Design Results for CAMKMT

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 4 (Pair 1)
Forward (321,22)GTAACAGAAGGCAAAGAAAGGGAmplicon SizecDNA: 209 bpgenomic: 331,538
Reverse (529,22)TTGTGCTTGAGGCAGTAGTAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops3.395 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops0.387 kcal/mol
Reverse Dimers-0.616 kcal/mol
Forward-Reverse Dimers-1.34 kcal/mol
Amplicon Folding0.209 kcal/mol inside primersite
Amplicon SequenceGTAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACA
AGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTT
GAAGATGTCCTTACCAGCTTTGACAATACAGGAAATGTTTGCATCTGGCCATCTGAAGAG
GTTTTGGCTTACTACTGCCTCAAGCACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)209321 - 529
Exon 2 To Exon 4 (Pair 2)
Forward (322,23)TAACAGAAGGCAAAGAAAGGGAAAmplicon SizecDNA: 211 bpgenomic: 331,540
Reverse (532,23)TTATTGTGCTTGAGGCAGTAGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops0.387 kcal/mol
Reverse Dimers-0.616 kcal/mol
Forward-Reverse Dimers-1.34 kcal/mol
Amplicon Folding0.209 kcal/mol inside primersite
Amplicon SequenceTAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAA
GCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTG
AAGATGTCCTTACCAGCTTTGACAATACAGGAAATGTTTGCATCTGGCCATCTGAAGAGG
TTTTGGCTTACTACTGCCTCAAGCACAATAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)211322 - 532
Exon 2 To Exon 5 (Pair 1)
Forward (359,22)TGGTGCATGGGTCCAATATACAAmplicon SizecDNA: 204 bpgenomic: 333,476
Reverse (562,20)AGCTCACACACAGCAAGGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol
Forward Dimers-2.116 kcal/mol
Reverse Loops1.053 kcal/mol in 3' area
Reverse Dimers-1.83 kcal/mol
Forward-Reverse Dimers-1.628 kcal/mol
Amplicon Folding0.209 kcal/mol outside primersite
Amplicon SequenceTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCA
TAATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCAGCTTTGACAATACAGGAAATGT
TTGCATCTGGCCATCTGAAGAGGTTTTGGCTTACTACTGCCTCAAGCACAATAATATATT
CAGGGCCCTTGCTGTGTGTGAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)204359 - 562
Exon 2 To Exon 3 (Pair 1)
Forward (365,23)ATGGGTCCAATATACAAGCATCTAmplicon SizecDNA: 97 bpgenomic: 17,449
Reverse (461,23)AAAGCTGGTAAGGACATCTTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.841 kcal/mol
Forward Dimers-2.116 kcal/mol
Reverse Loops0.914 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.337 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAG
TGGATCCTTGAATGTTGAAGATGTCCTTACCAGCTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)97365 - 461
Exon 2 To Exon 5 (Pair 2)
Forward (316,24)TTTCAGTAACAGAAGGCAAAGAAAAmplicon SizecDNA: 247 bpgenomic: 333,519
Reverse (562,20)AGCTCACACACAGCAAGGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.382 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops1.053 kcal/mol in 3' area
Reverse Dimers-1.83 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding0.209 kcal/mol outside primersite
Amplicon SequenceTTTCAGTAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAAT
ATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGA
ATGTTGAAGATGTCCTTACCAGCTTTGACAATACAGGAAATGTTTGCATCTGGCCATCTG
AAGAGGTTTTGGCTTACTACTGCCTCAAGCACAATAATATATTCAGGGCCCTTGCTGTGT
GTGAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)247316 - 562
Exon 2 To Exon 3 (Pair 2)
Forward (321,22)GTAACAGAAGGCAAAGAAAGGGAmplicon SizecDNA: 147 bpgenomic: 17,499
Reverse (467,23)ATTGTCAAAGCTGGTAAGGACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops3.395 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops1.4 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.828 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceGTAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACA
AGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTT
GAAGATGTCCTTACCAGCTTTGACAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)147321 - 467
Exon 2 To Exon 4 (Pair 3)
Forward (325,22)CAGAAGGCAAAGAAAGGGAAACAmplicon SizecDNA: 214 bpgenomic: 331,543
Reverse (538,24)AATATATTATTGTGCTTGAGGCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops0.387 kcal/mol in 3' area
Reverse Dimers-0.956 kcal/mol
Forward-Reverse Dimers-1.34 kcal/mol
Amplicon Folding0.209 kcal/mol inside primersite
Amplicon SequenceCAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAAGCA
TCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTGAAG
ATGTCCTTACCAGCTTTGACAATACAGGAAATGTTTGCATCTGGCCATCTGAAGAGGTTT
TGGCTTACTACTGCCTCAAGCACAATAATATATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)214325 - 538
Exon 2 To Exon 3 (Pair 3)
Forward (357,22)GTTGGTGCATGGGTCCAATATAAmplicon SizecDNA: 124 bpgenomic: 17,476
Reverse (480,24)AAACATTTCCTGTATTGTCAAAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.327 kcal/mol in 3' area
Forward Dimers-2.116 kcal/mol
Reverse Loops0.573 kcal/mol
Reverse Dimers-0.554 kcal/mol
Forward-Reverse Dimers-0.953 kcal/mol
Amplicon Folding0.492 kcal/mol inside primersite
Amplicon SequenceGTTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGG
CATAATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCAGCTTTGACAATACAGGAAAT
GTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)124357 - 480
Exon 2 To Exon 3 (Pair 4)
Forward (380,23)AAGCATCTTCTGTCCTGAATACAAmplicon SizecDNA: 94 bpgenomic: 17,446
Reverse (473,23)TCCTGTATTGTCAAAGCTGGTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.761 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.138 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGT
TGAAGATGTCCTTACCAGCTTTGACAATACAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)94380 - 473
Exon 2 To Exon 3 (Pair 5)
Forward (321,22)GTAACAGAAGGCAAAGAAAGGGAmplicon SizecDNA: 160 bpgenomic: 17,512
Reverse (480,24)AAACATTTCCTGTATTGTCAAAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops3.395 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops0.573 kcal/mol
Reverse Dimers-0.554 kcal/mol
Forward-Reverse Dimers-2.542 kcal/mol
Amplicon Folding0.492 kcal/mol inside primersite
Amplicon SequenceGTAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACA
AGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTT
GAAGATGTCCTTACCAGCTTTGACAATACAGGAAATGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)160321 - 480
Exon 2 To Exon 3 (Pair 6)
Forward (352,20)AGGAGGTTGGTGCATGGGTCAmplicon SizecDNA: 117 bpgenomic: 17,469
Reverse (468,23)TATTGTCAAAGCTGGTAAGGACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.385 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol
Reverse Loops1.4 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.751 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceAGGAGGTTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCT
TAAGGCATAATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCAGCTTTGACAATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)117352 - 468
Exon 2 To Exon 5 (Pair 3)
Forward (368,23)GGTCCAATATACAAGCATCTTCTAmplicon SizecDNA: 229 bpgenomic: 333,501
Reverse (596,20)CATGAGCCCAGCCAAGCATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.379 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.375 kcal/mol in 3' area
Reverse Dimers-1.208 kcal/mol
Forward-Reverse Dimers-1.438 kcal/mol
Amplicon Folding-1.016 kcal/mol outside primersite
Amplicon SequenceGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGG
ATCCTTGAATGTTGAAGATGTCCTTACCAGCTTTGACAATACAGGAAATGTTTGCATCTG
GCCATCTGAAGAGGTTTTGGCTTACTACTGCCTCAAGCACAATAATATATTCAGGGCCCT
TGCTGTGTGTGAGCTAGGGGGTGGCATGACATGCTTGGCTGGGCTCATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)229368 - 596
Exon 2 To Exon 5 (Pair 4)
