Design Results for CDCA7

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size400
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size1000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 4 To Exon 6 (Pair 1)
Forward (635,19)AGAGTCCCGCCAGCCCTCAAmplicon SizecDNA: 247 bpgenomic: 1,501
Reverse (881,20)TCTCCTGGAAGCAACACCCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.019 kcal/mol in 3' area
Forward Dimers0.022 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-2.494 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceAGAGTCCCGCCAGCCCTCAGAGAATTCTGTGACTGATTCCAACTCCGATTCAGAAGATGA
AAGTGGAATGAATTTTTTGGAGAAAAGGGCTTTAAATATAAAGCAAAACAAAGCAATGCT
TGCAAAACTCATGTCTGAATTAGAAAGCTTCCCTGGCTCGTTCCGTGGAAGACATCCCCT
CCCAGGCTCCGACTCACAATCAAGGAGACCGCGAAGGCGTACATTCCCGGGTGTTGCTTC
CAGGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)247635 - 881
NM_145810 (CDCA7)247398 - 644
Exon 4 To Exon 6 (Pair 2)
Forward (635,19)AGAGTCCCGCCAGCCCTCAAmplicon SizecDNA: 251 bpgenomic: 1,505
Reverse (885,21)GGTTTCTCCTGGAAGCAACACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.019 kcal/mol in 3' area
Forward Dimers0.022 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-2.494 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceAGAGTCCCGCCAGCCCTCAGAGAATTCTGTGACTGATTCCAACTCCGATTCAGAAGATGA
AAGTGGAATGAATTTTTTGGAGAAAAGGGCTTTAAATATAAAGCAAAACAAAGCAATGCT
TGCAAAACTCATGTCTGAATTAGAAAGCTTCCCTGGCTCGTTCCGTGGAAGACATCCCCT
CCCAGGCTCCGACTCACAATCAAGGAGACCGCGAAGGCGTACATTCCCGGGTGTTGCTTC
CAGGAGAAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)251635 - 885
NM_145810 (CDCA7)251398 - 648
Exon 4 To Exon 6 (Pair 3)
Forward (661,21)CTGTGACTGATTCCAACTCCGAmplicon SizecDNA: 221 bpgenomic: 1,475
Reverse (881,20)TCTCCTGGAAGCAACACCCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.102 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-2.648 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceCTGTGACTGATTCCAACTCCGATTCAGAAGATGAAAGTGGAATGAATTTTTTGGAGAAAA
GGGCTTTAAATATAAAGCAAAACAAAGCAATGCTTGCAAAACTCATGTCTGAATTAGAAA
GCTTCCCTGGCTCGTTCCGTGGAAGACATCCCCTCCCAGGCTCCGACTCACAATCAAGGA
GACCGCGAAGGCGTACATTCCCGGGTGTTGCTTCCAGGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)221424 - 644
NM_031942 (CDCA7)221661 - 881
Exon 4 To Exon 6 (Pair 4)
Forward (666,22)ACTGATTCCAACTCCGATTCAGAmplicon SizecDNA: 218 bpgenomic: 1,472
Reverse (883,21)TTTCTCCTGGAAGCAACACCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.763 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-2.648 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceACTGATTCCAACTCCGATTCAGAAGATGAAAGTGGAATGAATTTTTTGGAGAAAAGGGCT
TTAAATATAAAGCAAAACAAAGCAATGCTTGCAAAACTCATGTCTGAATTAGAAAGCTTC
CCTGGCTCGTTCCGTGGAAGACATCCCCTCCCAGGCTCCGACTCACAATCAAGGAGACCG
CGAAGGCGTACATTCCCGGGTGTTGCTTCCAGGAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)218429 - 646
NM_031942 (CDCA7)218666 - 883
Exon 4 To Exon 6 (Pair 5)
