869 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-2.521 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceCTGTTGCCTTATTTGAGGAAGAAGCTTCGACTCACAGGAACTAAGTATGGCTGTGGAGGA
GGAGGCTGTGGTGCTTGTACAGTGATGATATCACGATACAACCCCATCACCAAGAGGATA
AGGCATCACCCAGCCAATGCCTGTCTGATTCCCATCTGTTCTCTGTATGGTGCTGCCGTC
AC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)182180 - 361
Exon 2 To Exon 4 (Pair 14)
Forward (180,23)CTGTTGCCTTATTTGAGGAAGAAAmplicon SizecDNA: 180 bpgenomic: 4,276
Reverse (359,20)GACGGCAGCACCATACAGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.619 kcal/mol
Forward Dimers-1.906 kcal/mol
Reverse Loops0.869 kcal/mol
Reverse Dimers-1.012 kcal/mol
Forward-Reverse Dimers-2.521 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceCTGTTGCCTTATTTGAGGAAGAAGCTTCGACTCACAGGAACTAAGTATGGCTGTGGAGGA
GGAGGCTGTGGTGCTTGTACAGTGATGATATCACGATACAACCCCATCACCAAGAGGATA
AGGCATCACCCAGCCAATGCCTGTCTGATTCCCATCTGTTCTCTGTATGGTGCTGCCGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)180180 - 359
Exon 10 To Exon 12 (Pair 1)
Forward (970,24)GAATTGAAGAACTGAGTGTTGTAAAmplicon SizecDNA: 232 bpgenomic: 3,772
Reverse (1201,22)TCTGAATCTGGATGCCTGCTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-0.95 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGTC
TCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAGA
AGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCCCAGATCA
GGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)232970 - 1201
Exon 10 To Exon 12 (Pair 2)
Forward (968,24)TAGAATTGAAGAACTGAGTGTTGTAmplicon SizecDNA: 234 bpgenomic: 3,774
Reverse (1201,22)TCTGAATCTGGATGCCTGCTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-0.95 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceTAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGG
TCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGA
GAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCCCAGAT
CAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)234968 - 1201
Exon 10 To Exon 11 (Pair 1)
Forward (974,23)TGAAGAACTGAGTGTTGTAAACCAmplicon SizecDNA: 130 bpgenomic: 3,485
Reverse (1103,22)GTACATCTGTGTCTTCTCCTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol
Forward Dimers-1.998 kcal/mol
Reverse Loops0.87 kcal/mol
Reverse Dimers-0.171 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGTCTCAG
CCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAGAAGAC
ACAGATGTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)130974 - 1103
Exon 10 To Exon 12 (Pair 3)
Forward (959,24)TTCTCCTGATAGAATTGAAGAACTAmplicon SizecDNA: 242 bpgenomic: 3,782
Reverse (1200,22)CTGAATCTGGATGCCTGCTAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-2 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceTTCTCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCT
TGGTGCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCT
TCCAGAGGAGAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGG
GTCCCAGATCAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTC
AG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)242959 - 1200
Exon 10 To Exon 12 (Pair 4)
Forward (963,23)CCTGATAGAATTGAAGAACTGAGAmplicon SizecDNA: 240 bpgenomic: 3,780
Reverse (1202,22)ATCTGAATCTGGATGCCTGCTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-1.695 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGT
GCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCA
GAGGAGAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCC
CAGATCAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCAGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)240963 - 1202
Exon 10 To Exon 11 (Pair 2)
Forward (961,23)CTCCTGATAGAATTGAAGAACTGAmplicon SizecDNA: 140 bpgenomic: 3,495
Reverse (1100,21)CATCTGTGTCTTCTCCTCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops2.115 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceCTCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTG
GTGCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTC
CAGAGGAGAAGACACAGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)140961 - 1100
Exon 10 To Exon 12 (Pair 5)
Forward (959,24)TTCTCCTGATAGAATTGAAGAACTAmplicon SizecDNA: 240 bpgenomic: 3,780
Reverse (1198,22)GAATCTGGATGCCTGCTAATGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-2 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceTTCTCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCT
TGGTGCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCT
TCCAGAGGAGAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGG
GTCCCAGATCAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)240959 - 1198
Exon 10 To Exon 11 (Pair 3)
Forward (969,24)AGAATTGAAGAACTGAGTGTTGTAAmplicon SizecDNA: 134 bpgenomic: 3,489
Reverse (1102,22)TACATCTGTGTCTTCTCCTCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops0.87 kcal/mol
Reverse Dimers-0.171 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGT
CTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAG
AAGACACAGATGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)134969 - 1102
Exon 10 To Exon 11 (Pair 4)
Forward (970,24)GAATTGAAGAACTGAGTGTTGTAAAmplicon SizecDNA: 136 bpgenomic: 3,491
Reverse (1105,22)TGGTACATCTGTGTCTTCTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops0.767 kcal/mol
Reverse Dimers-0.684 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGTC
TCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAGA
AGACACAGATGTACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)136970 - 1105
Exon 10 To Exon 12 (Pair 6)
Forward (969,24)AGAATTGAAGAACTGAGTGTTGTAAmplicon SizecDNA: 232 bpgenomic: 3,772
Reverse (1200,22)CTGAATCTGGATGCCTGCTAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-0.95 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGT
CTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAG
AAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCCCAGATC
AGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)232969 - 1200
Exon 10 To Exon 12 (Pair 7)
Forward (963,23)CCTGATAGAATTGAAGAACTGAGAmplicon SizecDNA: 238 bpgenomic: 3,778
Reverse (1200,22)CTGAATCTGGATGCCTGCTAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-1.695 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGT
GCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCA
GAGGAGAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCC
CAGATCAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)238963 - 1200
Exon 10 To Exon 12 (Pair 8)
Forward (968,24)TAGAATTGAAGAACTGAGTGTTGTAmplicon SizecDNA: 236 bpgenomic: 3,776
Reverse (1203,21)GATCTGAATCTGGATGCCTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-0.95 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceTAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGG
TCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGA
GAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCCCAGAT
CAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCAGATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)236968 - 1203
Exon 10 To Exon 11 (Pair 5)
Forward (970,24)GAATTGAAGAACTGAGTGTTGTAAAmplicon SizecDNA: 133 bpgenomic: 3,488
Reverse (1102,22)TACATCTGTGTCTTCTCCTCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops0.87 kcal/mol
Reverse Dimers-0.171 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGTC
TCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAGA
AGACACAGATGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)133970 - 1102
Exon 10 To Exon 12 (Pair 9)
Forward (970,24)GAATTGAAGAACTGAGTGTTGTAAAmplicon SizecDNA: 234 bpgenomic: 3,774
Reverse (1203,21)GATCTGAATCTGGATGCCTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-0.95 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGTC
TCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAGA
AGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCCCAGATCA
GGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCAGATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)234970 - 1203
Exon 10 To Exon 12 (Pair 10)
Forward (958,24)TTTCTCCTGATAGAATTGAAGAACAmplicon SizecDNA: 244 bpgenomic: 3,784
Reverse (1201,22)TCTGAATCTGGATGCCTGCTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.836 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-2 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceTTTCTCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCC
TTGGTGCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGC
TTCCAGAGGAGAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTG
GGTCCCAGATCAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATT
CAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)244958 - 1201
Exon 10 To Exon 12 (Pair 11)
Forward (970,24)GAATTGAAGAACTGAGTGTTGTAAAmplicon SizecDNA: 231 bpgenomic: 3,771
Reverse (1200,22)CTGAATCTGGATGCCTGCTAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-0.95 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGTC
TCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAGA
AGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCCCAGATCA
GGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)231970 - 1200
Exon 10 To Exon 12 (Pair 12)
Forward (961,23)CTCCTGATAGAATTGAAGAACTGAmplicon SizecDNA: 239 bpgenomic: 3,779
Reverse (1199,22)TGAATCTGGATGCCTGCTAATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-2 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceCTCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTG
GTGCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTC
CAGAGGAGAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGT
CCCAGATCAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)239961 - 1199
Exon 10 To Exon 11 (Pair 6)
Forward (961,23)CTCCTGATAGAATTGAAGAACTGAmplicon SizecDNA: 142 bpgenomic: 3,497
Reverse (1102,22)TACATCTGTGTCTTCTCCTCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops0.87 kcal/mol
Reverse Dimers-0.171 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceCTCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTG
GTGCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTC
CAGAGGAGAAGACACAGATGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)142961 - 1102
Exon 10 To Exon 12 (Pair 13)
Forward (969,24)AGAATTGAAGAACTGAGTGTTGTAAmplicon SizecDNA: 234 bpgenomic: 3,774
Reverse (1202,22)ATCTGAATCTGGATGCCTGCTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-0.95 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGT
CTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAG
AAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCCCAGATC
AGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCAGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)234969 - 1202
Exon 10 To Exon 12 (Pair 14)
Forward (963,23)CCTGATAGAATTGAAGAACTGAGAmplicon SizecDNA: 241 bpgenomic: 3,781
Reverse (1203,21)GATCTGAATCTGGATGCCTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-1.695 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGT
GCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCA
GAGGAGAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCC
CAGATCAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCAGAT
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)241963 - 1203
Exon 10 To Exon 12 (Pair 15)
Forward (961,23)CTCCTGATAGAATTGAAGAACTGAmplicon SizecDNA: 238 bpgenomic: 3,778
Reverse (1198,22)GAATCTGGATGCCTGCTAATGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-2 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceCTCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTG
GTGCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTC
CAGAGGAGAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGT
CCCAGATCAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)238961 - 1198
Exon 10 To Exon 11 (Pair 7)
Forward (972,24)ATTGAAGAACTGAGTGTTGTAAACAmplicon SizecDNA: 132 bpgenomic: 3,487
Reverse (1103,22)GTACATCTGTGTCTTCTCCTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol
Forward Dimers-1.998 kcal/mol
Reverse Loops0.87 kcal/mol
Reverse Dimers-0.171 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGTCTC
AGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAGAAG
ACACAGATGTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)132972 - 1103
Exon 10 To Exon 12 (Pair 16)
Forward (972,24)ATTGAAGAACTGAGTGTTGTAAACAmplicon SizecDNA: 232 bpgenomic: 3,772
Reverse (1203,21)GATCTGAATCTGGATGCCTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol
Forward Dimers-1.998 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-0.935 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGTCTC
AGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAGAAG
ACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCCCAGATCAGG
AACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCAGATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)232972 - 1203
Exon 10 To Exon 12 (Pair 17)
Forward (958,24)TTTCTCCTGATAGAATTGAAGAACAmplicon SizecDNA: 246 bpgenomic: 3,786
Reverse (1203,21)GATCTGAATCTGGATGCCTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.836 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-2 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceTTTCTCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCC
TTGGTGCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGC
TTCCAGAGGAGAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTG
GGTCCCAGATCAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATT
CAGATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)246958 - 1203
Exon 10 To Exon 12 (Pair 18)
Forward (958,24)TTTCTCCTGATAGAATTGAAGAACAmplicon SizecDNA: 243 bpgenomic: 3,783
Reverse (1200,22)CTGAATCTGGATGCCTGCTAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.836 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-2 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceTTTCTCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCC
TTGGTGCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGC
TTCCAGAGGAGAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTG
GGTCCCAGATCAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATT
CAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)243958 - 1200
Exon 10 To Exon 11 (Pair 8)
Forward (975,23)GAAGAACTGAGTGTTGTAAACCAAmplicon SizecDNA: 129 bpgenomic: 3,484
Reverse (1103,22)GTACATCTGTGTCTTCTCCTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol
Forward Dimers-1.998 kcal/mol
Reverse Loops0.87 kcal/mol
Reverse Dimers-0.171 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGTCTCAGC
CTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAGAAGACA
CAGATGTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)129975 - 1103
Exon 10 To Exon 11 (Pair 9)
Forward (972,24)ATTGAAGAACTGAGTGTTGTAAACAmplicon SizecDNA: 129 bpgenomic: 3,484
Reverse (1100,21)CATCTGTGTCTTCTCCTCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol
Forward Dimers-1.998 kcal/mol
Reverse Loops2.115 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGTCTC
AGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAGAAG
ACACAGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)129972 - 1100
Exon 10 To Exon 12 (Pair 19)
Forward (969,24)AGAATTGAAGAACTGAGTGTTGTAAmplicon SizecDNA: 230 bpgenomic: 3,770
Reverse (1198,22)GAATCTGGATGCCTGCTAATGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-0.95 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGT
CTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAG
AAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCCCAGATC
AGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)230969 - 1198
Exon 10 To Exon 11 (Pair 10)
Forward (969,24)AGAATTGAAGAACTGAGTGTTGTAAmplicon SizecDNA: 135 bpgenomic: 3,490
Reverse (1103,22)GTACATCTGTGTCTTCTCCTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops0.87 kcal/mol
Reverse Dimers-0.171 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGT
CTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAG
AAGACACAGATGTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)135969 - 1103
Exon 10 To Exon 12 (Pair 20)
Forward (969,24)AGAATTGAAGAACTGAGTGTTGTAAmplicon SizecDNA: 231 bpgenomic: 3,771
Reverse (1199,22)TGAATCTGGATGCCTGCTAATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-0.95 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGT
CTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAG
AAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCCCAGATC
AGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)231969 - 1199
Exon 10 To Exon 12 (Pair 21)
Forward (963,23)CCTGATAGAATTGAAGAACTGAGAmplicon SizecDNA: 237 bpgenomic: 3,777
Reverse (1199,22)TGAATCTGGATGCCTGCTAATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-1.695 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGT
GCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCA
GAGGAGAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCC
CAGATCAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)237963 - 1199
Exon 10 To Exon 11 (Pair 11)
Forward (970,24)GAATTGAAGAACTGAGTGTTGTAAAmplicon SizecDNA: 131 bpgenomic: 3,486
Reverse (1100,21)CATCTGTGTCTTCTCCTCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops2.115 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGTC
TCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAGA
AGACACAGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)131970 - 1100
Exon 10 To Exon 11 (Pair 12)
Forward (975,23)GAAGAACTGAGTGTTGTAAACCAAmplicon SizecDNA: 126 bpgenomic: 3,481
Reverse (1100,21)CATCTGTGTCTTCTCCTCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol
Forward Dimers-1.998 kcal/mol
Reverse Loops2.115 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGTCTCAGC
CTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAGAAGACA
CAGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)126975 - 1100
Exon 10 To Exon 12 (Pair 22)
Forward (970,24)GAATTGAAGAACTGAGTGTTGTAAAmplicon SizecDNA: 233 bpgenomic: 3,773
Reverse (1202,22)ATCTGAATCTGGATGCCTGCTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-0.95 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGTC
TCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAGA
AGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCCCAGATCA
GGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCAGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)233970 - 1202
Exon 10 To Exon 12 (Pair 23)
Forward (961,23)CTCCTGATAGAATTGAAGAACTGAmplicon SizecDNA: 241 bpgenomic: 3,781
Reverse (1201,22)TCTGAATCTGGATGCCTGCTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-2 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceCTCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTG
GTGCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTC
CAGAGGAGAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGT
CCCAGATCAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCAG
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)241961 - 1201
Exon 10 To Exon 11 (Pair 13)
Forward (963,23)CCTGATAGAATTGAAGAACTGAGAmplicon SizecDNA: 141 bpgenomic: 3,496
Reverse (1103,22)GTACATCTGTGTCTTCTCCTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops0.87 kcal/mol
Reverse Dimers-0.171 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGT
GCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCA
GAGGAGAAGACACAGATGTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)141963 - 1103
Exon 10 To Exon 11 (Pair 14)
Forward (975,23)GAAGAACTGAGTGTTGTAAACCAAmplicon SizecDNA: 128 bpgenomic: 3,483
Reverse (1102,22)TACATCTGTGTCTTCTCCTCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol
Forward Dimers-1.998 kcal/mol
Reverse Loops0.87 kcal/mol
Reverse Dimers-0.171 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGTCTCAGC
CTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAGAAGACA
CAGATGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)128975 - 1102
Exon 10 To Exon 11 (Pair 15)
Forward (972,24)ATTGAAGAACTGAGTGTTGTAAACAmplicon SizecDNA: 134 bpgenomic: 3,489
Reverse (1105,22)TGGTACATCTGTGTCTTCTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol
Forward Dimers-1.998 kcal/mol
Reverse Loops0.767 kcal/mol
Reverse Dimers-0.684 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGTCTC
AGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAGAAG
ACACAGATGTACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)134972 - 1105
Exon 10 To Exon 12 (Pair 24)
Forward (968,24)TAGAATTGAAGAACTGAGTGTTGTAmplicon SizecDNA: 232 bpgenomic: 3,772
Reverse (1199,22)TGAATCTGGATGCCTGCTAATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-0.95 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceTAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGG
TCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGA
GAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCCCAGAT
CAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)232968 - 1199
Exon 10 To Exon 11 (Pair 16)
Forward (963,23)CCTGATAGAATTGAAGAACTGAGAmplicon SizecDNA: 143 bpgenomic: 3,498
Reverse (1105,22)TGGTACATCTGTGTCTTCTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops0.767 kcal/mol
Reverse Dimers-0.684 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGT
GCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCA
GAGGAGAAGACACAGATGTACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)143963 - 1105
Exon 10 To Exon 11 (Pair 17)
Forward (968,24)TAGAATTGAAGAACTGAGTGTTGTAmplicon SizecDNA: 133 bpgenomic: 3,488
Reverse (1100,21)CATCTGTGTCTTCTCCTCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops2.115 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceTAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGG
TCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGA
GAAGACACAGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)133968 - 1100
Exon 10 To Exon 11 (Pair 18)
Forward (961,23)CTCCTGATAGAATTGAAGAACTGAmplicon SizecDNA: 143 bpgenomic: 3,498
Reverse (1103,22)GTACATCTGTGTCTTCTCCTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops0.87 kcal/mol
Reverse Dimers-0.171 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceCTCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTG
GTGCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTC
CAGAGGAGAAGACACAGATGTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)143961 - 1103
Exon 10 To Exon 11 (Pair 19)
Forward (969,24)AGAATTGAAGAACTGAGTGTTGTAAmplicon SizecDNA: 132 bpgenomic: 3,487
Reverse (1100,21)CATCTGTGTCTTCTCCTCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops2.115 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGT
CTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAG
AAGACACAGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)132969 - 1100
Exon 10 To Exon 11 (Pair 20)
Forward (968,24)TAGAATTGAAGAACTGAGTGTTGTAmplicon SizecDNA: 136 bpgenomic: 3,491
Reverse (1103,22)GTACATCTGTGTCTTCTCCTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops0.87 kcal/mol