Forward (372,23)CAATATACAAGCATCTTCTGTCCAmplicon SizecDNA: 191 bpgenomic: 333,463
Reverse (562,20)AGCTCACACACAGCAAGGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.379 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.053 kcal/mol in 3' area
Reverse Dimers-1.83 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding0.209 kcal/mol outside primersite
Amplicon SequenceCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCC
TTGAATGTTGAAGATGTCCTTACCAGCTTTGACAATACAGGAAATGTTTGCATCTGGCCA
TCTGAAGAGGTTTTGGCTTACTACTGCCTCAAGCACAATAATATATTCAGGGCCCTTGCT
GTGTGTGAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)191372 - 562
Exon 2 To Exon 3 (Pair 7)
Forward (365,23)ATGGGTCCAATATACAAGCATCTAmplicon SizecDNA: 95 bpgenomic: 17,447
Reverse (459,22)AGCTGGTAAGGACATCTTCAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.841 kcal/mol
Forward Dimers-2.116 kcal/mol
Reverse Loops0.914 kcal/mol in 3' area
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers-2.337 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAG
TGGATCCTTGAATGTTGAAGATGTCCTTACCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)95365 - 459
Exon 2 To Exon 5 (Pair 5)
Forward (357,22)GTTGGTGCATGGGTCCAATATAAmplicon SizecDNA: 206 bpgenomic: 333,478
Reverse (562,20)AGCTCACACACAGCAAGGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.327 kcal/mol in 3' area
Forward Dimers-2.116 kcal/mol
Reverse Loops1.053 kcal/mol in 3' area
Reverse Dimers-1.83 kcal/mol
Forward-Reverse Dimers-1.628 kcal/mol
Amplicon Folding0.209 kcal/mol outside primersite
Amplicon SequenceGTTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGG
CATAATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCAGCTTTGACAATACAGGAAAT
GTTTGCATCTGGCCATCTGAAGAGGTTTTGGCTTACTACTGCCTCAAGCACAATAATATA
TTCAGGGCCCTTGCTGTGTGTGAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)206357 - 562
Exon 2 To Exon 3 (Pair 8)
Forward (358,22)TTGGTGCATGGGTCCAATATACAmplicon SizecDNA: 104 bpgenomic: 17,456
Reverse (461,23)AAAGCTGGTAAGGACATCTTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.327 kcal/mol
Forward Dimers-2.116 kcal/mol
Reverse Loops0.914 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.337 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceTTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGC
ATAATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCAGCTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)104358 - 461
Exon 2 To Exon 6 (Pair 1)
Forward (380,23)AAGCATCTTCTGTCCTGAATACAAmplicon SizecDNA: 255 bpgenomic: 334,584
Reverse (634,24)GTTAACAGAACTTCTTTGACATCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.761 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.064 kcal/mol
Reverse Dimers-0.992 kcal/mol
Forward-Reverse Dimers-2.912 kcal/mol
Amplicon Folding-1.016 kcal/mol outside primersite
Amplicon SequenceAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGT
TGAAGATGTCCTTACCAGCTTTGACAATACAGGAAATGTTTGCATCTGGCCATCTGAAGA
GGTTTTGGCTTACTACTGCCTCAAGCACAATAATATATTCAGGGCCCTTGCTGTGTGTGA
GCTAGGGGGTGGCATGACATGCTTGGCTGGGCTCATGGTTGCTATTTCTGCAGATGTCAA
AGAAGTTCTGTTAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)255380 - 634
Exon 2 To Exon 4 (Pair 4)
Forward (337,22)AAAGGGAAACTGAAGAGGAGGTAmplicon SizecDNA: 204 bpgenomic: 331,533
Reverse (540,24)TGAATATATTATTGTGCTTGAGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.966 kcal/mol
Forward Dimers-0.605 kcal/mol
Reverse Loops1.11 kcal/mol in 3' area
Reverse Dimers-1.764 kcal/mol
Forward-Reverse Dimers-1.362 kcal/mol
Amplicon Folding0.209 kcal/mol inside primersite
Amplicon SequenceAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTG
AATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCA
GCTTTGACAATACAGGAAATGTTTGCATCTGGCCATCTGAAGAGGTTTTGGCTTACTACT
GCCTCAAGCACAATAATATATTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)204337 - 540
Exon 2 To Exon 4 (Pair 5)
Forward (325,22)CAGAAGGCAAAGAAAGGGAAACAmplicon SizecDNA: 207 bpgenomic: 331,536
Reverse (531,23)TATTGTGCTTGAGGCAGTAGTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops0.387 kcal/mol
Reverse Dimers-0.616 kcal/mol
Forward-Reverse Dimers-1.34 kcal/mol
Amplicon Folding0.209 kcal/mol inside primersite
Amplicon SequenceCAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAAGCA
TCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTGAAG
ATGTCCTTACCAGCTTTGACAATACAGGAAATGTTTGCATCTGGCCATCTGAAGAGGTTT
TGGCTTACTACTGCCTCAAGCACAATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)207325 - 531
Exon 2 To Exon 5 (Pair 6)
Forward (374,23)ATATACAAGCATCTTCTGTCCTGAmplicon SizecDNA: 223 bpgenomic: 333,495
Reverse (596,20)CATGAGCCCAGCCAAGCATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.379 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.375 kcal/mol in 3' area
Reverse Dimers-1.208 kcal/mol
Forward-Reverse Dimers-1.438 kcal/mol
Amplicon Folding-1.016 kcal/mol outside primersite
Amplicon SequenceATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTT
GAATGTTGAAGATGTCCTTACCAGCTTTGACAATACAGGAAATGTTTGCATCTGGCCATC
TGAAGAGGTTTTGGCTTACTACTGCCTCAAGCACAATAATATATTCAGGGCCCTTGCTGT
GTGTGAGCTAGGGGGTGGCATGACATGCTTGGCTGGGCTCATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)223374 - 596
Exon 2 To Exon 4 (Pair 6)
Forward (337,22)AAAGGGAAACTGAAGAGGAGGTAmplicon SizecDNA: 202 bpgenomic: 331,531
Reverse (538,24)AATATATTATTGTGCTTGAGGCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.966 kcal/mol
Forward Dimers-0.605 kcal/mol
Reverse Loops0.387 kcal/mol in 3' area
Reverse Dimers-0.956 kcal/mol
Forward-Reverse Dimers-1.362 kcal/mol
Amplicon Folding0.209 kcal/mol inside primersite
Amplicon SequenceAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTG
AATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCA
GCTTTGACAATACAGGAAATGTTTGCATCTGGCCATCTGAAGAGGTTTTGGCTTACTACT
GCCTCAAGCACAATAATATATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)202337 - 538
Exon 2 To Exon 3 (Pair 9)
Forward (369,23)GTCCAATATACAAGCATCTTCTGAmplicon SizecDNA: 99 bpgenomic: 17,451
Reverse (467,23)ATTGTCAAAGCTGGTAAGGACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.379 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.4 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGA
TCCTTGAATGTTGAAGATGTCCTTACCAGCTTTGACAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)99369 - 467
Exon 2 To Exon 6 (Pair 2)
Forward (377,23)TACAAGCATCTTCTGTCCTGAATAmplicon SizecDNA: 260 bpgenomic: 334,589
Reverse (636,24)CAGTTAACAGAACTTCTTTGACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.379 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.018 kcal/mol
Reverse Dimers-1.732 kcal/mol
Forward-Reverse Dimers-2.912 kcal/mol
Amplicon Folding-1.016 kcal/mol outside primersite
Amplicon SequenceTACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAA
TGTTGAAGATGTCCTTACCAGCTTTGACAATACAGGAAATGTTTGCATCTGGCCATCTGA
AGAGGTTTTGGCTTACTACTGCCTCAAGCACAATAATATATTCAGGGCCCTTGCTGTGTG
TGAGCTAGGGGGTGGCATGACATGCTTGGCTGGGCTCATGGTTGCTATTTCTGCAGATGT
CAAAGAAGTTCTGTTAACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)260377 - 636
Exon 2 To Exon 3 (Pair 10)
Forward (325,22)CAGAAGGCAAAGAAAGGGAAACAmplicon SizecDNA: 133 bpgenomic: 17,485
Reverse (457,23)CTGGTAAGGACATCTTCAACATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops0.914 kcal/mol
Reverse Dimers-0.158 kcal/mol
Forward-Reverse Dimers-1.492 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceCAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAAGCA
TCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTGAAG
ATGTCCTTACCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)133325 - 457