Forward (659,22)TTCTGTGACTGATTCCAACTCCAmplicon SizecDNA: 223 bpgenomic: 1,477
Reverse (881,20)TCTCCTGGAAGCAACACCCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.102 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-2.648 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceTTCTGTGACTGATTCCAACTCCGATTCAGAAGATGAAAGTGGAATGAATTTTTTGGAGAA
AAGGGCTTTAAATATAAAGCAAAACAAAGCAATGCTTGCAAAACTCATGTCTGAATTAGA
AAGCTTCCCTGGCTCGTTCCGTGGAAGACATCCCCTCCCAGGCTCCGACTCACAATCAAG
GAGACCGCGAAGGCGTACATTCCCGGGTGTTGCTTCCAGGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)223659 - 881
NM_145810 (CDCA7)223422 - 644
Exon 4 To Exon 6 (Pair 6)
Forward (665,22)GACTGATTCCAACTCCGATTCAAmplicon SizecDNA: 220 bpgenomic: 1,474
Reverse (884,21)GTTTCTCCTGGAAGCAACACCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.102 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-2.648 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceGACTGATTCCAACTCCGATTCAGAAGATGAAAGTGGAATGAATTTTTTGGAGAAAAGGGC
TTTAAATATAAAGCAAAACAAAGCAATGCTTGCAAAACTCATGTCTGAATTAGAAAGCTT
CCCTGGCTCGTTCCGTGGAAGACATCCCCTCCCAGGCTCCGACTCACAATCAAGGAGACC
GCGAAGGCGTACATTCCCGGGTGTTGCTTCCAGGAGAAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)220428 - 647
NM_031942 (CDCA7)220665 - 884
Exon 4 To Exon 6 (Pair 7)
Forward (665,22)GACTGATTCCAACTCCGATTCAAmplicon SizecDNA: 219 bpgenomic: 1,473
Reverse (883,21)TTTCTCCTGGAAGCAACACCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.102 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-2.648 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceGACTGATTCCAACTCCGATTCAGAAGATGAAAGTGGAATGAATTTTTTGGAGAAAAGGGC
TTTAAATATAAAGCAAAACAAAGCAATGCTTGCAAAACTCATGTCTGAATTAGAAAGCTT
CCCTGGCTCGTTCCGTGGAAGACATCCCCTCCCAGGCTCCGACTCACAATCAAGGAGACC
GCGAAGGCGTACATTCCCGGGTGTTGCTTCCAGGAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)219428 - 646
NM_031942 (CDCA7)219665 - 883
Exon 4 To Exon 6 (Pair 8)
Forward (669,22)GATTCCAACTCCGATTCAGAAGAmplicon SizecDNA: 215 bpgenomic: 1,469
Reverse (883,21)TTTCTCCTGGAAGCAACACCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.279 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-1.912 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceGATTCCAACTCCGATTCAGAAGATGAAAGTGGAATGAATTTTTTGGAGAAAAGGGCTTTA
AATATAAAGCAAAACAAAGCAATGCTTGCAAAACTCATGTCTGAATTAGAAAGCTTCCCT
GGCTCGTTCCGTGGAAGACATCCCCTCCCAGGCTCCGACTCACAATCAAGGAGACCGCGA
AGGCGTACATTCCCGGGTGTTGCTTCCAGGAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)215669 - 883
NM_145810 (CDCA7)215432 - 646
Exon 4 To Exon 6 (Pair 9)
Forward (642,20)CGCCAGCCCTCAGAGAATTCAmplicon SizecDNA: 240 bpgenomic: 1,494
Reverse (881,20)TCTCCTGGAAGCAACACCCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol in 3' area
Forward Dimers-1.356 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-2.494 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceCGCCAGCCCTCAGAGAATTCTGTGACTGATTCCAACTCCGATTCAGAAGATGAAAGTGGA
ATGAATTTTTTGGAGAAAAGGGCTTTAAATATAAAGCAAAACAAAGCAATGCTTGCAAAA
