Design Results for Apol2

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 5 To Exon 6 (Pair 8)
Forward (629,22)AATCTGCTACAACTGCTGACTGAmplicon SizecDNA: 132 bpgenomic: 3,191
Reverse (760,22)GTCCTTCATGACCATGTGACTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.051 kcal/mol in 3' area
Forward Dimers-0.136 kcal/mol
Reverse Loops1.546 kcal/mol
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-0.889 kcal/mol
Amplicon Folding-2.957 kcal/mol outside primersite
Amplicon SequenceAATCTGCTACAACTGCTGACTGATGATGAAGCCTGGAATGGATTCGTGGCTGCTGCTGAA
CTGCCCAGGGATGAGGCAGATGAGCTCCGTAAAGCTCTGAACAAGCTTGCAAGTCACATG
GTCATGAAGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_030882 (APOL2)132406 - 537
NM_145637 (APOL2)132547 - 678
Exon 5 To Exon 6 (Pair 7)
Forward (629,22)AATCTGCTACAACTGCTGACTGAmplicon SizecDNA: 134 bpgenomic: 3,193
Reverse (762,22)TTGTCCTTCATGACCATGTGACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.051 kcal/mol in 3' area
Forward Dimers-0.136 kcal/mol
Reverse Loops1.546 kcal/mol in 3' area
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-1.101 kcal/mol
Amplicon Folding-2.957 kcal/mol outside primersite
Amplicon SequenceAATCTGCTACAACTGCTGACTGATGATGAAGCCTGGAATGGATTCGTGGCTGCTGCTGAA
CTGCCCAGGGATGAGGCAGATGAGCTCCGTAAAGCTCTGAACAAGCTTGCAAGTCACATG
GTCATGAAGGACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145637 (APOL2)134547 - 680
NM_030882 (APOL2)134406 - 539
Exon 5 To Exon 6 (Pair 6)
Forward (659,20)GCCTGGAATGGATTCGTGGCAmplicon SizecDNA: 103 bpgenomic: 3,162
Reverse (761,22)TGTCCTTCATGACCATGTGACTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.198 kcal/mol
Forward Dimers-1.93 kcal/mol
Reverse Loops1.546 kcal/mol
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-2.902 kcal/mol
Amplicon Folding-2.402 kcal/mol outside primersite
Amplicon SequenceGCCTGGAATGGATTCGTGGCTGCTGCTGAACTGCCCAGGGATGAGGCAGATGAGCTCCGT
AAAGCTCTGAACAAGCTTGCAAGTCACATGGTCATGAAGGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_030882 (APOL2)103436 - 538
NM_145637 (APOL2)103577 - 679
Exon 5 To Exon 6 (Pair 4)
Forward (659,20)GCCTGGAATGGATTCGTGGCAmplicon SizecDNA: 102 bpgenomic: 3,161
Reverse (760,22)GTCCTTCATGACCATGTGACTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.198 kcal/mol
Forward Dimers-1.93 kcal/mol
Reverse Loops1.546 kcal/mol
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-2.902 kcal/mol
Amplicon Folding-2.402 kcal/mol outside primersite
Amplicon SequenceGCCTGGAATGGATTCGTGGCTGCTGCTGAACTGCCCAGGGATGAGGCAGATGAGCTCCGT
AAAGCTCTGAACAAGCTTGCAAGTCACATGGTCATGAAGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_030882 (APOL2)102436 - 537
NM_145637 (APOL2)102577 - 678
Exon 5 To Exon 6 (Pair 5)
Forward (659,20)GCCTGGAATGGATTCGTGGCAmplicon SizecDNA: 101 bpgenomic: 3,160
Reverse (759,22)TCCTTCATGACCATGTGACTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.198 kcal/mol
Forward Dimers-1.93 kcal/mol
Reverse Loops1.546 kcal/mol
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-2.902 kcal/mol
Amplicon Folding-2.402 kcal/mol outside primersite
Amplicon SequenceGCCTGGAATGGATTCGTGGCTGCTGCTGAACTGCCCAGGGATGAGGCAGATGAGCTCCGT
AAAGCTCTGAACAAGCTTGCAAGTCACATGGTCATGAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145637 (APOL2)101577 - 677
NM_030882 (APOL2)101436 - 536
Exon 5 To Exon 6 (Pair 3)
Forward (629,22)AATCTGCTACAACTGCTGACTGAmplicon SizecDNA: 131 bpgenomic: 3,190
Reverse (759,22)TCCTTCATGACCATGTGACTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.051 kcal/mol in 3' area
Forward Dimers-0.136 kcal/mol
Reverse Loops1.546 kcal/mol
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-0.889 kcal/mol
Amplicon Folding-2.957 kcal/mol outside primersite
Amplicon SequenceAATCTGCTACAACTGCTGACTGATGATGAAGCCTGGAATGGATTCGTGGCTGCTGCTGAA
CTGCCCAGGGATGAGGCAGATGAGCTCCGTAAAGCTCTGAACAAGCTTGCAAGTCACATG
GTCATGAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145637 (APOL2)131547 - 677
NM_030882 (APOL2)131406 - 536
Exon 5 To Exon 6 (Pair 1)
Forward (659,20)GCCTGGAATGGATTCGTGGCAmplicon SizecDNA: 104 bpgenomic: 3,163
Reverse (762,22)TTGTCCTTCATGACCATGTGACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.198 kcal/mol
Forward Dimers-1.93 kcal/mol
Reverse Loops1.546 kcal/mol in 3' area
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-2.902 kcal/mol
Amplicon Folding-2.402 kcal/mol outside primersite
Amplicon SequenceGCCTGGAATGGATTCGTGGCTGCTGCTGAACTGCCCAGGGATGAGGCAGATGAGCTCCGT
AAAGCTCTGAACAAGCTTGCAAGTCACATGGTCATGAAGGACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145637 (APOL2)104577 - 680
NM_030882 (APOL2)104436 - 539
Exon 5 To Exon 6 (Pair 2)
Forward (659,20)GCCTGGAATGGATTCGTGGCAmplicon SizecDNA: 99 bpgenomic: 3,158
Reverse (757,22)CTTCATGACCATGTGACTTGCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.198 kcal/mol
Forward Dimers-1.93 kcal/mol
Reverse Loops1.546 kcal/mol
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-2.902 kcal/mol
Amplicon Folding-2.402 kcal/mol outside primersite
Amplicon SequenceGCCTGGAATGGATTCGTGGCTGCTGCTGAACTGCCCAGGGATGAGGCAGATGAGCTCCGT
AAAGCTCTGAACAAGCTTGCAAGTCACATGGTCATGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145637 (APOL2)99577 - 675
NM_030882 (APOL2)99436 - 534
 

See below for some more details.

Program Output:

Loading ...