Design Results for BRAF

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 3 To Exon 4 (Pair 1)
Forward (444,23)TTTCAGTGCTACCTTCATCTCTTAmplicon SizecDNA: 158 bpgenomic: 25,771
Reverse (601,21)ACTGTCTCGGACTGTAACTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.173 kcal/mol
Reverse Dimers-0.87 kcal/mol
Forward-Reverse Dimers-1.83 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGCA
ACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACAG
TGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)158444 - 601
Exon 3 To Exon 5 (Pair 1)
Forward (444,23)TTTCAGTGCTACCTTCATCTCTTAmplicon SizecDNA: 269 bpgenomic: 26,711
Reverse (712,22)AAGCCAGGAAATATCAGTGTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.787 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-2.445 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGCA
ACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACAG
TGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATGA
GAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAA
TTGGTTGGGACACTGATATTTCCTGGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)269444 - 712
Exon 3 To Exon 5 (Pair 2)
Forward (443,22)CTTTCAGTGCTACCTTCATCTCAmplicon SizecDNA: 295 bpgenomic: 26,737
Reverse (737,22)CTTCCACATGCAATTCTTCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGC
AACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACA
GTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATG
AGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCA
ATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)295443 - 737
Exon 3 To Exon 4 (Pair 2)
Forward (442,22)CCTTTCAGTGCTACCTTCATCTAmplicon SizecDNA: 159 bpgenomic: 25,772
Reverse (600,21)CTGTCTCGGACTGTAACTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.613 kcal/mol
Reverse Dimers-0.87 kcal/mol
Forward-Reverse Dimers-1.83 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAG
CAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGAC
AGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)159442 - 600
Exon 3 To Exon 4 (Pair 3)
Forward (443,22)CTTTCAGTGCTACCTTCATCTCAmplicon SizecDNA: 157 bpgenomic: 25,770
Reverse (599,21)TGTCTCGGACTGTAACTCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.613 kcal/mol
Reverse Dimers-0.87 kcal/mol
Forward-Reverse Dimers-1.83 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGC
AACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACA
GTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)157443 - 599
Exon 3 To Exon 4 (Pair 4)
Forward (442,22)CCTTTCAGTGCTACCTTCATCTAmplicon SizecDNA: 195 bpgenomic: 25,808
Reverse (636,22)GGGATTAGACCTCTCATCATCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.53 kcal/mol
Reverse Dimers-0.586 kcal/mol
Forward-Reverse Dimers-1.045 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAG
CAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGAC
AGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGAT
GAGAGGTCTAATCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)195442 - 636
Exon 3 To Exon 5 (Pair 3)
Forward (442,22)CCTTTCAGTGCTACCTTCATCTAmplicon SizecDNA: 291 bpgenomic: 26,733
Reverse (732,23)ACATGCAATTCTTCTCCAGTAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAG
CAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGAC
AGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGAT
GAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACC
AATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)291442 - 732
Exon 3 To Exon 4 (Pair 5)
Forward (440,22)AGCCTTTCAGTGCTACCTTCATAmplicon SizecDNA: 197 bpgenomic: 25,810
Reverse (636,22)GGGATTAGACCTCTCATCATCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.104 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.53 kcal/mol
Reverse Dimers-0.586 kcal/mol
Forward-Reverse Dimers-1.045 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGG
AGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGG
ACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATG
ATGAGAGGTCTAATCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)197440 - 636
Exon 3 To Exon 5 (Pair 4)
Forward (444,23)TTTCAGTGCTACCTTCATCTCTTAmplicon SizecDNA: 289 bpgenomic: 26,731
Reverse (732,23)ACATGCAATTCTTCTCCAGTAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGCA
ACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACAG
TGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATGA
GAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAA
TTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)289444 - 732
Exon 3 To Exon 5 (Pair 5)
Forward (443,22)CTTTCAGTGCTACCTTCATCTCAmplicon SizecDNA: 273 bpgenomic: 26,715
Reverse (715,23)AGTAAGCCAGGAAATATCAGTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.787 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-2.445 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGC
AACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACA
GTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATG
AGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCA
ATTGGTTGGGACACTGATATTTCCTGGCTTACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)273443 - 715
Exon 3 To Exon 5 (Pair 6)
Forward (443,22)CTTTCAGTGCTACCTTCATCTCAmplicon SizecDNA: 275 bpgenomic: 26,717
Reverse (717,22)CCAGTAAGCCAGGAAATATCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.601 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-2.445 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGC
AACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACA
GTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATG
AGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCA
ATTGGTTGGGACACTGATATTTCCTGGCTTACTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)275443 - 717
Exon 3 To Exon 5 (Pair 7)
Forward (443,22)CTTTCAGTGCTACCTTCATCTCAmplicon SizecDNA: 299 bpgenomic: 26,741
Reverse (741,23)AACACTTCCACATGCAATTCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-2.269 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGC
AACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACA
GTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATG
AGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCA
ATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGAAGTGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)299443 - 741
Exon 3 To Exon 4 (Pair 6)
Forward (437,22)TCTAGCCTTTCAGTGCTACCTTAmplicon SizecDNA: 196 bpgenomic: 25,809
Reverse (632,22)TTAGACCTCTCATCATCAGTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.874 kcal/mol
Forward Dimers-1.01 kcal/mol
Reverse Loops1.53 kcal/mol
Reverse Dimers-0.167 kcal/mol
Forward-Reverse Dimers-0.629 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCA
CGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAG
AGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTG
ATGATGAGAGGTCTAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)196437 - 632
Exon 3 To Exon 5 (Pair 8)
Forward (439,22)TAGCCTTTCAGTGCTACCTTCAAmplicon SizecDNA: 294 bpgenomic: 26,736