Exon 2 To Exon 6 (Pair 3)
Forward (359,22)TGGTGCATGGGTCCAATATACAAmplicon SizecDNA: 280 bpgenomic: 334,609
Reverse (638,24)ATCAGTTAACAGAACTTCTTTGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol
Forward Dimers-2.116 kcal/mol
Reverse Loops0.018 kcal/mol
Reverse Dimers-1.732 kcal/mol
Forward-Reverse Dimers-0.662 kcal/mol
Amplicon Folding-1.016 kcal/mol outside primersite
Amplicon SequenceTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCA
TAATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCAGCTTTGACAATACAGGAAATGT
TTGCATCTGGCCATCTGAAGAGGTTTTGGCTTACTACTGCCTCAAGCACAATAATATATT
CAGGGCCCTTGCTGTGTGTGAGCTAGGGGGTGGCATGACATGCTTGGCTGGGCTCATGGT
TGCTATTTCTGCAGATGTCAAAGAAGTTCTGTTAACTGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)280359 - 638
Exon 2 To Exon 3 (Pair 11)
Forward (262,21)TGGATGATTGCCTGCGACATGAmplicon SizecDNA: 197 bpgenomic: 17,549
Reverse (458,22)GCTGGTAAGGACATCTTCAACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.776 kcal/mol in 3' area
Forward Dimers-1.322 kcal/mol
Reverse Loops0.914 kcal/mol
Reverse Dimers-0.158 kcal/mol
Forward-Reverse Dimers-2.235 kcal/mol
Amplicon Folding-0.044 kcal/mol outside primersite
Amplicon SequenceTGGATGATTGCCTGCGACATGTATCTGTAAGAAGATTTGAATCATTTAATCTGTTTTCAG
TAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAA
GCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTG
AAGATGTCCTTACCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)197262 - 458
Exon 2 To Exon 3 (Pair 12)
Forward (372,23)CAATATACAAGCATCTTCTGTCCAmplicon SizecDNA: 109 bpgenomic: 17,461
Reverse (480,24)AAACATTTCCTGTATTGTCAAAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.379 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.573 kcal/mol
Reverse Dimers-0.554 kcal/mol
Forward-Reverse Dimers-1.376 kcal/mol
Amplicon Folding0.492 kcal/mol inside primersite
Amplicon SequenceCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCC
TTGAATGTTGAAGATGTCCTTACCAGCTTTGACAATACAGGAAATGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)109372 - 480
Exon 2 To Exon 3 (Pair 13)
Forward (262,21)TGGATGATTGCCTGCGACATGAmplicon SizecDNA: 198 bpgenomic: 17,550
Reverse (459,22)AGCTGGTAAGGACATCTTCAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.776 kcal/mol in 3' area
Forward Dimers-1.322 kcal/mol
Reverse Loops0.914 kcal/mol in 3' area
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers-2.235 kcal/mol
Amplicon Folding-0.044 kcal/mol outside primersite
Amplicon SequenceTGGATGATTGCCTGCGACATGTATCTGTAAGAAGATTTGAATCATTTAATCTGTTTTCAG
TAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAA
GCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTG
AAGATGTCCTTACCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)198262 - 459
Exon 2 To Exon 4 (Pair 7)
Forward (358,22)TTGGTGCATGGGTCCAATATACAmplicon SizecDNA: 174 bpgenomic: 331,503
Reverse (531,23)TATTGTGCTTGAGGCAGTAGTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.327 kcal/mol
Forward Dimers-2.116 kcal/mol
Reverse Loops0.387 kcal/mol
Reverse Dimers-0.616 kcal/mol
Forward-Reverse Dimers-1.68 kcal/mol
Amplicon Folding0.209 kcal/mol inside primersite
Amplicon SequenceTTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGC
ATAATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCAGCTTTGACAATACAGGAAATG
TTTGCATCTGGCCATCTGAAGAGGTTTTGGCTTACTACTGCCTCAAGCACAATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)174358 - 531
Exon 2 To Exon 5 (Pair 7)
Forward (318,23)TCAGTAACAGAAGGCAAAGAAAGAmplicon SizecDNA: 245 bpgenomic: 333,517
Reverse (562,20)AGCTCACACACAGCAAGGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.636 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops1.053 kcal/mol in 3' area
Reverse Dimers-1.83 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding0.209 kcal/mol outside primersite
Amplicon SequenceTCAGTAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATAT
ACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAAT
GTTGAAGATGTCCTTACCAGCTTTGACAATACAGGAAATGTTTGCATCTGGCCATCTGAA
GAGGTTTTGGCTTACTACTGCCTCAAGCACAATAATATATTCAGGGCCCTTGCTGTGTGT
GAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)245318 - 562
Exon 2 To Exon 5 (Pair 8)
Forward (377,23)TACAAGCATCTTCTGTCCTGAATAmplicon SizecDNA: 220 bpgenomic: 333,492
Reverse (596,20)CATGAGCCCAGCCAAGCATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.379 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.375 kcal/mol in 3' area
Reverse Dimers-1.208 kcal/mol
Forward-Reverse Dimers-1.438 kcal/mol
Amplicon Folding-1.016 kcal/mol outside primersite
Amplicon SequenceTACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAA
TGTTGAAGATGTCCTTACCAGCTTTGACAATACAGGAAATGTTTGCATCTGGCCATCTGA
AGAGGTTTTGGCTTACTACTGCCTCAAGCACAATAATATATTCAGGGCCCTTGCTGTGTG
TGAGCTAGGGGGTGGCATGACATGCTTGGCTGGGCTCATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)220377 - 596
Exon 2 To Exon 3 (Pair 14)
Forward (262,21)TGGATGATTGCCTGCGACATGAmplicon SizecDNA: 203 bpgenomic: 17,555
Reverse (464,22)GTCAAAGCTGGTAAGGACATCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.776 kcal/mol in 3' area
Forward Dimers-1.322 kcal/mol
Reverse Loops1.556 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.235 kcal/mol
Amplicon Folding-0.044 kcal/mol outside primersite
Amplicon SequenceTGGATGATTGCCTGCGACATGTATCTGTAAGAAGATTTGAATCATTTAATCTGTTTTCAG
TAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAA
GCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTG
AAGATGTCCTTACCAGCTTTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)203262 - 464
Exon 2 To Exon 3 (Pair 15)
Forward (262,21)TGGATGATTGCCTGCGACATGAmplicon SizecDNA: 219 bpgenomic: 17,571
Reverse (480,24)AAACATTTCCTGTATTGTCAAAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.776 kcal/mol in 3' area
Forward Dimers-1.322 kcal/mol
Reverse Loops0.573 kcal/mol
Reverse Dimers-0.554 kcal/mol
Forward-Reverse Dimers-1.692 kcal/mol
Amplicon Folding-0.044 kcal/mol outside primersite
Amplicon SequenceTGGATGATTGCCTGCGACATGTATCTGTAAGAAGATTTGAATCATTTAATCTGTTTTCAG
TAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAA
GCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTG
AAGATGTCCTTACCAGCTTTGACAATACAGGAAATGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)219262 - 480
Exon 2 To Exon 5 (Pair 9)
Forward (360,22)GGTGCATGGGTCCAATATACAAAmplicon SizecDNA: 237 bpgenomic: 333,509
Reverse (596,20)CATGAGCCCAGCCAAGCATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.841 kcal/mol
Forward Dimers-2.116 kcal/mol
Reverse Loops1.375 kcal/mol in 3' area
Reverse Dimers-1.208 kcal/mol
Forward-Reverse Dimers-2.514 kcal/mol
Amplicon Folding-1.016 kcal/mol outside primersite
Amplicon SequenceGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCAT
AATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCAGCTTTGACAATACAGGAAATGTT
TGCATCTGGCCATCTGAAGAGGTTTTGGCTTACTACTGCCTCAAGCACAATAATATATTC
AGGGCCCTTGCTGTGTGTGAGCTAGGGGGTGGCATGACATGCTTGGCTGGGCTCATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)237360 - 596
Exon 2 To Exon 3 (Pair 16)
Forward (256,21)AACACCTGGATGATTGCCTGCAmplicon SizecDNA: 203 bpgenomic: 17,555
Reverse (458,22)GCTGGTAAGGACATCTTCAACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.578 kcal/mol
Forward Dimers-2.268 kcal/mol
Reverse Loops0.914 kcal/mol
Reverse Dimers-0.158 kcal/mol
Forward-Reverse Dimers-2.404 kcal/mol
Amplicon Folding-0.044 kcal/mol outside primersite
Amplicon SequenceAACACCTGGATGATTGCCTGCGACATGTATCTGTAAGAAGATTTGAATCATTTAATCTGT
TTTCAGTAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAAT
ATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGA
ATGTTGAAGATGTCCTTACCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)203256 - 458
Exon 2 To Exon 3 (Pair 17)
Forward (316,24)TTTCAGTAACAGAAGGCAAAGAAAAmplicon SizecDNA: 155 bpgenomic: 17,507
Reverse (470,23)TGTATTGTCAAAGCTGGTAAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.382 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops1.73 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.828 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceTTTCAGTAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAAT
ATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGA
ATGTTGAAGATGTCCTTACCAGCTTTGACAATACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)155316 - 470
Exon 2 To Exon 3 (Pair 18)
Forward (258,20)CACCTGGATGATTGCCTGCGAmplicon SizecDNA: 201 bpgenomic: 17,553
Reverse (458,22)GCTGGTAAGGACATCTTCAACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.121 kcal/mol
Forward Dimers-2.268 kcal/mol
Reverse Loops0.914 kcal/mol
Reverse Dimers-0.158 kcal/mol
Forward-Reverse Dimers-2.404 kcal/mol
Amplicon Folding-0.044 kcal/mol outside primersite
Amplicon SequenceCACCTGGATGATTGCCTGCGACATGTATCTGTAAGAAGATTTGAATCATTTAATCTGTTT
TCAGTAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATAT
ACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAAT
GTTGAAGATGTCCTTACCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)201258 - 458
Exon 2 To Exon 4 (Pair 8)
Forward (335,22)AGAAAGGGAAACTGAAGAGGAGAmplicon SizecDNA: 204 bpgenomic: 331,533
Reverse (538,24)AATATATTATTGTGCTTGAGGCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.966 kcal/mol
Forward Dimers-0.605 kcal/mol
Reverse Loops0.387 kcal/mol in 3' area
Reverse Dimers-0.956 kcal/mol
Forward-Reverse Dimers-1.362 kcal/mol
Amplicon Folding0.209 kcal/mol inside primersite
Amplicon SequenceAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCC
TGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTGAAGATGTCCTTAC
CAGCTTTGACAATACAGGAAATGTTTGCATCTGGCCATCTGAAGAGGTTTTGGCTTACTA
CTGCCTCAAGCACAATAATATATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)204335 - 538
Exon 2 To Exon 3 (Pair 19)
Forward (358,22)TTGGTGCATGGGTCCAATATACAmplicon SizecDNA: 100 bpgenomic: 17,452
Reverse (457,23)CTGGTAAGGACATCTTCAACATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.327 kcal/mol
Forward Dimers-2.116 kcal/mol
Reverse Loops0.914 kcal/mol
Reverse Dimers-0.158 kcal/mol
Forward-Reverse Dimers-2.337 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceTTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGC
ATAATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)100358 - 457
Exon 2 To Exon 6 (Pair 4)
Forward (376,23)ATACAAGCATCTTCTGTCCTGAAAmplicon SizecDNA: 260 bpgenomic: 334,589
Reverse (635,24)AGTTAACAGAACTTCTTTGACATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.379 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.492 kcal/mol
Reverse Dimers-1.646 kcal/mol
Forward-Reverse Dimers-2.912 kcal/mol
Amplicon Folding-1.016 kcal/mol outside primersite
Amplicon SequenceATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGA
ATGTTGAAGATGTCCTTACCAGCTTTGACAATACAGGAAATGTTTGCATCTGGCCATCTG
AAGAGGTTTTGGCTTACTACTGCCTCAAGCACAATAATATATTCAGGGCCCTTGCTGTGT
GTGAGCTAGGGGGTGGCATGACATGCTTGGCTGGGCTCATGGTTGCTATTTCTGCAGATG
TCAAAGAAGTTCTGTTAACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)260376 - 635
Exon 2 To Exon 3 (Pair 20)
Forward (368,23)GGTCCAATATACAAGCATCTTCTAmplicon SizecDNA: 94 bpgenomic: 17,446
Reverse (461,23)AAAGCTGGTAAGGACATCTTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.379 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.914 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.337 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGG
ATCCTTGAATGTTGAAGATGTCCTTACCAGCTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)94368 - 461
Exon 2 To Exon 3 (Pair 21)
Forward (318,23)TCAGTAACAGAAGGCAAAGAAAGAmplicon SizecDNA: 150 bpgenomic: 17,502
Reverse (467,23)ATTGTCAAAGCTGGTAAGGACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.636 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops1.4 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.828 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceTCAGTAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATAT
ACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAAT
GTTGAAGATGTCCTTACCAGCTTTGACAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)150318 - 467
Exon 2 To Exon 3 (Pair 22)
Forward (371,23)CCAATATACAAGCATCTTCTGTCAmplicon SizecDNA: 100 bpgenomic: 17,452
Reverse (470,23)TGTATTGTCAAAGCTGGTAAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.379 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.73 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATC
CTTGAATGTTGAAGATGTCCTTACCAGCTTTGACAATACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)100371 - 470
Exon 2 To Exon 3 (Pair 23)
Forward (337,22)AAAGGGAAACTGAAGAGGAGGTAmplicon SizecDNA: 134 bpgenomic: 17,486
Reverse (470,23)TGTATTGTCAAAGCTGGTAAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.966 kcal/mol
Forward Dimers-0.605 kcal/mol
Reverse Loops1.73 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-0.895 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTG
AATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCA
GCTTTGACAATACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)134337 - 470
Exon 2 To Exon 3 (Pair 24)
Forward (377,23)TACAAGCATCTTCTGTCCTGAATAmplicon SizecDNA: 97 bpgenomic: 17,449
Reverse (473,23)TCCTGTATTGTCAAAGCTGGTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.379 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.138 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceTACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAA
TGTTGAAGATGTCCTTACCAGCTTTGACAATACAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)97377 - 473
Exon 2 To Exon 3 (Pair 25)
Forward (365,23)ATGGGTCCAATATACAAGCATCTAmplicon SizecDNA: 91 bpgenomic: 17,443
Reverse (455,23)GGTAAGGACATCTTCAACATTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.841 kcal/mol
Forward Dimers-2.116 kcal/mol
Reverse Loops0.914 kcal/mol
Reverse Dimers-0.158 kcal/mol
Forward-Reverse Dimers-2.337 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAG
TGGATCCTTGAATGTTGAAGATGTCCTTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)91365 - 455
Exon 2 To Exon 6 (Pair 5)
Forward (335,22)AGAAAGGGAAACTGAAGAGGAGAmplicon SizecDNA: 301 bpgenomic: 334,630
Reverse (635,24)AGTTAACAGAACTTCTTTGACATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.966 kcal/mol
Forward Dimers-0.605 kcal/mol
Reverse Loops0.492 kcal/mol
Reverse Dimers-1.646 kcal/mol
Forward-Reverse Dimers-2.255 kcal/mol
Amplicon Folding-1.016 kcal/mol outside primersite
Amplicon SequenceAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCC
TGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTGAAGATGTCCTTAC
CAGCTTTGACAATACAGGAAATGTTTGCATCTGGCCATCTGAAGAGGTTTTGGCTTACTA
CTGCCTCAAGCACAATAATATATTCAGGGCCCTTGCTGTGTGTGAGCTAGGGGGTGGCAT
GACATGCTTGGCTGGGCTCATGGTTGCTATTTCTGCAGATGTCAAAGAAGTTCTGTTAAC
T
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)301335 - 635
Exon 2 To Exon 3 (Pair 26)
Forward (256,21)AACACCTGGATGATTGCCTGCAmplicon SizecDNA: 206 bpgenomic: 17,558
Reverse (461,23)AAAGCTGGTAAGGACATCTTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.578 kcal/mol
Forward Dimers-2.268 kcal/mol
Reverse Loops0.914 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.404 kcal/mol
Amplicon Folding-0.044 kcal/mol outside primersite
Amplicon SequenceAACACCTGGATGATTGCCTGCGACATGTATCTGTAAGAAGATTTGAATCATTTAATCTGT
TTTCAGTAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAAT
ATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGA
ATGTTGAAGATGTCCTTACCAGCTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)206256 - 461
Exon 2 To Exon 3 (Pair 27)
Forward (371,23)CCAATATACAAGCATCTTCTGTCAmplicon SizecDNA: 94 bpgenomic: 17,446
Reverse (464,22)GTCAAAGCTGGTAAGGACATCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.379 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.556 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATC
CTTGAATGTTGAAGATGTCCTTACCAGCTTTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)94371 - 464
Exon 2 To Exon 3 (Pair 28)
Forward (344,21)AACTGAAGAGGAGGTTGGTGCAmplicon SizecDNA: 125 bpgenomic: 17,477
Reverse (468,23)TATTGTCAAAGCTGGTAAGGACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.561 kcal/mol
Forward Dimers-0.605 kcal/mol
Reverse Loops1.4 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.751 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAG
TATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCAGCTTTGA
CAATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)125344 - 468
Exon 2 To Exon 3 (Pair 29)
Forward (344,21)AACTGAAGAGGAGGTTGGTGCAmplicon SizecDNA: 119 bpgenomic: 17,471
Reverse (462,22)CAAAGCTGGTAAGGACATCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.561 kcal/mol
Forward Dimers-0.605 kcal/mol
Reverse Loops0.914 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.751 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAG
TATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCAGCTTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)119344 - 462
Exon 2 To Exon 3 (Pair 30)
Forward (372,23)CAATATACAAGCATCTTCTGTCCAmplicon SizecDNA: 99 bpgenomic: 17,451
Reverse (470,23)TGTATTGTCAAAGCTGGTAAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.379 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.73 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCC
TTGAATGTTGAAGATGTCCTTACCAGCTTTGACAATACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)99372 - 470
Exon 2 To Exon 3 (Pair 31)
Forward (360,22)GGTGCATGGGTCCAATATACAAAmplicon SizecDNA: 102 bpgenomic: 17,454
Reverse (461,23)AAAGCTGGTAAGGACATCTTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.841 kcal/mol
Forward Dimers-2.116 kcal/mol
Reverse Loops0.914 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.337 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCAT
AATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCAGCTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)102360 - 461
Exon 2 To Exon 3 (Pair 32)
Forward (316,24)TTTCAGTAACAGAAGGCAAAGAAAAmplicon SizecDNA: 144 bpgenomic: 17,496
Reverse (459,22)AGCTGGTAAGGACATCTTCAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.382 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops0.914 kcal/mol in 3' area
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers-1.828 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceTTTCAGTAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAAT
ATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGA
ATGTTGAAGATGTCCTTACCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)144316 - 459
Exon 2 To Exon 6 (Pair 6)
Forward (351,20)GAGGAGGTTGGTGCATGGGTAmplicon SizecDNA: 286 bpgenomic: 334,615
Reverse (636,24)CAGTTAACAGAACTTCTTTGACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.035 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops0.018 kcal/mol
Reverse Dimers-1.732 kcal/mol
Forward-Reverse Dimers-1.697 kcal/mol
Amplicon Folding-1.016 kcal/mol outside primersite
Amplicon SequenceGAGGAGGTTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCC
TTAAGGCATAATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCAGCTTTGACAATACA
GGAAATGTTTGCATCTGGCCATCTGAAGAGGTTTTGGCTTACTACTGCCTCAAGCACAAT
AATATATTCAGGGCCCTTGCTGTGTGTGAGCTAGGGGGTGGCATGACATGCTTGGCTGGG
CTCATGGTTGCTATTTCTGCAGATGTCAAAGAAGTTCTGTTAACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)286351 - 636
Exon 2 To Exon 6 (Pair 7)
Forward (375,23)TATACAAGCATCTTCTGTCCTGAAmplicon SizecDNA: 265 bpgenomic: 334,594
Reverse (639,24)CATCAGTTAACAGAACTTCTTTGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.379 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.018 kcal/mol
Reverse Dimers-1.732 kcal/mol
Forward-Reverse Dimers-2.912 kcal/mol
Amplicon Folding-1.016 kcal/mol outside primersite
Amplicon SequenceTATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTG
AATGTTGAAGATGTCCTTACCAGCTTTGACAATACAGGAAATGTTTGCATCTGGCCATCT
GAAGAGGTTTTGGCTTACTACTGCCTCAAGCACAATAATATATTCAGGGCCCTTGCTGTG
TGTGAGCTAGGGGGTGGCATGACATGCTTGGCTGGGCTCATGGTTGCTATTTCTGCAGAT
GTCAAAGAAGTTCTGTTAACTGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)265375 - 639
Exon 2 To Exon 3 (Pair 33)
Forward (323,23)AACAGAAGGCAAAGAAAGGGAAAAmplicon SizecDNA: 133 bpgenomic: 17,485
Reverse (455,23)GGTAAGGACATCTTCAACATTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops0.914 kcal/mol
Reverse Dimers-0.158 kcal/mol
Forward-Reverse Dimers-1.492 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAAG
CATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTGA
AGATGTCCTTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)133323 - 455
Exon 2 To Exon 4 (Pair 9)
Forward (351,20)GAGGAGGTTGGTGCATGGGTAmplicon SizecDNA: 190 bpgenomic: 331,519
Reverse (540,24)TGAATATATTATTGTGCTTGAGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.035 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops1.11 kcal/mol in 3' area
Reverse Dimers-1.764 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding0.209 kcal/mol inside primersite
Amplicon SequenceGAGGAGGTTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCC
TTAAGGCATAATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCAGCTTTGACAATACA
GGAAATGTTTGCATCTGGCCATCTGAAGAGGTTTTGGCTTACTACTGCCTCAAGCACAAT
AATATATTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)190351 - 540
Exon 2 To Exon 3 (Pair 34)
Forward (325,22)CAGAAGGCAAAGAAAGGGAAACAmplicon SizecDNA: 149 bpgenomic: 17,501
Reverse (473,23)TCCTGTATTGTCAAAGCTGGTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops2.138 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.566 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceCAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAAGCA
TCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTGAAG
ATGTCCTTACCAGCTTTGACAATACAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)149325 - 473
Exon 2 To Exon 3 (Pair 35)
Forward (359,22)TGGTGCATGGGTCCAATATACAAmplicon SizecDNA: 99 bpgenomic: 17,451
Reverse (457,23)CTGGTAAGGACATCTTCAACATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol
Forward Dimers-2.116 kcal/mol
Reverse Loops0.914 kcal/mol
Reverse Dimers-0.158 kcal/mol
Forward-Reverse Dimers-2.337 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCA
TAATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)99359 - 457
Exon 2 To Exon 3 (Pair 36)
Forward (369,23)GTCCAATATACAAGCATCTTCTGAmplicon SizecDNA: 90 bpgenomic: 17,442
Reverse (458,22)GCTGGTAAGGACATCTTCAACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.379 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.914 kcal/mol
Reverse Dimers-0.158 kcal/mol
Forward-Reverse Dimers-2.046 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGA
TCCTTGAATGTTGAAGATGTCCTTACCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)90369 - 458
Exon 2 To Exon 3 (Pair 37)
Forward (323,23)AACAGAAGGCAAAGAAAGGGAAAAmplicon SizecDNA: 151 bpgenomic: 17,503