CTCATGTCTGAATTAGAAAGCTTCCCTGGCTCGTTCCGTGGAAGACATCCCCTCCCAGGC
TCCGACTCACAATCAAGGAGACCGCGAAGGCGTACATTCCCGGGTGTTGCTTCCAGGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)240405 - 644
NM_031942 (CDCA7)240642 - 881
Exon 4 To Exon 6 (Pair 10)
Forward (670,23)ATTCCAACTCCGATTCAGAAGATAmplicon SizecDNA: 216 bpgenomic: 1,470
Reverse (885,21)GGTTTCTCCTGGAAGCAACACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-1.912 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceATTCCAACTCCGATTCAGAAGATGAAAGTGGAATGAATTTTTTGGAGAAAAGGGCTTTAA
ATATAAAGCAAAACAAAGCAATGCTTGCAAAACTCATGTCTGAATTAGAAAGCTTCCCTG
GCTCGTTCCGTGGAAGACATCCCCTCCCAGGCTCCGACTCACAATCAAGGAGACCGCGAA
GGCGTACATTCCCGGGTGTTGCTTCCAGGAGAAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)216433 - 648
NM_031942 (CDCA7)216670 - 885
Exon 4 To Exon 6 (Pair 11)
Forward (661,21)CTGTGACTGATTCCAACTCCGAmplicon SizecDNA: 223 bpgenomic: 1,477
Reverse (883,21)TTTCTCCTGGAAGCAACACCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.102 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-2.648 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceCTGTGACTGATTCCAACTCCGATTCAGAAGATGAAAGTGGAATGAATTTTTTGGAGAAAA
GGGCTTTAAATATAAAGCAAAACAAAGCAATGCTTGCAAAACTCATGTCTGAATTAGAAA
GCTTCCCTGGCTCGTTCCGTGGAAGACATCCCCTCCCAGGCTCCGACTCACAATCAAGGA
GACCGCGAAGGCGTACATTCCCGGGTGTTGCTTCCAGGAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)223661 - 883
NM_145810 (CDCA7)223424 - 646
Exon 4 To Exon 6 (Pair 12)
Forward (670,23)ATTCCAACTCCGATTCAGAAGATAmplicon SizecDNA: 214 bpgenomic: 1,468
Reverse (883,21)TTTCTCCTGGAAGCAACACCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-1.912 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceATTCCAACTCCGATTCAGAAGATGAAAGTGGAATGAATTTTTTGGAGAAAAGGGCTTTAA
ATATAAAGCAAAACAAAGCAATGCTTGCAAAACTCATGTCTGAATTAGAAAGCTTCCCTG
GCTCGTTCCGTGGAAGACATCCCCTCCCAGGCTCCGACTCACAATCAAGGAGACCGCGAA
GGCGTACATTCCCGGGTGTTGCTTCCAGGAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)214670 - 883
NM_145810 (CDCA7)214433 - 646
Exon 4 To Exon 6 (Pair 13)
Forward (635,19)AGAGTCCCGCCAGCCCTCAAmplicon SizecDNA: 252 bpgenomic: 1,506
Reverse (886,21)GGGTTTCTCCTGGAAGCAACANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.019 kcal/mol in 3' area
Forward Dimers0.022 kcal/mol
Reverse Loops1.249 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-2.494 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceAGAGTCCCGCCAGCCCTCAGAGAATTCTGTGACTGATTCCAACTCCGATTCAGAAGATGA
AAGTGGAATGAATTTTTTGGAGAAAAGGGCTTTAAATATAAAGCAAAACAAAGCAATGCT
TGCAAAACTCATGTCTGAATTAGAAAGCTTCCCTGGCTCGTTCCGTGGAAGACATCCCCT
CCCAGGCTCCGACTCACAATCAAGGAGACCGCGAAGGCGTACATTCCCGGGTGTTGCTTC
CAGGAGAAACCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)252398 - 649
NM_031942 (CDCA7)252635 - 886
Exon 4 To Exon 6 (Pair 14)
Forward (642,20)CGCCAGCCCTCAGAGAATTCAmplicon SizecDNA: 244 bpgenomic: 1,498
Reverse (885,21)GGTTTCTCCTGGAAGCAACACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol in 3' area