Reverse Dimers-0.171 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceTAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGG
TCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGA
GAAGACACAGATGTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)136968 - 1103
Exon 10 To Exon 11 (Pair 21)
Forward (969,24)AGAATTGAAGAACTGAGTGTTGTAAmplicon SizecDNA: 137 bpgenomic: 3,492
Reverse (1105,22)TGGTACATCTGTGTCTTCTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops0.767 kcal/mol
Reverse Dimers-0.684 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGT
CTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAG
AAGACACAGATGTACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)137969 - 1105
Exon 10 To Exon 12 (Pair 25)
Forward (970,24)GAATTGAAGAACTGAGTGTTGTAAAmplicon SizecDNA: 229 bpgenomic: 3,769
Reverse (1198,22)GAATCTGGATGCCTGCTAATGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-0.95 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGTC
TCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAGA
AGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCCCAGATCA
GGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)229970 - 1198
Exon 10 To Exon 11 (Pair 22)
Forward (974,23)TGAAGAACTGAGTGTTGTAAACCAmplicon SizecDNA: 127 bpgenomic: 3,482
Reverse (1100,21)CATCTGTGTCTTCTCCTCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol
Forward Dimers-1.998 kcal/mol
Reverse Loops2.115 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGTCTCAG
CCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAGAAGAC
ACAGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)127974 - 1100
Exon 10 To Exon 12 (Pair 26)
Forward (969,24)AGAATTGAAGAACTGAGTGTTGTAAmplicon SizecDNA: 235 bpgenomic: 3,775
Reverse (1203,21)GATCTGAATCTGGATGCCTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-0.95 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGT
CTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAG
AAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCCCAGATC
AGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCAGATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)235969 - 1203
Exon 10 To Exon 12 (Pair 27)
Forward (961,23)CTCCTGATAGAATTGAAGAACTGAmplicon SizecDNA: 240 bpgenomic: 3,780
Reverse (1200,22)CTGAATCTGGATGCCTGCTAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-2 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceCTCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTG
GTGCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTC
CAGAGGAGAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGT
CCCAGATCAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)240961 - 1200
Exon 10 To Exon 11 (Pair 23)
Forward (963,23)CCTGATAGAATTGAAGAACTGAGAmplicon SizecDNA: 138 bpgenomic: 3,493
Reverse (1100,21)CATCTGTGTCTTCTCCTCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops2.115 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGT
GCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCA
GAGGAGAAGACACAGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)138963 - 1100
Exon 10 To Exon 12 (Pair 28)
Forward (974,23)TGAAGAACTGAGTGTTGTAAACCAmplicon SizecDNA: 230 bpgenomic: 3,770
Reverse (1203,21)GATCTGAATCTGGATGCCTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol
Forward Dimers-1.998 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-0.935 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGTCTCAG
CCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAGAAGAC
ACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCCCAGATCAGGAA
CATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCAGATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)230974 - 1203
Exon 10 To Exon 12 (Pair 29)
Forward (961,23)CTCCTGATAGAATTGAAGAACTGAmplicon SizecDNA: 242 bpgenomic: 3,782
Reverse (1202,22)ATCTGAATCTGGATGCCTGCTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-2 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceCTCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTG
GTGCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTC
CAGAGGAGAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGT
CCCAGATCAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCAG
AT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)242961 - 1202
Exon 10 To Exon 11 (Pair 24)
Forward (970,24)GAATTGAAGAACTGAGTGTTGTAAAmplicon SizecDNA: 134 bpgenomic: 3,489
Reverse (1103,22)GTACATCTGTGTCTTCTCCTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops0.87 kcal/mol
Reverse Dimers-0.171 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGTC
TCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAGA
AGACACAGATGTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)134970 - 1103
Exon 10 To Exon 12 (Pair 30)
Forward (958,24)TTTCTCCTGATAGAATTGAAGAACAmplicon SizecDNA: 242 bpgenomic: 3,782
Reverse (1199,22)TGAATCTGGATGCCTGCTAATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.836 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-2 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceTTTCTCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCC
TTGGTGCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGC
TTCCAGAGGAGAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTG
GGTCCCAGATCAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATT
CA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)242958 - 1199
Exon 10 To Exon 11 (Pair 25)
Forward (968,24)TAGAATTGAAGAACTGAGTGTTGTAmplicon SizecDNA: 135 bpgenomic: 3,490
Reverse (1102,22)TACATCTGTGTCTTCTCCTCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops0.87 kcal/mol
Reverse Dimers-0.171 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceTAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGG
TCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGA
GAAGACACAGATGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)135968 - 1102
Exon 10 To Exon 12 (Pair 31)
Forward (963,23)CCTGATAGAATTGAAGAACTGAGAmplicon SizecDNA: 239 bpgenomic: 3,779
Reverse (1201,22)TCTGAATCTGGATGCCTGCTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-1.695 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGT
GCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCA
GAGGAGAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCC
CAGATCAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)239963 - 1201
Exon 10 To Exon 12 (Pair 32)
Forward (959,24)TTCTCCTGATAGAATTGAAGAACTAmplicon SizecDNA: 245 bpgenomic: 3,785
Reverse (1203,21)GATCTGAATCTGGATGCCTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-2 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceTTCTCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCT
TGGTGCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCT
TCCAGAGGAGAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGG
GTCCCAGATCAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTC
AGATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)245959 - 1203
Exon 10 To Exon 12 (Pair 33)
Forward (968,24)TAGAATTGAAGAACTGAGTGTTGTAmplicon SizecDNA: 233 bpgenomic: 3,773
Reverse (1200,22)CTGAATCTGGATGCCTGCTAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-0.95 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceTAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGG
TCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGA
GAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCCCAGAT
CAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)233968 - 1200
Exon 10 To Exon 12 (Pair 34)
Forward (970,24)GAATTGAAGAACTGAGTGTTGTAAAmplicon SizecDNA: 230 bpgenomic: 3,770
Reverse (1199,22)TGAATCTGGATGCCTGCTAATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-0.95 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGTC
TCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAGA
AGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCCCAGATCA
GGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)230970 - 1199
Exon 10 To Exon 12 (Pair 35)
Forward (969,24)AGAATTGAAGAACTGAGTGTTGTAAmplicon SizecDNA: 233 bpgenomic: 3,773
Reverse (1201,22)TCTGAATCTGGATGCCTGCTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-0.95 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGT
CTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAG
AAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCCCAGATC
AGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)233969 - 1201
Exon 10 To Exon 11 (Pair 26)
Forward (968,24)TAGAATTGAAGAACTGAGTGTTGTAmplicon SizecDNA: 138 bpgenomic: 3,493
Reverse (1105,22)TGGTACATCTGTGTCTTCTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops0.767 kcal/mol
Reverse Dimers-0.684 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceTAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGG
TCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGA
GAAGACACAGATGTACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)138968 - 1105
Exon 10 To Exon 12 (Pair 36)
Forward (958,24)TTTCTCCTGATAGAATTGAAGAACAmplicon SizecDNA: 245 bpgenomic: 3,785
Reverse (1202,22)ATCTGAATCTGGATGCCTGCTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.836 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-2 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceTTTCTCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCC
TTGGTGCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGC
TTCCAGAGGAGAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTG
GGTCCCAGATCAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATT
CAGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)245958 - 1202
Exon 10 To Exon 12 (Pair 37)
Forward (972,24)ATTGAAGAACTGAGTGTTGTAAACAmplicon SizecDNA: 227 bpgenomic: 3,767
Reverse (1198,22)GAATCTGGATGCCTGCTAATGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol
Forward Dimers-1.998 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-0.94 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGTCTC
AGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAGAAG
ACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCCCAGATCAGG
AACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)227972 - 1198
Exon 10 To Exon 12 (Pair 38)
Forward (959,24)TTCTCCTGATAGAATTGAAGAACTAmplicon SizecDNA: 244 bpgenomic: 3,784
Reverse (1202,22)ATCTGAATCTGGATGCCTGCTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-2 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceTTCTCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCT
TGGTGCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCT
TCCAGAGGAGAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGG
GTCCCAGATCAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTC
AGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)244959 - 1202
Exon 10 To Exon 12 (Pair 39)
Forward (968,24)TAGAATTGAAGAACTGAGTGTTGTAmplicon SizecDNA: 235 bpgenomic: 3,775
Reverse (1202,22)ATCTGAATCTGGATGCCTGCTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-0.95 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceTAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGG
TCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGA
GAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCCCAGAT
CAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCAGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)235968 - 1202
Exon 10 To Exon 12 (Pair 40)
Forward (959,24)TTCTCCTGATAGAATTGAAGAACTAmplicon SizecDNA: 241 bpgenomic: 3,781