Reverse (732,23)ACATGCAATTCTTCTCCAGTAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.874 kcal/mol
Forward Dimers-1.01 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACG
GAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAG
GACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGAT
GATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAA
ACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)294439 - 732
Exon 3 To Exon 4 (Pair 7)
Forward (444,23)TTTCAGTGCTACCTTCATCTCTTAmplicon SizecDNA: 183 bpgenomic: 25,796
Reverse (626,23)CTCTCATCATCAGTGCTTTCTTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.941 kcal/mol in 3' area
Reverse Dimers-0.959 kcal/mol
Forward-Reverse Dimers-1.355 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGCA
ACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACAG
TGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATGA
GAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)183444 - 626
Exon 3 To Exon 4 (Pair 8)
Forward (440,22)AGCCTTTCAGTGCTACCTTCATAmplicon SizecDNA: 163 bpgenomic: 25,776
Reverse (602,21)GACTGTCTCGGACTGTAACTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.104 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops0.61 kcal/mol
Reverse Dimers-1.004 kcal/mol
Forward-Reverse Dimers-1.83 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGG
AGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGG
ACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 9)
Forward (443,22)CTTTCAGTGCTACCTTCATCTCAmplicon SizecDNA: 290 bpgenomic: 26,732
Reverse (732,23)ACATGCAATTCTTCTCCAGTAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGC
AACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACA
GTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATG
AGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCA
ATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)290443 - 732
Exon 3 To Exon 4 (Pair 9)
Forward (439,22)TAGCCTTTCAGTGCTACCTTCAAmplicon SizecDNA: 161 bpgenomic: 25,774
Reverse (599,21)TGTCTCGGACTGTAACTCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.874 kcal/mol
Forward Dimers-1.01 kcal/mol
Reverse Loops1.613 kcal/mol
Reverse Dimers-0.87 kcal/mol
Forward-Reverse Dimers-1.83 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACG
GAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAG
GACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 10)
Forward (317,21)ACCAGCAAGCTAGATGCACTCAmplicon SizecDNA: 286 bpgenomic: 25,899
Reverse (602,21)GACTGTCTCGGACTGTAACTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.586 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.61 kcal/mol
Reverse Dimers-1.004 kcal/mol
Forward-Reverse Dimers-1.072 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTGGAATCTCTGGGGAAC
GGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTTACATCTTCTTCCTCT
TCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCA
CGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAG
AGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)286317 - 602
Exon 3 To Exon 5 (Pair 10)
Forward (439,22)TAGCCTTTCAGTGCTACCTTCAAmplicon SizecDNA: 295 bpgenomic: 26,737
Reverse (733,23)CACATGCAATTCTTCTCCAGTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.874 kcal/mol
Forward Dimers-1.01 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACG
GAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAG
GACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGAT
GATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAA
ACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)295439 - 733
Exon 3 To Exon 4 (Pair 11)
Forward (439,22)TAGCCTTTCAGTGCTACCTTCAAmplicon SizecDNA: 186 bpgenomic: 25,799
Reverse (624,23)CTCATCATCAGTGCTTTCTTTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.874 kcal/mol
Forward Dimers-1.01 kcal/mol
Reverse Loops1.941 kcal/mol in 3' area
Reverse Dimers-0.959 kcal/mol
Forward-Reverse Dimers-1.532 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACG
GAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAG
GACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGAT
GATGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)186439 - 624
Exon 3 To Exon 4 (Pair 12)
Forward (437,22)TCTAGCCTTTCAGTGCTACCTTAmplicon SizecDNA: 190 bpgenomic: 25,803
Reverse (626,23)CTCTCATCATCAGTGCTTTCTTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.874 kcal/mol
Forward Dimers-1.01 kcal/mol
Reverse Loops1.941 kcal/mol in 3' area
Reverse Dimers-0.959 kcal/mol
Forward-Reverse Dimers-1.532 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCA
CGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAG
AGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTG
ATGATGAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)190437 - 626
Exon 3 To Exon 4 (Pair 13)
Forward (442,22)CCTTTCAGTGCTACCTTCATCTAmplicon SizecDNA: 191 bpgenomic: 25,804
Reverse (632,22)TTAGACCTCTCATCATCAGTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.53 kcal/mol
Reverse Dimers-0.167 kcal/mol
Forward-Reverse Dimers-0.629 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAG
CAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGAC
AGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGAT
GAGAGGTCTAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)191442 - 632
Exon 3 To Exon 4 (Pair 14)
Forward (313,22)ATACACCAGCAAGCTAGATGCAAmplicon SizecDNA: 290 bpgenomic: 25,903
Reverse (602,21)GACTGTCTCGGACTGTAACTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.586 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.61 kcal/mol
Reverse Dimers-1.004 kcal/mol
Forward-Reverse Dimers-1.072 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceATACACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTGGAATCTCTGGG
GAACGGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTTACATCTTCTTC
CTCTTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGT
GGCACGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAA
ACAGAGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)290313 - 602
Exon 3 To Exon 5 (Pair 11)
Forward (444,23)TTTCAGTGCTACCTTCATCTCTTAmplicon SizecDNA: 297 bpgenomic: 26,739
Reverse (740,23)ACACTTCCACATGCAATTCTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-2.269 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGCA
ACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACAG
TGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATGA
GAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAA
TTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGAAGTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)297444 - 740
Exon 3 To Exon 5 (Pair 12)
Forward (444,23)TTTCAGTGCTACCTTCATCTCTTAmplicon SizecDNA: 276 bpgenomic: 26,718
Reverse (719,22)CTCCAGTAAGCCAGGAAATATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.296 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-2.445 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGCA
ACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACAG
TGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATGA
GAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAA
TTGGTTGGGACACTGATATTTCCTGGCTTACTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)276444 - 719
Exon 3 To Exon 5 (Pair 13)
Forward (443,22)CTTTCAGTGCTACCTTCATCTCAmplicon SizecDNA: 293 bpgenomic: 26,735
Reverse (735,22)TCCACATGCAATTCTTCTCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGC
AACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACA
GTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATG
AGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCA
ATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)293443 - 735
Exon 3 To Exon 4 (Pair 15)
Forward (444,23)TTTCAGTGCTACCTTCATCTCTTAmplicon SizecDNA: 193 bpgenomic: 25,806
Reverse (636,22)GGGATTAGACCTCTCATCATCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.53 kcal/mol
Reverse Dimers-0.586 kcal/mol
Forward-Reverse Dimers-1.045 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGCA
ACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACAG
TGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATGA
GAGGTCTAATCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)193444 - 636
Exon 3 To Exon 4 (Pair 16)
Forward (440,22)AGCCTTTCAGTGCTACCTTCATAmplicon SizecDNA: 193 bpgenomic: 25,806
Reverse (632,22)TTAGACCTCTCATCATCAGTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.104 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.53 kcal/mol
Reverse Dimers-0.167 kcal/mol
Forward-Reverse Dimers-0.629 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGG
AGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGG
ACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATG
ATGAGAGGTCTAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)193440 - 632
Exon 3 To Exon 5 (Pair 14)
Forward (444,23)TTTCAGTGCTACCTTCATCTCTTAmplicon SizecDNA: 278 bpgenomic: 26,720
Reverse (721,23)TTCTCCAGTAAGCCAGGAAATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.296 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-2.445 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGCA
ACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACAG
TGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATGA
GAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAA
TTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)278444 - 721
Exon 3 To Exon 4 (Pair 17)
Forward (444,23)TTTCAGTGCTACCTTCATCTCTTAmplicon SizecDNA: 196 bpgenomic: 25,809
Reverse (639,22)TCTGGGATTAGACCTCTCATCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.53 kcal/mol
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-1.062 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGCA
ACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACAG
TGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATGA
GAGGTCTAATCCCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)196444 - 639
Exon 3 To Exon 4 (Pair 18)
Forward (442,22)CCTTTCAGTGCTACCTTCATCTAmplicon SizecDNA: 185 bpgenomic: 25,798
Reverse (626,23)CTCTCATCATCAGTGCTTTCTTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.941 kcal/mol in 3' area
Reverse Dimers-0.959 kcal/mol
Forward-Reverse Dimers-1.355 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAG
CAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGAC
AGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGAT
GAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)185442 - 626
Exon 3 To Exon 4 (Pair 19)
Forward (442,22)CCTTTCAGTGCTACCTTCATCTAmplicon SizecDNA: 181 bpgenomic: 25,794
Reverse (622,23)CATCATCAGTGCTTTCTTTAGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.941 kcal/mol
Reverse Dimers-0.959 kcal/mol
Forward-Reverse Dimers-1.355 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAG
CAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGAC
AGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGAT
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)181442 - 622
Exon 3 To Exon 4 (Pair 20)
Forward (316,21)CACCAGCAAGCTAGATGCACTAmplicon SizecDNA: 285 bpgenomic: 25,898
Reverse (600,21)CTGTCTCGGACTGTAACTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.586 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.613 kcal/mol
Reverse Dimers-0.87 kcal/mol
Forward-Reverse Dimers-1.072 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceCACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTGGAATCTCTGGGGAA
CGGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTTACATCTTCTTCCTC
TTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGC
ACGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACA
GAGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)285316 - 600
Exon 3 To Exon 4 (Pair 21)
Forward (440,22)AGCCTTTCAGTGCTACCTTCATAmplicon SizecDNA: 187 bpgenomic: 25,800
Reverse (626,23)CTCTCATCATCAGTGCTTTCTTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.104 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.941 kcal/mol in 3' area
Reverse Dimers-0.959 kcal/mol
Forward-Reverse Dimers-1.355 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGG
AGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGG
ACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATG
ATGAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)187440 - 626
Exon 3 To Exon 4 (Pair 22)
Forward (443,22)CTTTCAGTGCTACCTTCATCTCAmplicon SizecDNA: 194 bpgenomic: 25,807
Reverse (636,22)GGGATTAGACCTCTCATCATCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.53 kcal/mol
Reverse Dimers-0.586 kcal/mol
Forward-Reverse Dimers-1.045 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGC
AACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACA
GTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATG
AGAGGTCTAATCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)194443 - 636
Exon 3 To Exon 5 (Pair 15)
Forward (440,22)AGCCTTTCAGTGCTACCTTCATAmplicon SizecDNA: 296 bpgenomic: 26,738
Reverse (735,22)TCCACATGCAATTCTTCTCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.104 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGG
AGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGG
ACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATG
ATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAA
CCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)296440 - 735
Exon 3 To Exon 5 (Pair 16)
Forward (443,22)CTTTCAGTGCTACCTTCATCTCAmplicon SizecDNA: 268 bpgenomic: 26,710
Reverse (710,21)GCCAGGAAATATCAGTGTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.721 kcal/mol in 3' area
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-2.445 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGC
AACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACA
GTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATG
AGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCA
ATTGGTTGGGACACTGATATTTCCTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)268443 - 710
Exon 3 To Exon 4 (Pair 23)
Forward (444,23)TTTCAGTGCTACCTTCATCTCTTAmplicon SizecDNA: 179 bpgenomic: 25,792
