Design Results for BSPRY

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 3 To Exon 5 (Pair 4)
Forward (511,21)CAGAAACTTGACACCATCCGCAmplicon SizecDNA: 189 bpgenomic: 7,684
Reverse (699,20)GAGTTGGGTCAGTAGTGGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.828 kcal/mol
Forward Dimers-0.646 kcal/mol
Reverse Loops2.061 kcal/mol in 3' area
Reverse Dimers0.332 kcal/mol in 3' area
Forward-Reverse Dimers-2.213 kcal/mol
Amplicon Folding-1.517 kcal/mol outside primersite
Amplicon SequenceCAGAAACTTGACACCATCCGCACTGGCCTGGTGGGCATGCTTACTCACCTGGATGACCTC
CAGCTGATTCAGAAGGAGCAAGAGATTTTCGAGAGGACCGAAGAAGCAGAGGGCATTTTG
GATCCCCAGGAGTCGGAAATGTTAAACTTTAATGAGAAGTGCACTCGGAGCCCACTACTG
ACCCAACTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017688 (BSPRY)189511 - 699
Exon 3 To Exon 5 (Pair 3)
Forward (510,21)GCAGAAACTTGACACCATCCGAmplicon SizecDNA: 190 bpgenomic: 7,685
Reverse (699,20)GAGTTGGGTCAGTAGTGGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.828 kcal/mol
Forward Dimers-0.646 kcal/mol
Reverse Loops2.061 kcal/mol in 3' area
Reverse Dimers0.332 kcal/mol in 3' area
Forward-Reverse Dimers-2.213 kcal/mol
Amplicon Folding-1.517 kcal/mol outside primersite
Amplicon SequenceGCAGAAACTTGACACCATCCGCACTGGCCTGGTGGGCATGCTTACTCACCTGGATGACCT
CCAGCTGATTCAGAAGGAGCAAGAGATTTTCGAGAGGACCGAAGAAGCAGAGGGCATTTT
GGATCCCCAGGAGTCGGAAATGTTAAACTTTAATGAGAAGTGCACTCGGAGCCCACTACT
GACCCAACTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017688 (BSPRY)190510 - 699
Exon 3 To Exon 5 (Pair 2)
Forward (510,21)GCAGAAACTTGACACCATCCGAmplicon SizecDNA: 148 bpgenomic: 7,643
Reverse (657,22)GTTTAACATTTCCGACTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.828 kcal/mol
Forward Dimers-0.646 kcal/mol
Reverse Loops1.527 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.517 kcal/mol outside primersite
Amplicon SequenceGCAGAAACTTGACACCATCCGCACTGGCCTGGTGGGCATGCTTACTCACCTGGATGACCT
CCAGCTGATTCAGAAGGAGCAAGAGATTTTCGAGAGGACCGAAGAAGCAGAGGGCATTTT
GGATCCCCAGGAGTCGGAAATGTTAAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017688 (BSPRY)148510 - 657
Exon 3 To Exon 5 (Pair 1)
Forward (510,21)GCAGAAACTTGACACCATCCGAmplicon SizecDNA: 119 bpgenomic: 7,614
Reverse (628,21)AAATGCCCTCTGCTTCTTCGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.828 kcal/mol
Forward Dimers-0.646 kcal/mol
Reverse Loops0.913 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.45 kcal/mol
Amplicon Folding-1.517 kcal/mol outside primersite
Amplicon SequenceGCAGAAACTTGACACCATCCGCACTGGCCTGGTGGGCATGCTTACTCACCTGGATGACCT
CCAGCTGATTCAGAAGGAGCAAGAGATTTTCGAGAGGACCGAAGAAGCAGAGGGCATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017688 (BSPRY)119510 - 628
Exon 3 To Exon 5 (Pair 5)
Forward (511,21)CAGAAACTTGACACCATCCGCAmplicon SizecDNA: 147 bpgenomic: 7,642
Reverse (657,22)GTTTAACATTTCCGACTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.828 kcal/mol
Forward Dimers-0.646 kcal/mol
Reverse Loops1.527 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.517 kcal/mol outside primersite
Amplicon SequenceCAGAAACTTGACACCATCCGCACTGGCCTGGTGGGCATGCTTACTCACCTGGATGACCTC
CAGCTGATTCAGAAGGAGCAAGAGATTTTCGAGAGGACCGAAGAAGCAGAGGGCATTTTG
GATCCCCAGGAGTCGGAAATGTTAAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017688 (BSPRY)147511 - 657