Reverse (1199,22)TGAATCTGGATGCCTGCTAATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-2 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceTTCTCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCT
TGGTGCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCT
TCCAGAGGAGAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGG
GTCCCAGATCAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTC
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)241959 - 1199
Exon 10 To Exon 11 (Pair 27)
Forward (963,23)CCTGATAGAATTGAAGAACTGAGAmplicon SizecDNA: 140 bpgenomic: 3,495
Reverse (1102,22)TACATCTGTGTCTTCTCCTCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops0.87 kcal/mol
Reverse Dimers-0.171 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGT
GCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCA
GAGGAGAAGACACAGATGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)140963 - 1102
Exon 10 To Exon 11 (Pair 28)
Forward (972,24)ATTGAAGAACTGAGTGTTGTAAACAmplicon SizecDNA: 131 bpgenomic: 3,486
Reverse (1102,22)TACATCTGTGTCTTCTCCTCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol
Forward Dimers-1.998 kcal/mol
Reverse Loops0.87 kcal/mol
Reverse Dimers-0.171 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGTCTC
AGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAGAAG
ACACAGATGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)131972 - 1102
Exon 10 To Exon 12 (Pair 41)
Forward (963,23)CCTGATAGAATTGAAGAACTGAGAmplicon SizecDNA: 236 bpgenomic: 3,776
Reverse (1198,22)GAATCTGGATGCCTGCTAATGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-1.695 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGT
GCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCA
GAGGAGAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCC
CAGATCAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)236963 - 1198
Exon 10 To Exon 12 (Pair 42)
Forward (961,23)CTCCTGATAGAATTGAAGAACTGAmplicon SizecDNA: 243 bpgenomic: 3,783
Reverse (1203,21)GATCTGAATCTGGATGCCTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops1.633 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-2 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceCTCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTG
GTGCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTC
CAGAGGAGAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGT
CCCAGATCAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTCAG
ATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)243961 - 1203
Exon 10 To Exon 12 (Pair 43)
Forward (974,23)TGAAGAACTGAGTGTTGTAAACCAmplicon SizecDNA: 225 bpgenomic: 3,765
Reverse (1198,22)GAATCTGGATGCCTGCTAATGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol
Forward Dimers-1.998 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-0.94 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGTCTCAG
CCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAGAAGAC
ACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCCCAGATCAGGAA
CATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)225974 - 1198
Exon 10 To Exon 12 (Pair 44)
Forward (968,24)TAGAATTGAAGAACTGAGTGTTGTAmplicon SizecDNA: 231 bpgenomic: 3,771
Reverse (1198,22)GAATCTGGATGCCTGCTAATGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol in 3' area
Forward Dimers-1.998 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-0.95 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceTAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGG
TCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGA
GAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGGGTCCCAGAT
CAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)231968 - 1198
Exon 10 To Exon 11 (Pair 29)
Forward (974,23)TGAAGAACTGAGTGTTGTAAACCAmplicon SizecDNA: 129 bpgenomic: 3,484
Reverse (1102,22)TACATCTGTGTCTTCTCCTCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.576 kcal/mol
Forward Dimers-1.998 kcal/mol
Reverse Loops0.87 kcal/mol
Reverse Dimers-0.171 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTGGTGCTGGTCTCAG
CCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTCCAGAGGAGAAGAC
ACAGATGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)129974 - 1102
Exon 10 To Exon 12 (Pair 45)
Forward (959,24)TTCTCCTGATAGAATTGAAGAACTAmplicon SizecDNA: 243 bpgenomic: 3,783
Reverse (1201,22)TCTGAATCTGGATGCCTGCTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-2 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceTTCTCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCT
TGGTGCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCT
TCCAGAGGAGAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTGG
GTCCCAGATCAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATTC
AGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)243959 - 1201
Exon 10 To Exon 12 (Pair 46)
Forward (958,24)TTTCTCCTGATAGAATTGAAGAACAmplicon SizecDNA: 241 bpgenomic: 3,781
Reverse (1198,22)GAATCTGGATGCCTGCTAATGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.836 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops1.716 kcal/mol
Reverse Dimers-1.251 kcal/mol
Forward-Reverse Dimers-2 kcal/mol
Amplicon Folding-1.81 kcal/mol outside primersite
Amplicon SequenceTTTCTCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCC
TTGGTGCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGC
TTCCAGAGGAGAAGACACAGATGTACCATGCTCTCCTGAAGCATTTGGGAACTCTGGCTG
GGTCCCAGATCAGGAACATGGCTTCTTTAGGGGGACACATCATTAGCAGGCATCCAGATT
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)241958 - 1198
Exon 10 To Exon 11 (Pair 30)
Forward (961,23)CTCCTGATAGAATTGAAGAACTGAmplicon SizecDNA: 145 bpgenomic: 3,500