Reverse (622,23)CATCATCAGTGCTTTCTTTAGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.941 kcal/mol
Reverse Dimers-0.959 kcal/mol
Forward-Reverse Dimers-1.355 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGCA
ACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACAG
TGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)179444 - 622
Exon 3 To Exon 4 (Pair 24)
Forward (316,21)CACCAGCAAGCTAGATGCACTAmplicon SizecDNA: 286 bpgenomic: 25,899
Reverse (601,21)ACTGTCTCGGACTGTAACTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.586 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.173 kcal/mol
Reverse Dimers-0.87 kcal/mol
Forward-Reverse Dimers-1.072 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceCACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTGGAATCTCTGGGGAA
CGGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTTACATCTTCTTCCTC
TTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGC
ACGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACA
GAGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)286316 - 601
Exon 3 To Exon 4 (Pair 25)
Forward (311,22)GAATACACCAGCAAGCTAGATGAmplicon SizecDNA: 289 bpgenomic: 25,902
Reverse (599,21)TGTCTCGGACTGTAACTCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.426 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.613 kcal/mol
Reverse Dimers-0.87 kcal/mol
Forward-Reverse Dimers-1.072 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceGAATACACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTGGAATCTCTG
GGGAACGGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTTACATCTTCT
TCCTCTTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGAT
GTGGCACGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAAC
AAACAGAGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)289311 - 599
Exon 3 To Exon 4 (Pair 26)
Forward (443,22)CTTTCAGTGCTACCTTCATCTCAmplicon SizecDNA: 195 bpgenomic: 25,808
Reverse (637,22)TGGGATTAGACCTCTCATCATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.53 kcal/mol
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-1.062 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGC
AACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACA
GTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATG
AGAGGTCTAATCCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)195443 - 637
Exon 3 To Exon 4 (Pair 27)
Forward (440,22)AGCCTTTCAGTGCTACCTTCATAmplicon SizecDNA: 162 bpgenomic: 25,775
Reverse (601,21)ACTGTCTCGGACTGTAACTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.104 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.173 kcal/mol
Reverse Dimers-0.87 kcal/mol
Forward-Reverse Dimers-1.83 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGG
AGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGG
ACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)162440 - 601
Exon 3 To Exon 5 (Pair 17)
Forward (444,23)TTTCAGTGCTACCTTCATCTCTTAmplicon SizecDNA: 290 bpgenomic: 26,732
Reverse (733,23)CACATGCAATTCTTCTCCAGTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGCA
ACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACAG
TGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATGA
GAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAA
TTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)290444 - 733
Exon 3 To Exon 4 (Pair 28)
Forward (444,23)TTTCAGTGCTACCTTCATCTCTTAmplicon SizecDNA: 195 bpgenomic: 25,808
Reverse (638,22)CTGGGATTAGACCTCTCATCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.53 kcal/mol
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-1.062 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGCA
ACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACAG
TGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATGA
GAGGTCTAATCCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)195444 - 638
Exon 3 To Exon 4 (Pair 29)
Forward (437,22)TCTAGCCTTTCAGTGCTACCTTAmplicon SizecDNA: 188 bpgenomic: 25,801
Reverse (624,23)CTCATCATCAGTGCTTTCTTTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.874 kcal/mol
Forward Dimers-1.01 kcal/mol
Reverse Loops1.941 kcal/mol in 3' area
Reverse Dimers-0.959 kcal/mol
Forward-Reverse Dimers-1.532 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCA
CGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAG
AGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTG
ATGATGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)188437 - 624
Exon 3 To Exon 4 (Pair 30)
Forward (317,21)ACCAGCAAGCTAGATGCACTCAmplicon SizecDNA: 283 bpgenomic: 25,896
Reverse (599,21)TGTCTCGGACTGTAACTCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.586 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.613 kcal/mol
Reverse Dimers-0.87 kcal/mol
Forward-Reverse Dimers-1.072 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTGGAATCTCTGGGGAAC
GGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTTACATCTTCTTCCTCT
TCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCA
CGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAG
AGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)283317 - 599
Exon 3 To Exon 4 (Pair 31)
Forward (439,22)TAGCCTTTCAGTGCTACCTTCAAmplicon SizecDNA: 163 bpgenomic: 25,776
Reverse (601,21)ACTGTCTCGGACTGTAACTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.874 kcal/mol
Forward Dimers-1.01 kcal/mol
Reverse Loops1.173 kcal/mol
Reverse Dimers-0.87 kcal/mol
Forward-Reverse Dimers-1.83 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACG
GAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAG
GACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 18)
Forward (444,23)TTTCAGTGCTACCTTCATCTCTTAmplicon SizecDNA: 291 bpgenomic: 26,733
Reverse (734,22)CCACATGCAATTCTTCTCCAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGCA
ACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACAG
TGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATGA
GAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAA
TTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)291444 - 734
Exon 3 To Exon 4 (Pair 32)
Forward (315,21)ACACCAGCAAGCTAGATGCACAmplicon SizecDNA: 287 bpgenomic: 25,900
Reverse (601,21)ACTGTCTCGGACTGTAACTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.586 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.173 kcal/mol
Reverse Dimers-0.87 kcal/mol
Forward-Reverse Dimers-1.072 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceACACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTGGAATCTCTGGGGA
ACGGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTTACATCTTCTTCCT
CTTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGG
CACGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAAC
AGAGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)287315 - 601
Exon 3 To Exon 5 (Pair 19)
Forward (437,22)TCTAGCCTTTCAGTGCTACCTTAmplicon SizecDNA: 297 bpgenomic: 26,739
Reverse (733,23)CACATGCAATTCTTCTCCAGTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.874 kcal/mol
Forward Dimers-1.01 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCA
CGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAG
AGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTG
ATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAG
AAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)297437 - 733
Exon 3 To Exon 5 (Pair 20)
Forward (437,22)TCTAGCCTTTCAGTGCTACCTTAmplicon SizecDNA: 298 bpgenomic: 26,740
Reverse (734,22)CCACATGCAATTCTTCTCCAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.874 kcal/mol
Forward Dimers-1.01 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCA
CGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAG
AGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTG
ATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAG
AAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)298437 - 734
Exon 3 To Exon 4 (Pair 33)
Forward (312,22)AATACACCAGCAAGCTAGATGCAmplicon SizecDNA: 290 bpgenomic: 25,903
Reverse (601,21)ACTGTCTCGGACTGTAACTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.008 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.173 kcal/mol
Reverse Dimers-0.87 kcal/mol
Forward-Reverse Dimers-1.072 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceAATACACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTGGAATCTCTGG
GGAACGGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTTACATCTTCTT
CCTCTTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATG
TGGCACGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACA
AACAGAGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)290312 - 601
Exon 3 To Exon 5 (Pair 21)
Forward (439,22)TAGCCTTTCAGTGCTACCTTCAAmplicon SizecDNA: 297 bpgenomic: 26,739
Reverse (735,22)TCCACATGCAATTCTTCTCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.874 kcal/mol
Forward Dimers-1.01 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACG
GAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAG
GACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGAT
GATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAA
ACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)297439 - 735
Exon 3 To Exon 4 (Pair 34)
Forward (439,22)TAGCCTTTCAGTGCTACCTTCAAmplicon SizecDNA: 162 bpgenomic: 25,775
Reverse (600,21)CTGTCTCGGACTGTAACTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.874 kcal/mol
Forward Dimers-1.01 kcal/mol
Reverse Loops1.613 kcal/mol
Reverse Dimers-0.87 kcal/mol
Forward-Reverse Dimers-1.83 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACG
GAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAG
GACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 35)
Forward (315,21)ACACCAGCAAGCTAGATGCACAmplicon SizecDNA: 285 bpgenomic: 25,898
Reverse (599,21)TGTCTCGGACTGTAACTCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.586 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.613 kcal/mol
Reverse Dimers-0.87 kcal/mol
Forward-Reverse Dimers-1.072 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceACACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTGGAATCTCTGGGGA
ACGGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTTACATCTTCTTCCT
CTTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGG
CACGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAAC
AGAGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)285315 - 599
Exon 3 To Exon 5 (Pair 22)
Forward (443,22)CTTTCAGTGCTACCTTCATCTCAmplicon SizecDNA: 291 bpgenomic: 26,733
Reverse (733,23)CACATGCAATTCTTCTCCAGTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGC
AACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACA
GTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATG
AGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCA
ATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)291443 - 733
Exon 3 To Exon 4 (Pair 36)
Forward (443,22)CTTTCAGTGCTACCTTCATCTCAmplicon SizecDNA: 180 bpgenomic: 25,793
Reverse (622,23)CATCATCAGTGCTTTCTTTAGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.941 kcal/mol
Reverse Dimers-0.959 kcal/mol
Forward-Reverse Dimers-1.355 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGC
AACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACA
GTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)180443 - 622
Exon 3 To Exon 4 (Pair 37)
Forward (443,22)CTTTCAGTGCTACCTTCATCTCAmplicon SizecDNA: 160 bpgenomic: 25,773
Reverse (602,21)GACTGTCTCGGACTGTAACTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops0.61 kcal/mol
Reverse Dimers-1.004 kcal/mol
Forward-Reverse Dimers-1.83 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGC
AACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACA
GTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)160443 - 602
Exon 3 To Exon 5 (Pair 23)
Forward (443,22)CTTTCAGTGCTACCTTCATCTCAmplicon SizecDNA: 279 bpgenomic: 26,721
Reverse (721,23)TTCTCCAGTAAGCCAGGAAATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.296 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-2.445 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGC
AACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACA
GTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATG
AGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCA
ATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)279443 - 721
Exon 3 To Exon 5 (Pair 24)
Forward (437,22)TCTAGCCTTTCAGTGCTACCTTAmplicon SizecDNA: 301 bpgenomic: 26,743
Reverse (737,22)CTTCCACATGCAATTCTTCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.874 kcal/mol
Forward Dimers-1.01 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCA
CGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAG
AGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTG
ATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAG
AAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGAA
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)301437 - 737
Exon 3 To Exon 5 (Pair 25)
Forward (442,22)CCTTTCAGTGCTACCTTCATCTAmplicon SizecDNA: 296 bpgenomic: 26,738
Reverse (737,22)CTTCCACATGCAATTCTTCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAG
CAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGAC
AGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGAT
GAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACC
AATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)296442 - 737
Exon 3 To Exon 4 (Pair 38)
Forward (443,22)CTTTCAGTGCTACCTTCATCTCAmplicon SizecDNA: 159 bpgenomic: 25,772
Reverse (601,21)ACTGTCTCGGACTGTAACTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.173 kcal/mol
Reverse Dimers-0.87 kcal/mol
Forward-Reverse Dimers-1.83 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGC
AACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACA
GTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)159443 - 601
Exon 3 To Exon 4 (Pair 39)
Forward (311,22)GAATACACCAGCAAGCTAGATGAmplicon SizecDNA: 292 bpgenomic: 25,905
Reverse (602,21)GACTGTCTCGGACTGTAACTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.426 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops0.61 kcal/mol