Forward Dimers-1.356 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-2.494 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceCGCCAGCCCTCAGAGAATTCTGTGACTGATTCCAACTCCGATTCAGAAGATGAAAGTGGA
ATGAATTTTTTGGAGAAAAGGGCTTTAAATATAAAGCAAAACAAAGCAATGCTTGCAAAA
CTCATGTCTGAATTAGAAAGCTTCCCTGGCTCGTTCCGTGGAAGACATCCCCTCCCAGGC
TCCGACTCACAATCAAGGAGACCGCGAAGGCGTACATTCCCGGGTGTTGCTTCCAGGAGA
AACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)244405 - 648
NM_031942 (CDCA7)244642 - 885
Exon 4 To Exon 6 (Pair 15)
Forward (670,23)ATTCCAACTCCGATTCAGAAGATAmplicon SizecDNA: 217 bpgenomic: 1,471
Reverse (886,21)GGGTTTCTCCTGGAAGCAACANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops1.249 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-1.912 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceATTCCAACTCCGATTCAGAAGATGAAAGTGGAATGAATTTTTTGGAGAAAAGGGCTTTAA
ATATAAAGCAAAACAAAGCAATGCTTGCAAAACTCATGTCTGAATTAGAAAGCTTCCCTG
GCTCGTTCCGTGGAAGACATCCCCTCCCAGGCTCCGACTCACAATCAAGGAGACCGCGAA
GGCGTACATTCCCGGGTGTTGCTTCCAGGAGAAACCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)217433 - 649
NM_031942 (CDCA7)217670 - 886
Exon 4 To Exon 6 (Pair 16)
Forward (635,19)AGAGTCCCGCCAGCCCTCAAmplicon SizecDNA: 250 bpgenomic: 1,504
Reverse (884,21)GTTTCTCCTGGAAGCAACACCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.019 kcal/mol in 3' area
Forward Dimers0.022 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-2.494 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceAGAGTCCCGCCAGCCCTCAGAGAATTCTGTGACTGATTCCAACTCCGATTCAGAAGATGA
AAGTGGAATGAATTTTTTGGAGAAAAGGGCTTTAAATATAAAGCAAAACAAAGCAATGCT
TGCAAAACTCATGTCTGAATTAGAAAGCTTCCCTGGCTCGTTCCGTGGAAGACATCCCCT
CCCAGGCTCCGACTCACAATCAAGGAGACCGCGAAGGCGTACATTCCCGGGTGTTGCTTC
CAGGAGAAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)250635 - 884
NM_145810 (CDCA7)250398 - 647
Exon 4 To Exon 6 (Pair 17)
Forward (635,19)AGAGTCCCGCCAGCCCTCAAmplicon SizecDNA: 249 bpgenomic: 1,503
Reverse (883,21)TTTCTCCTGGAAGCAACACCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.019 kcal/mol in 3' area
Forward Dimers0.022 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-2.494 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceAGAGTCCCGCCAGCCCTCAGAGAATTCTGTGACTGATTCCAACTCCGATTCAGAAGATGA
AAGTGGAATGAATTTTTTGGAGAAAAGGGCTTTAAATATAAAGCAAAACAAAGCAATGCT
TGCAAAACTCATGTCTGAATTAGAAAGCTTCCCTGGCTCGTTCCGTGGAAGACATCCCCT
CCCAGGCTCCGACTCACAATCAAGGAGACCGCGAAGGCGTACATTCCCGGGTGTTGCTTC
CAGGAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)249398 - 646
NM_031942 (CDCA7)249635 - 883
Exon 4 To Exon 6 (Pair 18)
Forward (669,22)GATTCCAACTCCGATTCAGAAGAmplicon SizecDNA: 219 bpgenomic: 1,473
Reverse (887,21)AGGGTTTCTCCTGGAAGCAACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.279 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops0.829 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-1.912 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceGATTCCAACTCCGATTCAGAAGATGAAAGTGGAATGAATTTTTTGGAGAAAAGGGCTTTA