Reverse (473,23)TCCTGTATTGTCAAAGCTGGTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops2.138 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.542 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAAG
CATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTGA
AGATGTCCTTACCAGCTTTGACAATACAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)151323 - 473
Exon 2 To Exon 3 (Pair 38)
Forward (366,23)TGGGTCCAATATACAAGCATCTTAmplicon SizecDNA: 92 bpgenomic: 17,444
Reverse (457,23)CTGGTAAGGACATCTTCAACATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.761 kcal/mol in 3' area
Forward Dimers-1.514 kcal/mol
Reverse Loops0.914 kcal/mol
Reverse Dimers-0.158 kcal/mol
Forward-Reverse Dimers-2.337 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceTGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGT
GGATCCTTGAATGTTGAAGATGTCCTTACCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)92366 - 457
Exon 2 To Exon 3 (Pair 39)
Forward (368,23)GGTCCAATATACAAGCATCTTCTAmplicon SizecDNA: 92 bpgenomic: 17,444
Reverse (459,22)AGCTGGTAAGGACATCTTCAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.379 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.914 kcal/mol in 3' area
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers-2.337 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGG
ATCCTTGAATGTTGAAGATGTCCTTACCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)92368 - 459
Exon 2 To Exon 4 (Pair 10)
Forward (322,23)TAACAGAAGGCAAAGAAAGGGAAAmplicon SizecDNA: 210 bpgenomic: 331,539
Reverse (531,23)TATTGTGCTTGAGGCAGTAGTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops0.387 kcal/mol
Reverse Dimers-0.616 kcal/mol
Forward-Reverse Dimers-1.34 kcal/mol
Amplicon Folding0.209 kcal/mol inside primersite
Amplicon SequenceTAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAA
GCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTG
AAGATGTCCTTACCAGCTTTGACAATACAGGAAATGTTTGCATCTGGCCATCTGAAGAGG
TTTTGGCTTACTACTGCCTCAAGCACAATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)210322 - 531
Exon 2 To Exon 5 (Pair 10)
Forward (363,22)GCATGGGTCCAATATACAAGCAAmplicon SizecDNA: 234 bpgenomic: 333,506
Reverse (596,20)CATGAGCCCAGCCAAGCATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.841 kcal/mol
Forward Dimers-2.116 kcal/mol
Reverse Loops1.375 kcal/mol in 3' area
Reverse Dimers-1.208 kcal/mol
Forward-Reverse Dimers-2.514 kcal/mol
Amplicon Folding-1.016 kcal/mol outside primersite
Amplicon SequenceGCATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAAT
AGTGGATCCTTGAATGTTGAAGATGTCCTTACCAGCTTTGACAATACAGGAAATGTTTGC
ATCTGGCCATCTGAAGAGGTTTTGGCTTACTACTGCCTCAAGCACAATAATATATTCAGG
GCCCTTGCTGTGTGTGAGCTAGGGGGTGGCATGACATGCTTGGCTGGGCTCATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)234363 - 596
Exon 2 To Exon 3 (Pair 40)
Forward (323,23)AACAGAAGGCAAAGAAAGGGAAAAmplicon SizecDNA: 142 bpgenomic: 17,494
Reverse (464,22)GTCAAAGCTGGTAAGGACATCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops1.556 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.436 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAAG
CATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTGA
AGATGTCCTTACCAGCTTTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)142323 - 464
Exon 2 To Exon 3 (Pair 41)
Forward (369,23)GTCCAATATACAAGCATCTTCTGAmplicon SizecDNA: 100 bpgenomic: 17,452
Reverse (468,23)TATTGTCAAAGCTGGTAAGGACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.379 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.4 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGA
TCCTTGAATGTTGAAGATGTCCTTACCAGCTTTGACAATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)100369 - 468
Exon 2 To Exon 3 (Pair 42)
Forward (363,22)GCATGGGTCCAATATACAAGCAAmplicon SizecDNA: 96 bpgenomic: 17,448
Reverse (458,22)GCTGGTAAGGACATCTTCAACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.841 kcal/mol
Forward Dimers-2.116 kcal/mol
Reverse Loops0.914 kcal/mol
Reverse Dimers-0.158 kcal/mol
Forward-Reverse Dimers-2.337 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceGCATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAAT
AGTGGATCCTTGAATGTTGAAGATGTCCTTACCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)96363 - 458
Exon 2 To Exon 3 (Pair 43)
Forward (361,22)GTGCATGGGTCCAATATACAAGAmplicon SizecDNA: 102 bpgenomic: 17,454
Reverse (462,22)CAAAGCTGGTAAGGACATCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.841 kcal/mol
Forward Dimers-2.116 kcal/mol
Reverse Loops0.914 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.337 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATA
ATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCAGCTTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)102361 - 462
Exon 2 To Exon 3 (Pair 44)
Forward (258,20)CACCTGGATGATTGCCTGCGAmplicon SizecDNA: 200 bpgenomic: 17,552
Reverse (457,23)CTGGTAAGGACATCTTCAACATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.121 kcal/mol
Forward Dimers-2.268 kcal/mol
Reverse Loops0.914 kcal/mol
Reverse Dimers-0.158 kcal/mol
Forward-Reverse Dimers-2.404 kcal/mol
Amplicon Folding-0.044 kcal/mol outside primersite
Amplicon SequenceCACCTGGATGATTGCCTGCGACATGTATCTGTAAGAAGATTTGAATCATTTAATCTGTTT
TCAGTAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATAT
ACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAAT
GTTGAAGATGTCCTTACCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)200258 - 457
Exon 2 To Exon 3 (Pair 45)
Forward (333,23)AAAGAAAGGGAAACTGAAGAGGAAmplicon SizecDNA: 138 bpgenomic: 17,490
Reverse (470,23)TGTATTGTCAAAGCTGGTAAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.966 kcal/mol
Forward Dimers-0.605 kcal/mol
Reverse Loops1.73 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-0.895 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAAGCATCTTCTGT
CCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTGAAGATGTCCTT
ACCAGCTTTGACAATACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)138333 - 470
Exon 2 To Exon 3 (Pair 46)
Forward (321,22)GTAACAGAAGGCAAAGAAAGGGAmplicon SizecDNA: 139 bpgenomic: 17,491
Reverse (459,22)AGCTGGTAAGGACATCTTCAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops3.395 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops0.914 kcal/mol in 3' area
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers-1.828 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceGTAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACA
AGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTT
GAAGATGTCCTTACCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)139321 - 459
Exon 2 To Exon 4 (Pair 11)
Forward (337,22)AAAGGGAAACTGAAGAGGAGGTAmplicon SizecDNA: 203 bpgenomic: 331,532
Reverse (539,24)GAATATATTATTGTGCTTGAGGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.966 kcal/mol
Forward Dimers-0.605 kcal/mol
Reverse Loops0.387 kcal/mol in 3' area
Reverse Dimers-1.764 kcal/mol
Forward-Reverse Dimers-1.362 kcal/mol
Amplicon Folding0.209 kcal/mol inside primersite
Amplicon SequenceAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTG
AATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCA
GCTTTGACAATACAGGAAATGTTTGCATCTGGCCATCTGAAGAGGTTTTGGCTTACTACT
GCCTCAAGCACAATAATATATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)203337 - 539
Exon 2 To Exon 5 (Pair 11)
Forward (380,23)AAGCATCTTCTGTCCTGAATACAAmplicon SizecDNA: 183 bpgenomic: 333,455
Reverse (562,20)AGCTCACACACAGCAAGGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.761 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.053 kcal/mol in 3' area
Reverse Dimers-1.83 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding0.209 kcal/mol outside primersite