Reverse Dimers-1.004 kcal/mol
Forward-Reverse Dimers-1.072 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceGAATACACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTGGAATCTCTG
GGGAACGGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTTACATCTTCT
TCCTCTTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGAT
GTGGCACGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAAC
AAACAGAGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)292311 - 602
Exon 3 To Exon 5 (Pair 26)
Forward (442,22)CCTTTCAGTGCTACCTTCATCTAmplicon SizecDNA: 269 bpgenomic: 26,711
Reverse (710,21)GCCAGGAAATATCAGTGTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.721 kcal/mol in 3' area
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-2.445 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAG
CAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGAC
AGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGAT
GAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACC
AATTGGTTGGGACACTGATATTTCCTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)269442 - 710
Exon 3 To Exon 4 (Pair 40)
Forward (439,22)TAGCCTTTCAGTGCTACCTTCAAmplicon SizecDNA: 184 bpgenomic: 25,797
Reverse (622,23)CATCATCAGTGCTTTCTTTAGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.874 kcal/mol
Forward Dimers-1.01 kcal/mol
Reverse Loops1.941 kcal/mol
Reverse Dimers-0.959 kcal/mol
Forward-Reverse Dimers-1.532 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACG
GAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAG
GACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGAT
GATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)184439 - 622
Exon 3 To Exon 4 (Pair 41)
Forward (317,21)ACCAGCAAGCTAGATGCACTCAmplicon SizecDNA: 285 bpgenomic: 25,898
Reverse (601,21)ACTGTCTCGGACTGTAACTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.586 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.173 kcal/mol
Reverse Dimers-0.87 kcal/mol
Forward-Reverse Dimers-1.072 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTGGAATCTCTGGGGAAC
GGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTTACATCTTCTTCCTCT
TCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCA
CGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAG
AGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)285317 - 601
Exon 3 To Exon 5 (Pair 27)
Forward (443,22)CTTTCAGTGCTACCTTCATCTCAmplicon SizecDNA: 298 bpgenomic: 26,740
Reverse (740,23)ACACTTCCACATGCAATTCTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-2.269 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGC
AACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACA
GTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATG
AGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCA
ATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGAAGTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)298443 - 740
Exon 3 To Exon 5 (Pair 28)
Forward (440,22)AGCCTTTCAGTGCTACCTTCATAmplicon SizecDNA: 293 bpgenomic: 26,735
Reverse (732,23)ACATGCAATTCTTCTCCAGTAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.104 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGG
AGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGG
ACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATG
ATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAA
CCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)293440 - 732
Exon 3 To Exon 4 (Pair 42)
Forward (439,22)TAGCCTTTCAGTGCTACCTTCAAmplicon SizecDNA: 194 bpgenomic: 25,807
Reverse (632,22)TTAGACCTCTCATCATCAGTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.874 kcal/mol
Forward Dimers-1.01 kcal/mol
Reverse Loops1.53 kcal/mol
Reverse Dimers-0.167 kcal/mol
Forward-Reverse Dimers-0.629 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACG
GAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAG
GACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGAT
GATGAGAGGTCTAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)194439 - 632
Exon 3 To Exon 5 (Pair 29)
Forward (442,22)CCTTTCAGTGCTACCTTCATCTAmplicon SizecDNA: 300 bpgenomic: 26,742
Reverse (741,23)AACACTTCCACATGCAATTCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-2.269 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAG
CAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGAC
AGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGAT
GAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACC
AATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGAAGTGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)300442 - 741
Exon 3 To Exon 4 (Pair 43)
Forward (443,22)CTTTCAGTGCTACCTTCATCTCAmplicon SizecDNA: 196 bpgenomic: 25,809
Reverse (638,22)CTGGGATTAGACCTCTCATCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.53 kcal/mol
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-1.062 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGC
AACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACA
GTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATG
AGAGGTCTAATCCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)196443 - 638
Exon 3 To Exon 5 (Pair 30)
Forward (440,22)AGCCTTTCAGTGCTACCTTCATAmplicon SizecDNA: 294 bpgenomic: 26,736
Reverse (733,23)CACATGCAATTCTTCTCCAGTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.104 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGG
AGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGG
ACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATG
ATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAA
CCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)294440 - 733
Exon 3 To Exon 4 (Pair 44)
Forward (444,23)TTTCAGTGCTACCTTCATCTCTTAmplicon SizecDNA: 156 bpgenomic: 25,769
Reverse (599,21)TGTCTCGGACTGTAACTCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.613 kcal/mol
Reverse Dimers-0.87 kcal/mol
Forward-Reverse Dimers-1.83 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGCA
ACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACAG
TGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)156444 - 599
Exon 3 To Exon 5 (Pair 31)
Forward (442,22)CCTTTCAGTGCTACCTTCATCTAmplicon SizecDNA: 294 bpgenomic: 26,736
Reverse (735,22)TCCACATGCAATTCTTCTCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAG
CAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGAC
AGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGAT
GAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACC
AATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)294442 - 735
Exon 3 To Exon 4 (Pair 45)
Forward (316,21)CACCAGCAAGCTAGATGCACTAmplicon SizecDNA: 284 bpgenomic: 25,897
Reverse (599,21)TGTCTCGGACTGTAACTCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.586 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.613 kcal/mol
Reverse Dimers-0.87 kcal/mol
Forward-Reverse Dimers-1.072 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceCACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTGGAATCTCTGGGGAA
CGGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTTACATCTTCTTCCTC
TTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGC
ACGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACA
GAGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)284316 - 599
Exon 3 To Exon 5 (Pair 32)
Forward (439,22)TAGCCTTTCAGTGCTACCTTCAAmplicon SizecDNA: 299 bpgenomic: 26,741
Reverse (737,22)CTTCCACATGCAATTCTTCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.874 kcal/mol
Forward Dimers-1.01 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACG
GAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAG
GACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGAT
GATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAA
ACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)299439 - 737
Exon 3 To Exon 4 (Pair 46)
Forward (443,22)CTTTCAGTGCTACCTTCATCTCAmplicon SizecDNA: 158 bpgenomic: 25,771
Reverse (600,21)CTGTCTCGGACTGTAACTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.613 kcal/mol
Reverse Dimers-0.87 kcal/mol
Forward-Reverse Dimers-1.83 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGC
AACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACA
GTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)158443 - 600
Exon 3 To Exon 5 (Pair 33)
Forward (443,22)CTTTCAGTGCTACCTTCATCTCAmplicon SizecDNA: 292 bpgenomic: 26,734
Reverse (734,22)CCACATGCAATTCTTCTCCAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGC
AACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACA
GTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATG
AGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCA
ATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)292443 - 734
Exon 3 To Exon 4 (Pair 47)
Forward (317,21)ACCAGCAAGCTAGATGCACTCAmplicon SizecDNA: 284 bpgenomic: 25,897
Reverse (600,21)CTGTCTCGGACTGTAACTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.586 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.613 kcal/mol
Reverse Dimers-0.87 kcal/mol
Forward-Reverse Dimers-1.072 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTGGAATCTCTGGGGAAC
GGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTTACATCTTCTTCCTCT
TCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCA
CGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAG
AGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)284317 - 600
Exon 3 To Exon 4 (Pair 48)
Forward (440,22)AGCCTTTCAGTGCTACCTTCATAmplicon SizecDNA: 161 bpgenomic: 25,774
Reverse (600,21)CTGTCTCGGACTGTAACTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.104 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.613 kcal/mol
Reverse Dimers-0.87 kcal/mol
Forward-Reverse Dimers-1.83 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGG
AGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGG
ACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)161440 - 600
Exon 3 To Exon 4 (Pair 49)
Forward (442,22)CCTTTCAGTGCTACCTTCATCTAmplicon SizecDNA: 160 bpgenomic: 25,773
Reverse (601,21)ACTGTCTCGGACTGTAACTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.173 kcal/mol
Reverse Dimers-0.87 kcal/mol
Forward-Reverse Dimers-1.83 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAG
CAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGAC
AGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)160442 - 601
Exon 3 To Exon 4 (Pair 50)
Forward (311,22)GAATACACCAGCAAGCTAGATGAmplicon SizecDNA: 290 bpgenomic: 25,903
Reverse (600,21)CTGTCTCGGACTGTAACTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.426 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.613 kcal/mol
Reverse Dimers-0.87 kcal/mol
Forward-Reverse Dimers-1.072 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceGAATACACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTGGAATCTCTG
GGGAACGGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTTACATCTTCT
TCCTCTTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGAT
GTGGCACGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAAC
AAACAGAGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)290311 - 600
Exon 3 To Exon 4 (Pair 51)
Forward (311,22)GAATACACCAGCAAGCTAGATGAmplicon SizecDNA: 291 bpgenomic: 25,904
Reverse (601,21)ACTGTCTCGGACTGTAACTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.426 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.173 kcal/mol
Reverse Dimers-0.87 kcal/mol
Forward-Reverse Dimers-1.072 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceGAATACACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTGGAATCTCTG
GGGAACGGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTTACATCTTCT
TCCTCTTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGAT
GTGGCACGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAAC
AAACAGAGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)291311 - 601
Exon 3 To Exon 5 (Pair 34)
Forward (442,22)CCTTTCAGTGCTACCTTCATCTAmplicon SizecDNA: 271 bpgenomic: 26,713
Reverse (712,22)AAGCCAGGAAATATCAGTGTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.787 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-2.445 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAG
CAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGAC
AGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGAT
GAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACC
AATTGGTTGGGACACTGATATTTCCTGGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)271442 - 712
Exon 3 To Exon 5 (Pair 35)
Forward (443,22)CTTTCAGTGCTACCTTCATCTCAmplicon SizecDNA: 300 bpgenomic: 26,742
Reverse (742,23)CAACACTTCCACATGCAATTCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.195 kcal/mol in 3' area
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-2.269 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGC
AACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACA
GTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATG
AGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCA
ATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGAAGTGTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)300443 - 742
Exon 3 To Exon 4 (Pair 52)
Forward (312,22)AATACACCAGCAAGCTAGATGCAmplicon SizecDNA: 291 bpgenomic: 25,904
Reverse (602,21)GACTGTCTCGGACTGTAACTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.008 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.61 kcal/mol
Reverse Dimers-1.004 kcal/mol
Forward-Reverse Dimers-1.072 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceAATACACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTGGAATCTCTGG
GGAACGGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTTACATCTTCTT
CCTCTTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATG
TGGCACGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACA
AACAGAGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)291312 - 602
Exon 3 To Exon 4 (Pair 53)
Forward (437,22)TCTAGCCTTTCAGTGCTACCTTAmplicon SizecDNA: 166 bpgenomic: 25,779
Reverse (602,21)GACTGTCTCGGACTGTAACTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.874 kcal/mol
Forward Dimers-1.01 kcal/mol