AATATAAAGCAAAACAAAGCAATGCTTGCAAAACTCATGTCTGAATTAGAAAGCTTCCCT
GGCTCGTTCCGTGGAAGACATCCCCTCCCAGGCTCCGACTCACAATCAAGGAGACCGCGA
AGGCGTACATTCCCGGGTGTTGCTTCCAGGAGAAACCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)219432 - 650
NM_031942 (CDCA7)219669 - 887
Exon 4 To Exon 6 (Pair 19)
Forward (666,22)ACTGATTCCAACTCCGATTCAGAmplicon SizecDNA: 216 bpgenomic: 1,470
Reverse (881,20)TCTCCTGGAAGCAACACCCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.763 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-2.648 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceACTGATTCCAACTCCGATTCAGAAGATGAAAGTGGAATGAATTTTTTGGAGAAAAGGGCT
TTAAATATAAAGCAAAACAAAGCAATGCTTGCAAAACTCATGTCTGAATTAGAAAGCTTC
CCTGGCTCGTTCCGTGGAAGACATCCCCTCCCAGGCTCCGACTCACAATCAAGGAGACCG
CGAAGGCGTACATTCCCGGGTGTTGCTTCCAGGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)216429 - 644
NM_031942 (CDCA7)216666 - 881
Exon 4 To Exon 6 (Pair 20)
Forward (670,23)ATTCCAACTCCGATTCAGAAGATAmplicon SizecDNA: 215 bpgenomic: 1,469
Reverse (884,21)GTTTCTCCTGGAAGCAACACCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-1.912 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceATTCCAACTCCGATTCAGAAGATGAAAGTGGAATGAATTTTTTGGAGAAAAGGGCTTTAA
ATATAAAGCAAAACAAAGCAATGCTTGCAAAACTCATGTCTGAATTAGAAAGCTTCCCTG
GCTCGTTCCGTGGAAGACATCCCCTCCCAGGCTCCGACTCACAATCAAGGAGACCGCGAA
GGCGTACATTCCCGGGTGTTGCTTCCAGGAGAAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)215433 - 647
NM_031942 (CDCA7)215670 - 884
Exon 4 To Exon 6 (Pair 21)
Forward (669,22)GATTCCAACTCCGATTCAGAAGAmplicon SizecDNA: 217 bpgenomic: 1,471
Reverse (885,21)GGTTTCTCCTGGAAGCAACACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.279 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-1.912 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceGATTCCAACTCCGATTCAGAAGATGAAAGTGGAATGAATTTTTTGGAGAAAAGGGCTTTA
AATATAAAGCAAAACAAAGCAATGCTTGCAAAACTCATGTCTGAATTAGAAAGCTTCCCT
GGCTCGTTCCGTGGAAGACATCCCCTCCCAGGCTCCGACTCACAATCAAGGAGACCGCGA
AGGCGTACATTCCCGGGTGTTGCTTCCAGGAGAAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)217432 - 648
NM_031942 (CDCA7)217669 - 885
Exon 4 To Exon 6 (Pair 22)
Forward (642,20)CGCCAGCCCTCAGAGAATTCAmplicon SizecDNA: 243 bpgenomic: 1,497
Reverse (884,21)GTTTCTCCTGGAAGCAACACCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol in 3' area
Forward Dimers-1.356 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-2.494 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceCGCCAGCCCTCAGAGAATTCTGTGACTGATTCCAACTCCGATTCAGAAGATGAAAGTGGA
ATGAATTTTTTGGAGAAAAGGGCTTTAAATATAAAGCAAAACAAAGCAATGCTTGCAAAA
CTCATGTCTGAATTAGAAAGCTTCCCTGGCTCGTTCCGTGGAAGACATCCCCTCCCAGGC
TCCGACTCACAATCAAGGAGACCGCGAAGGCGTACATTCCCGGGTGTTGCTTCCAGGAGA
AAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)243405 - 647
NM_031942 (CDCA7)243642 - 884
Exon 4 To Exon 6 (Pair 23)