Amplicon SequenceAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGT
TGAAGATGTCCTTACCAGCTTTGACAATACAGGAAATGTTTGCATCTGGCCATCTGAAGA
GGTTTTGGCTTACTACTGCCTCAAGCACAATAATATATTCAGGGCCCTTGCTGTGTGTGA
GCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)183380 - 562
Exon 2 To Exon 5 (Pair 12)
Forward (344,21)AACTGAAGAGGAGGTTGGTGCAmplicon SizecDNA: 219 bpgenomic: 333,491
Reverse (562,20)AGCTCACACACAGCAAGGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.561 kcal/mol
Forward Dimers-0.605 kcal/mol
Reverse Loops1.053 kcal/mol in 3' area
Reverse Dimers-1.83 kcal/mol
Forward-Reverse Dimers-1.654 kcal/mol
Amplicon Folding0.209 kcal/mol outside primersite
Amplicon SequenceAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAG
TATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCAGCTTTGA
CAATACAGGAAATGTTTGCATCTGGCCATCTGAAGAGGTTTTGGCTTACTACTGCCTCAA
GCACAATAATATATTCAGGGCCCTTGCTGTGTGTGAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)219344 - 562
Exon 2 To Exon 3 (Pair 47)
Forward (322,23)TAACAGAAGGCAAAGAAAGGGAAAmplicon SizecDNA: 152 bpgenomic: 17,504
Reverse (473,23)TCCTGTATTGTCAAAGCTGGTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops2.138 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.542 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceTAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAA
GCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTG
AAGATGTCCTTACCAGCTTTGACAATACAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)152322 - 473
Exon 2 To Exon 4 (Pair 12)
Forward (325,22)CAGAAGGCAAAGAAAGGGAAACAmplicon SizecDNA: 208 bpgenomic: 331,537
Reverse (532,23)TTATTGTGCTTGAGGCAGTAGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops0.387 kcal/mol
Reverse Dimers-0.616 kcal/mol
Forward-Reverse Dimers-1.34 kcal/mol
Amplicon Folding0.209 kcal/mol inside primersite
Amplicon SequenceCAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAAGCA
TCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTGAAG
ATGTCCTTACCAGCTTTGACAATACAGGAAATGTTTGCATCTGGCCATCTGAAGAGGTTT
TGGCTTACTACTGCCTCAAGCACAATAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)208325 - 532
Exon 2 To Exon 3 (Pair 48)
Forward (258,20)CACCTGGATGATTGCCTGCGAmplicon SizecDNA: 202 bpgenomic: 17,554
Reverse (459,22)AGCTGGTAAGGACATCTTCAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.121 kcal/mol
Forward Dimers-2.268 kcal/mol
Reverse Loops0.914 kcal/mol in 3' area
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers-2.404 kcal/mol
Amplicon Folding-0.044 kcal/mol outside primersite
Amplicon SequenceCACCTGGATGATTGCCTGCGACATGTATCTGTAAGAAGATTTGAATCATTTAATCTGTTT
TCAGTAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATAT
ACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAAT
GTTGAAGATGTCCTTACCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)202258 - 459
Exon 2 To Exon 3 (Pair 49)
Forward (372,23)CAATATACAAGCATCTTCTGTCCAmplicon SizecDNA: 102 bpgenomic: 17,454
Reverse (473,23)TCCTGTATTGTCAAAGCTGGTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.379 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.138 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCC
TTGAATGTTGAAGATGTCCTTACCAGCTTTGACAATACAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)102372 - 473
Exon 2 To Exon 4 (Pair 13)
Forward (351,20)GAGGAGGTTGGTGCATGGGTAmplicon SizecDNA: 179 bpgenomic: 331,508
Reverse (529,22)TTGTGCTTGAGGCAGTAGTAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.035 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops0.387 kcal/mol
Reverse Dimers-0.616 kcal/mol
Forward-Reverse Dimers-1.68 kcal/mol
Amplicon Folding0.209 kcal/mol inside primersite
Amplicon SequenceGAGGAGGTTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCC
TTAAGGCATAATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCAGCTTTGACAATACA
GGAAATGTTTGCATCTGGCCATCTGAAGAGGTTTTGGCTTACTACTGCCTCAAGCACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)179351 - 529
Exon 2 To Exon 3 (Pair 50)
Forward (368,23)GGTCCAATATACAAGCATCTTCTAmplicon SizecDNA: 90 bpgenomic: 17,442
Reverse (457,23)CTGGTAAGGACATCTTCAACATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.379 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.914 kcal/mol
Reverse Dimers-0.158 kcal/mol
Forward-Reverse Dimers-2.337 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGG
ATCCTTGAATGTTGAAGATGTCCTTACCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)90368 - 457
Exon 2 To Exon 3 (Pair 51)
Forward (351,20)GAGGAGGTTGGTGCATGGGTAmplicon SizecDNA: 120 bpgenomic: 17,472
Reverse (470,23)TGTATTGTCAAAGCTGGTAAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.035 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops1.73 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.751 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceGAGGAGGTTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCC
TTAAGGCATAATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCAGCTTTGACAATACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)120351 - 470
Exon 2 To Exon 6 (Pair 8)
Forward (351,20)GAGGAGGTTGGTGCATGGGTAmplicon SizecDNA: 285 bpgenomic: 334,614
Reverse (635,24)AGTTAACAGAACTTCTTTGACATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.035 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops0.492 kcal/mol
Reverse Dimers-1.646 kcal/mol
Forward-Reverse Dimers-1.697 kcal/mol
Amplicon Folding-1.016 kcal/mol outside primersite
Amplicon SequenceGAGGAGGTTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCC
TTAAGGCATAATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCAGCTTTGACAATACA
GGAAATGTTTGCATCTGGCCATCTGAAGAGGTTTTGGCTTACTACTGCCTCAAGCACAAT
AATATATTCAGGGCCCTTGCTGTGTGTGAGCTAGGGGGTGGCATGACATGCTTGGCTGGG
CTCATGGTTGCTATTTCTGCAGATGTCAAAGAAGTTCTGTTAACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)285351 - 635
Exon 2 To Exon 3 (Pair 52)
Forward (322,23)TAACAGAAGGCAAAGAAAGGGAAAmplicon SizecDNA: 137 bpgenomic: 17,489
Reverse (458,22)GCTGGTAAGGACATCTTCAACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops0.914 kcal/mol
Reverse Dimers-0.158 kcal/mol
Forward-Reverse Dimers-1.828 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceTAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAA
GCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTG
AAGATGTCCTTACCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)137322 - 458
Exon 2 To Exon 3 (Pair 53)
Forward (351,20)GAGGAGGTTGGTGCATGGGTAmplicon SizecDNA: 117 bpgenomic: 17,469
Reverse (467,23)ATTGTCAAAGCTGGTAAGGACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.035 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops1.4 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.751 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceGAGGAGGTTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCC
TTAAGGCATAATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCAGCTTTGACAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)117351 - 467
Exon 2 To Exon 3 (Pair 54)
Forward (344,21)AACTGAAGAGGAGGTTGGTGCAmplicon SizecDNA: 122 bpgenomic: 17,474
Reverse (465,22)TGTCAAAGCTGGTAAGGACATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.561 kcal/mol
Forward Dimers-0.605 kcal/mol
Reverse Loops1.471 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.751 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAG
TATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCAGCTTTGA
CA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)122344 - 465
Exon 2 To Exon 3 (Pair 55)
Forward (344,21)AACTGAAGAGGAGGTTGGTGCAmplicon SizecDNA: 124 bpgenomic: 17,476