Reverse Loops0.61 kcal/mol
Reverse Dimers-1.004 kcal/mol
Forward-Reverse Dimers-1.83 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCA
CGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAG
AGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)166437 - 602
Exon 3 To Exon 5 (Pair 36)
Forward (437,22)TCTAGCCTTTCAGTGCTACCTTAmplicon SizecDNA: 299 bpgenomic: 26,741
Reverse (735,22)TCCACATGCAATTCTTCTCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.874 kcal/mol
Forward Dimers-1.01 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCA
CGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAG
AGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTG
ATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAG
AAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)299437 - 735
Exon 3 To Exon 4 (Pair 54)
Forward (444,23)TTTCAGTGCTACCTTCATCTCTTAmplicon SizecDNA: 194 bpgenomic: 25,807
Reverse (637,22)TGGGATTAGACCTCTCATCATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.53 kcal/mol
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-1.062 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGCA
ACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACAG
TGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATGA
GAGGTCTAATCCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)194444 - 637
Exon 3 To Exon 5 (Pair 37)
Forward (442,22)CCTTTCAGTGCTACCTTCATCTAmplicon SizecDNA: 292 bpgenomic: 26,734
Reverse (733,23)CACATGCAATTCTTCTCCAGTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAG
CAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGAC
AGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGAT
GAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACC
AATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)292442 - 733
Exon 3 To Exon 4 (Pair 55)
Forward (440,22)AGCCTTTCAGTGCTACCTTCATAmplicon SizecDNA: 160 bpgenomic: 25,773
Reverse (599,21)TGTCTCGGACTGTAACTCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.104 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.613 kcal/mol
Reverse Dimers-0.87 kcal/mol
Forward-Reverse Dimers-1.83 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGG
AGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGG
ACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)160440 - 599
Exon 3 To Exon 5 (Pair 38)
Forward (444,23)TTTCAGTGCTACCTTCATCTCTTAmplicon SizecDNA: 294 bpgenomic: 26,736
Reverse (737,22)CTTCCACATGCAATTCTTCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGCA
ACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACAG
TGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATGA
GAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAA
TTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)294444 - 737
Exon 3 To Exon 5 (Pair 39)
Forward (442,22)CCTTTCAGTGCTACCTTCATCTAmplicon SizecDNA: 301 bpgenomic: 26,743
Reverse (742,23)CAACACTTCCACATGCAATTCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.195 kcal/mol in 3' area
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-2.269 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAG
CAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGAC
AGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGAT
GAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACC
AATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGAAGTGTT
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)301442 - 742
Exon 3 To Exon 4 (Pair 56)
Forward (315,21)ACACCAGCAAGCTAGATGCACAmplicon SizecDNA: 288 bpgenomic: 25,901
Reverse (602,21)GACTGTCTCGGACTGTAACTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.586 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.61 kcal/mol
Reverse Dimers-1.004 kcal/mol
Forward-Reverse Dimers-1.072 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceACACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTGGAATCTCTGGGGA
ACGGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTTACATCTTCTTCCT
CTTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGG
CACGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAAC
AGAGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)288315 - 602
Exon 3 To Exon 5 (Pair 40)
Forward (442,22)CCTTTCAGTGCTACCTTCATCTAmplicon SizecDNA: 293 bpgenomic: 26,735
Reverse (734,22)CCACATGCAATTCTTCTCCAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.996 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAG
CAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGAC
AGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGAT
GAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACC
AATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)293442 - 734
Exon 3 To Exon 5 (Pair 41)
Forward (440,22)AGCCTTTCAGTGCTACCTTCATAmplicon SizecDNA: 295 bpgenomic: 26,737
Reverse (734,22)CCACATGCAATTCTTCTCCAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.104 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGG
AGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGG
ACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATG
ATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAA
CCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)295440 - 734
Exon 3 To Exon 4 (Pair 57)
Forward (437,22)TCTAGCCTTTCAGTGCTACCTTAmplicon SizecDNA: 163 bpgenomic: 25,776
Reverse (599,21)TGTCTCGGACTGTAACTCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.874 kcal/mol
Forward Dimers-1.01 kcal/mol
Reverse Loops1.613 kcal/mol
Reverse Dimers-0.87 kcal/mol
Forward-Reverse Dimers-1.83 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCA
CGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAG
AGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 58)
Forward (440,22)AGCCTTTCAGTGCTACCTTCATAmplicon SizecDNA: 183 bpgenomic: 25,796
Reverse (622,23)CATCATCAGTGCTTTCTTTAGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.104 kcal/mol
Forward Dimers-0.833 kcal/mol
Reverse Loops1.941 kcal/mol
Reverse Dimers-0.959 kcal/mol
Forward-Reverse Dimers-1.355 kcal/mol
Amplicon Folding-1.455 kcal/mol outside primersite
Amplicon SequenceAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGG
AGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGG
ACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATG
ATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)183440 - 622
Exon 3 To Exon 5 (Pair 42)
Forward (439,22)TAGCCTTTCAGTGCTACCTTCAAmplicon SizecDNA: 296 bpgenomic: 26,738
Reverse (734,22)CCACATGCAATTCTTCTCCAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.874 kcal/mol
Forward Dimers-1.01 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.511 kcal/mol outside primersite
Amplicon SequenceTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACG
GAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAG
GACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGAT
GATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAA
ACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)296439 - 734
 

See below for some more details.

Program Output:

Loading ...