Forward (670,23)ATTCCAACTCCGATTCAGAAGATAmplicon SizecDNA: 218 bpgenomic: 1,472
Reverse (887,21)AGGGTTTCTCCTGGAAGCAACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops0.829 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-1.912 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceATTCCAACTCCGATTCAGAAGATGAAAGTGGAATGAATTTTTTGGAGAAAAGGGCTTTAA
ATATAAAGCAAAACAAAGCAATGCTTGCAAAACTCATGTCTGAATTAGAAAGCTTCCCTG
GCTCGTTCCGTGGAAGACATCCCCTCCCAGGCTCCGACTCACAATCAAGGAGACCGCGAA
GGCGTACATTCCCGGGTGTTGCTTCCAGGAGAAACCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)218670 - 887
NM_145810 (CDCA7)218433 - 650
Exon 4 To Exon 6 (Pair 24)
Forward (642,20)CGCCAGCCCTCAGAGAATTCAmplicon SizecDNA: 245 bpgenomic: 1,499
Reverse (886,21)GGGTTTCTCCTGGAAGCAACANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol in 3' area
Forward Dimers-1.356 kcal/mol
Reverse Loops1.249 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-2.494 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceCGCCAGCCCTCAGAGAATTCTGTGACTGATTCCAACTCCGATTCAGAAGATGAAAGTGGA
ATGAATTTTTTGGAGAAAAGGGCTTTAAATATAAAGCAAAACAAAGCAATGCTTGCAAAA
CTCATGTCTGAATTAGAAAGCTTCCCTGGCTCGTTCCGTGGAAGACATCCCCTCCCAGGC
TCCGACTCACAATCAAGGAGACCGCGAAGGCGTACATTCCCGGGTGTTGCTTCCAGGAGA
AACCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)245642 - 886
NM_145810 (CDCA7)245405 - 649
Exon 4 To Exon 6 (Pair 25)
Forward (669,22)GATTCCAACTCCGATTCAGAAGAmplicon SizecDNA: 216 bpgenomic: 1,470
Reverse (884,21)GTTTCTCCTGGAAGCAACACCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.279 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-1.912 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceGATTCCAACTCCGATTCAGAAGATGAAAGTGGAATGAATTTTTTGGAGAAAAGGGCTTTA
AATATAAAGCAAAACAAAGCAATGCTTGCAAAACTCATGTCTGAATTAGAAAGCTTCCCT
GGCTCGTTCCGTGGAAGACATCCCCTCCCAGGCTCCGACTCACAATCAAGGAGACCGCGA
AGGCGTACATTCCCGGGTGTTGCTTCCAGGAGAAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)216669 - 884
NM_145810 (CDCA7)216432 - 647
Exon 4 To Exon 6 (Pair 26)
Forward (670,23)ATTCCAACTCCGATTCAGAAGATAmplicon SizecDNA: 212 bpgenomic: 1,466
Reverse (881,20)TCTCCTGGAAGCAACACCCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-1.912 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceATTCCAACTCCGATTCAGAAGATGAAAGTGGAATGAATTTTTTGGAGAAAAGGGCTTTAA
ATATAAAGCAAAACAAAGCAATGCTTGCAAAACTCATGTCTGAATTAGAAAGCTTCCCTG
GCTCGTTCCGTGGAAGACATCCCCTCCCAGGCTCCGACTCACAATCAAGGAGACCGCGAA
GGCGTACATTCCCGGGTGTTGCTTCCAGGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)212433 - 644
NM_031942 (CDCA7)212670 - 881
Exon 4 To Exon 6 (Pair 27)
Forward (665,22)GACTGATTCCAACTCCGATTCAAmplicon SizecDNA: 217 bpgenomic: 1,471
Reverse (881,20)TCTCCTGGAAGCAACACCCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.102 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-2.648 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceGACTGATTCCAACTCCGATTCAGAAGATGAAAGTGGAATGAATTTTTTGGAGAAAAGGGC
TTTAAATATAAAGCAAAACAAAGCAATGCTTGCAAAACTCATGTCTGAATTAGAAAGCTT