Reverse (467,23)ATTGTCAAAGCTGGTAAGGACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.561 kcal/mol
Forward Dimers-0.605 kcal/mol
Reverse Loops1.4 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.751 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAG
TATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCAGCTTTGA
CAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)124344 - 467
Exon 2 To Exon 3 (Pair 56)
Forward (318,23)TCAGTAACAGAAGGCAAAGAAAGAmplicon SizecDNA: 145 bpgenomic: 17,497
Reverse (462,22)CAAAGCTGGTAAGGACATCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.636 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops0.914 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.828 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceTCAGTAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATAT
ACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAAT
GTTGAAGATGTCCTTACCAGCTTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)145318 - 462
Exon 2 To Exon 3 (Pair 57)
Forward (318,23)TCAGTAACAGAAGGCAAAGAAAGAmplicon SizecDNA: 147 bpgenomic: 17,499
Reverse (464,22)GTCAAAGCTGGTAAGGACATCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.636 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops1.556 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.828 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceTCAGTAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATAT
ACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAAT
GTTGAAGATGTCCTTACCAGCTTTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)147318 - 464
Exon 2 To Exon 3 (Pair 58)
Forward (369,23)GTCCAATATACAAGCATCTTCTGAmplicon SizecDNA: 112 bpgenomic: 17,464
Reverse (480,24)AAACATTTCCTGTATTGTCAAAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.379 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.573 kcal/mol
Reverse Dimers-0.554 kcal/mol
Forward-Reverse Dimers-1.376 kcal/mol
Amplicon Folding0.492 kcal/mol inside primersite
Amplicon SequenceGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGA
TCCTTGAATGTTGAAGATGTCCTTACCAGCTTTGACAATACAGGAAATGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)112369 - 480
Exon 2 To Exon 3 (Pair 59)
Forward (318,23)TCAGTAACAGAAGGCAAAGAAAGAmplicon SizecDNA: 153 bpgenomic: 17,505
Reverse (470,23)TGTATTGTCAAAGCTGGTAAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.636 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops1.73 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.828 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceTCAGTAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATAT
ACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAAT
GTTGAAGATGTCCTTACCAGCTTTGACAATACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)153318 - 470
Exon 2 To Exon 3 (Pair 60)
Forward (316,24)TTTCAGTAACAGAAGGCAAAGAAAAmplicon SizecDNA: 150 bpgenomic: 17,502
Reverse (465,22)TGTCAAAGCTGGTAAGGACATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.382 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops1.471 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.828 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceTTTCAGTAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAAT
ATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGA
ATGTTGAAGATGTCCTTACCAGCTTTGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)150316 - 465
Exon 2 To Exon 4 (Pair 14)
Forward (380,23)AAGCATCTTCTGTCCTGAATACAAmplicon SizecDNA: 162 bpgenomic: 331,491
Reverse (541,24)CTGAATATATTATTGTGCTTGAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.761 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.389 kcal/mol
Reverse Dimers-1.764 kcal/mol
Forward-Reverse Dimers-2.447 kcal/mol
Amplicon Folding0.209 kcal/mol inside primersite
Amplicon SequenceAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGT
TGAAGATGTCCTTACCAGCTTTGACAATACAGGAAATGTTTGCATCTGGCCATCTGAAGA
GGTTTTGGCTTACTACTGCCTCAAGCACAATAATATATTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)162380 - 541
Exon 2 To Exon 3 (Pair 61)
Forward (368,23)GGTCCAATATACAAGCATCTTCTAmplicon SizecDNA: 88 bpgenomic: 17,440
Reverse (455,23)GGTAAGGACATCTTCAACATTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.379 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.914 kcal/mol
Reverse Dimers-0.158 kcal/mol
Forward-Reverse Dimers-2.337 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGG
ATCCTTGAATGTTGAAGATGTCCTTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)88368 - 455
Exon 2 To Exon 3 (Pair 62)
Forward (351,20)GAGGAGGTTGGTGCATGGGTAmplicon SizecDNA: 123 bpgenomic: 17,475
Reverse (473,23)TCCTGTATTGTCAAAGCTGGTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.035 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops2.138 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.188 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceGAGGAGGTTGGTGCATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCC
TTAAGGCATAATAGTGGATCCTTGAATGTTGAAGATGTCCTTACCAGCTTTGACAATACA
GGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)123351 - 473
Exon 2 To Exon 3 (Pair 63)
Forward (371,23)CCAATATACAAGCATCTTCTGTCAmplicon SizecDNA: 103 bpgenomic: 17,455
Reverse (473,23)TCCTGTATTGTCAAAGCTGGTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.379 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.138 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATC
CTTGAATGTTGAAGATGTCCTTACCAGCTTTGACAATACAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)103371 - 473
Exon 2 To Exon 3 (Pair 64)
Forward (321,22)GTAACAGAAGGCAAAGAAAGGGAmplicon SizecDNA: 138 bpgenomic: 17,490
Reverse (458,22)GCTGGTAAGGACATCTTCAACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops3.395 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops0.914 kcal/mol
Reverse Dimers-0.158 kcal/mol
Forward-Reverse Dimers-1.828 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceGTAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACA
AGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTT
GAAGATGTCCTTACCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)138321 - 458
Exon 2 To Exon 5 (Pair 13)
Forward (365,23)ATGGGTCCAATATACAAGCATCTAmplicon SizecDNA: 232 bpgenomic: 333,504
Reverse (596,20)CATGAGCCCAGCCAAGCATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.841 kcal/mol
Forward Dimers-2.116 kcal/mol
Reverse Loops1.375 kcal/mol in 3' area
Reverse Dimers-1.208 kcal/mol
Forward-Reverse Dimers-2.514 kcal/mol
Amplicon Folding-1.016 kcal/mol outside primersite
Amplicon SequenceATGGGTCCAATATACAAGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAG
TGGATCCTTGAATGTTGAAGATGTCCTTACCAGCTTTGACAATACAGGAAATGTTTGCAT
CTGGCCATCTGAAGAGGTTTTGGCTTACTACTGCCTCAAGCACAATAATATATTCAGGGC
CCTTGCTGTGTGTGAGCTAGGGGGTGGCATGACATGCTTGGCTGGGCTCATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)232365 - 596
Exon 2 To Exon 3 (Pair 65)
Forward (321,22)GTAACAGAAGGCAAAGAAAGGGAmplicon SizecDNA: 150 bpgenomic: 17,502
Reverse (470,23)TGTATTGTCAAAGCTGGTAAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops3.395 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops1.73 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.828 kcal/mol
Amplicon Folding0.777 kcal/mol inside primersite
Amplicon SequenceGTAACAGAAGGCAAAGAAAGGGAAACTGAAGAGGAGGTTGGTGCATGGGTCCAATATACA
AGCATCTTCTGTCCTGAATACAGTATCTCCTTAAGGCATAATAGTGGATCCTTGAATGTT
GAAGATGTCCTTACCAGCTTTGACAATACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024766 (CAMKMT)150321 - 470
 

See below for some more details.

Program Output:

Loading ...