Reverse (1105,22)TGGTACATCTGTGTCTTCTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops0.767 kcal/mol
Reverse Dimers-0.684 kcal/mol
Forward-Reverse Dimers-1.405 kcal/mol
Amplicon Folding-0.611 kcal/mol outside primersite
Amplicon SequenceCTCCTGATAGAATTGAAGAACTGAGTGTTGTAAACCATGCATATAATGGACTCACCCTTG
GTGCTGGTCTCAGCCTAGCCCAGGTGAAGGACATTTTGGCTGATGTAGTCCAGAAGCTTC
CAGAGGAGAAGACACAGATGTACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)145961 - 1105
Exon 12 To Exon 14 (Pair 1)
Forward (1229,22)CTGTACCCTCAACTTGCTATCAAmplicon SizecDNA: 175 bpgenomic: 3,259
Reverse (1403,19)CTGTCGCTGGGCTTGTCGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.189 kcal/mol in 3' area
Forward Dimers-0.036 kcal/mol
Reverse Loops1.925 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-1.764 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceCTGTACCCTCAACTTGCTATCAAAAGAAGGAAAACGACAGATTCCTTTAAATGAGCAATT
CCTCAGCAAGTGCCCTAATGCAGATCTTAAGCCTCAAGAAATCTTGGTCTCAGTGAACAT
CCCCTACTCAAGGAAGTGGGAATTTGTGTCAGCCTTCCGACAAGCCCAGCGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)1751229 - 1403
Exon 12 To Exon 14 (Pair 2)
Forward (1225,22)GTAACTGTACCCTCAACTTGCTAmplicon SizecDNA: 167 bpgenomic: 3,251
Reverse (1391,22)TTGTCGGAAGGCTGACACAAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.251 kcal/mol in 3' area
Forward Dimers-0.826 kcal/mol
Reverse Loops0.186 kcal/mol
Reverse Dimers-2.409 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceGTAACTGTACCCTCAACTTGCTATCAAAAGAAGGAAAACGACAGATTCCTTTAAATGAGC
AATTCCTCAGCAAGTGCCCTAATGCAGATCTTAAGCCTCAAGAAATCTTGGTCTCAGTGA
ACATCCCCTACTCAAGGAAGTGGGAATTTGTGTCAGCCTTCCGACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)1671225 - 1391
Exon 12 To Exon 14 (Pair 3)
Forward (1225,22)GTAACTGTACCCTCAACTTGCTAmplicon SizecDNA: 169 bpgenomic: 3,253
Reverse (1393,20)GCTTGTCGGAAGGCTGACACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.251 kcal/mol in 3' area
Forward Dimers-0.826 kcal/mol
Reverse Loops0.186 kcal/mol in 3' area
Reverse Dimers-2.409 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceGTAACTGTACCCTCAACTTGCTATCAAAAGAAGGAAAACGACAGATTCCTTTAAATGAGC
AATTCCTCAGCAAGTGCCCTAATGCAGATCTTAAGCCTCAAGAAATCTTGGTCTCAGTGA
ACATCCCCTACTCAAGGAAGTGGGAATTTGTGTCAGCCTTCCGACAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)1691225 - 1393
Exon 12 To Exon 14 (Pair 4)
Forward (1230,23)TGTACCCTCAACTTGCTATCAAAAmplicon SizecDNA: 173 bpgenomic: 3,257
Reverse (1402,20)TGTCGCTGGGCTTGTCGGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.745 kcal/mol in 3' area
Forward Dimers-0.036 kcal/mol
Reverse Loops1.456 kcal/mol in 3' area
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-1.764 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceTGTACCCTCAACTTGCTATCAAAAGAAGGAAAACGACAGATTCCTTTAAATGAGCAATTC
CTCAGCAAGTGCCCTAATGCAGATCTTAAGCCTCAAGAAATCTTGGTCTCAGTGAACATC
CCCTACTCAAGGAAGTGGGAATTTGTGTCAGCCTTCCGACAAGCCCAGCGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)1731230 - 1402
Exon 12 To Exon 14 (Pair 5)
Forward (1226,23)TAACTGTACCCTCAACTTGCTATAmplicon SizecDNA: 178 bpgenomic: 3,262
Reverse (1403,19)CTGTCGCTGGGCTTGTCGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.251 kcal/mol in 3' area
Forward Dimers-0.826 kcal/mol
Reverse Loops1.925 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-1.764 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceTAACTGTACCCTCAACTTGCTATCAAAAGAAGGAAAACGACAGATTCCTTTAAATGAGCA
ATTCCTCAGCAAGTGCCCTAATGCAGATCTTAAGCCTCAAGAAATCTTGGTCTCAGTGAA
CATCCCCTACTCAAGGAAGTGGGAATTTGTGTCAGCCTTCCGACAAGCCCAGCGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)1781226 - 1403
Exon 12 To Exon 14 (Pair 6)
Forward (1225,22)GTAACTGTACCCTCAACTTGCTAmplicon SizecDNA: 178 bpgenomic: 3,262
Reverse (1402,20)TGTCGCTGGGCTTGTCGGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.251 kcal/mol in 3' area
Forward Dimers-0.826 kcal/mol
Reverse Loops1.456 kcal/mol in 3' area
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-1.764 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceGTAACTGTACCCTCAACTTGCTATCAAAAGAAGGAAAACGACAGATTCCTTTAAATGAGC
AATTCCTCAGCAAGTGCCCTAATGCAGATCTTAAGCCTCAAGAAATCTTGGTCTCAGTGA
ACATCCCCTACTCAAGGAAGTGGGAATTTGTGTCAGCCTTCCGACAAGCCCAGCGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)1781225 - 1402
Exon 12 To Exon 14 (Pair 7)
Forward (1226,23)TAACTGTACCCTCAACTTGCTATAmplicon SizecDNA: 168 bpgenomic: 3,252
Reverse (1393,20)GCTTGTCGGAAGGCTGACACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.251 kcal/mol in 3' area
Forward Dimers-0.826 kcal/mol
Reverse Loops0.186 kcal/mol in 3' area
Reverse Dimers-2.409 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceTAACTGTACCCTCAACTTGCTATCAAAAGAAGGAAAACGACAGATTCCTTTAAATGAGCA
ATTCCTCAGCAAGTGCCCTAATGCAGATCTTAAGCCTCAAGAAATCTTGGTCTCAGTGAA
CATCCCCTACTCAAGGAAGTGGGAATTTGTGTCAGCCTTCCGACAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)1681226 - 1393
Exon 12 To Exon 14 (Pair 8)
Forward (1228,22)ACTGTACCCTCAACTTGCTATCAmplicon SizecDNA: 281 bpgenomic: 3,365
Reverse (1508,19)GGCTGGACCAACGCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.251 kcal/mol
Forward Dimers-0.036 kcal/mol
Reverse Loops0.916 kcal/mol
Reverse Dimers-1.382 kcal/mol
Forward-Reverse Dimers-0.992 kcal/mol
Amplicon Folding-1.686 kcal/mol outside primersite
Amplicon SequenceACTGTACCCTCAACTTGCTATCAAAAGAAGGAAAACGACAGATTCCTTTAAATGAGCAAT
TCCTCAGCAAGTGCCCTAATGCAGATCTTAAGCCTCAAGAAATCTTGGTCTCAGTGAACA
TCCCCTACTCAAGGAAGTGGGAATTTGTGTCAGCCTTCCGACAAGCCCAGCGACAGGAGA
ATGCGCTAGCGATAGTCAATTCAGGAATGAGAGTCTTTTTTGGAGAAGGGGATGGCATTA
TTAGAGAGTTATGCATCTCATATGGAGGCGTTGGTCCAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001159 (AOX1)2811228 - 1508
 

See below for some more details.

Program Output:

Loading ...