Exon 3 To Exon 5 (Pair 4)
Forward (511,21)CAGAAACTTGACACCATCCGCAmplicon SizecDNA: 189 bpgenomic: 7,684
Reverse (699,20)GAGTTGGGTCAGTAGTGGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.828 kcal/mol
Forward Dimers-0.646 kcal/mol
Reverse Loops2.061 kcal/mol in 3' area
Reverse Dimers0.332 kcal/mol in 3' area
Forward-Reverse Dimers-2.213 kcal/mol
Amplicon Folding-1.517 kcal/mol outside primersite
Amplicon SequenceCAGAAACTTGACACCATCCGCACTGGCCTGGTGGGCATGCTTACTCACCTGGATGACCTC
CAGCTGATTCAGAAGGAGCAAGAGATTTTCGAGAGGACCGAAGAAGCAGAGGGCATTTTG
GATCCCCAGGAGTCGGAAATGTTAAACTTTAATGAGAAGTGCACTCGGAGCCCACTACTG
ACCCAACTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017688 (BSPRY)189511 - 699
Exon 3 To Exon 5 (Pair 3)
Forward (510,21)GCAGAAACTTGACACCATCCGAmplicon SizecDNA: 190 bpgenomic: 7,685
Reverse (699,20)GAGTTGGGTCAGTAGTGGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.828 kcal/mol
Forward Dimers-0.646 kcal/mol
Reverse Loops2.061 kcal/mol in 3' area
Reverse Dimers0.332 kcal/mol in 3' area
Forward-Reverse Dimers-2.213 kcal/mol
Amplicon Folding-1.517 kcal/mol outside primersite
Amplicon SequenceGCAGAAACTTGACACCATCCGCACTGGCCTGGTGGGCATGCTTACTCACCTGGATGACCT
CCAGCTGATTCAGAAGGAGCAAGAGATTTTCGAGAGGACCGAAGAAGCAGAGGGCATTTT
GGATCCCCAGGAGTCGGAAATGTTAAACTTTAATGAGAAGTGCACTCGGAGCCCACTACT
GACCCAACTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017688 (BSPRY)190510 - 699
Exon 3 To Exon 5 (Pair 2)
Forward (510,21)GCAGAAACTTGACACCATCCGAmplicon SizecDNA: 148 bpgenomic: 7,643
Reverse (657,22)GTTTAACATTTCCGACTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.828 kcal/mol
Forward Dimers-0.646 kcal/mol
Reverse Loops1.527 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.517 kcal/mol outside primersite
Amplicon SequenceGCAGAAACTTGACACCATCCGCACTGGCCTGGTGGGCATGCTTACTCACCTGGATGACCT
CCAGCTGATTCAGAAGGAGCAAGAGATTTTCGAGAGGACCGAAGAAGCAGAGGGCATTTT
GGATCCCCAGGAGTCGGAAATGTTAAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017688 (BSPRY)148510 - 657
Exon 3 To Exon 5 (Pair 1)
Forward (510,21)GCAGAAACTTGACACCATCCGAmplicon SizecDNA: 119 bpgenomic: 7,614
Reverse (628,21)AAATGCCCTCTGCTTCTTCGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.828 kcal/mol
Forward Dimers-0.646 kcal/mol
Reverse Loops0.913 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.45 kcal/mol
Amplicon Folding-1.517 kcal/mol outside primersite
Amplicon SequenceGCAGAAACTTGACACCATCCGCACTGGCCTGGTGGGCATGCTTACTCACCTGGATGACCT
CCAGCTGATTCAGAAGGAGCAAGAGATTTTCGAGAGGACCGAAGAAGCAGAGGGCATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017688 (BSPRY)119510 - 628
Exon 3 To Exon 5 (Pair 5)
Forward (511,21)CAGAAACTTGACACCATCCGCAmplicon SizecDNA: 147 bpgenomic: 7,642
Reverse (657,22)GTTTAACATTTCCGACTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.828 kcal/mol
Forward Dimers-0.646 kcal/mol
Reverse Loops1.527 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.517 kcal/mol outside primersite
Amplicon SequenceCAGAAACTTGACACCATCCGCACTGGCCTGGTGGGCATGCTTACTCACCTGGATGACCTC
CAGCTGATTCAGAAGGAGCAAGAGATTTTCGAGAGGACCGAAGAAGCAGAGGGCATTTTG
GATCCCCAGGAGTCGGAAATGTTAAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_017688 (BSPRY)147511 - 657
 

See below for some more details.

Program Output:

Loading ...