CCCTGGCTCGTTCCGTGGAAGACATCCCCTCCCAGGCTCCGACTCACAATCAAGGAGACC
GCGAAGGCGTACATTCCCGGGTGTTGCTTCCAGGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)217665 - 881
NM_145810 (CDCA7)217428 - 644
Exon 4 To Exon 6 (Pair 28)
Forward (659,22)TTCTGTGACTGATTCCAACTCCAmplicon SizecDNA: 225 bpgenomic: 1,479
Reverse (883,21)TTTCTCCTGGAAGCAACACCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.102 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-2.648 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceTTCTGTGACTGATTCCAACTCCGATTCAGAAGATGAAAGTGGAATGAATTTTTTGGAGAA
AAGGGCTTTAAATATAAAGCAAAACAAAGCAATGCTTGCAAAACTCATGTCTGAATTAGA
AAGCTTCCCTGGCTCGTTCCGTGGAAGACATCCCCTCCCAGGCTCCGACTCACAATCAAG
GAGACCGCGAAGGCGTACATTCCCGGGTGTTGCTTCCAGGAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)225659 - 883
NM_145810 (CDCA7)225422 - 646
Exon 4 To Exon 6 (Pair 29)
Forward (642,20)CGCCAGCCCTCAGAGAATTCAmplicon SizecDNA: 246 bpgenomic: 1,500
Reverse (887,21)AGGGTTTCTCCTGGAAGCAACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol in 3' area
Forward Dimers-1.356 kcal/mol
Reverse Loops0.829 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-2.592 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceCGCCAGCCCTCAGAGAATTCTGTGACTGATTCCAACTCCGATTCAGAAGATGAAAGTGGA
ATGAATTTTTTGGAGAAAAGGGCTTTAAATATAAAGCAAAACAAAGCAATGCTTGCAAAA
CTCATGTCTGAATTAGAAAGCTTCCCTGGCTCGTTCCGTGGAAGACATCCCCTCCCAGGC
TCCGACTCACAATCAAGGAGACCGCGAAGGCGTACATTCCCGGGTGTTGCTTCCAGGAGA
AACCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)246642 - 887
NM_145810 (CDCA7)246405 - 650
Exon 4 To Exon 6 (Pair 30)
Forward (669,22)GATTCCAACTCCGATTCAGAAGAmplicon SizecDNA: 218 bpgenomic: 1,472
Reverse (886,21)GGGTTTCTCCTGGAAGCAACANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.279 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.249 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-1.912 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceGATTCCAACTCCGATTCAGAAGATGAAAGTGGAATGAATTTTTTGGAGAAAAGGGCTTTA
AATATAAAGCAAAACAAAGCAATGCTTGCAAAACTCATGTCTGAATTAGAAAGCTTCCCT
GGCTCGTTCCGTGGAAGACATCCCCTCCCAGGCTCCGACTCACAATCAAGGAGACCGCGA
AGGCGTACATTCCCGGGTGTTGCTTCCAGGAGAAACCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)218432 - 649
NM_031942 (CDCA7)218669 - 886
Exon 4 To Exon 6 (Pair 31)
Forward (669,22)GATTCCAACTCCGATTCAGAAGAmplicon SizecDNA: 213 bpgenomic: 1,467
Reverse (881,20)TCTCCTGGAAGCAACACCCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.279 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-1.912 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceGATTCCAACTCCGATTCAGAAGATGAAAGTGGAATGAATTTTTTGGAGAAAAGGGCTTTA
AATATAAAGCAAAACAAAGCAATGCTTGCAAAACTCATGTCTGAATTAGAAAGCTTCCCT
GGCTCGTTCCGTGGAAGACATCCCCTCCCAGGCTCCGACTCACAATCAAGGAGACCGCGA
AGGCGTACATTCCCGGGTGTTGCTTCCAGGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)213669 - 881
NM_145810 (CDCA7)213432 - 644
Exon 4 To Exon 6 (Pair 32)
Forward (661,21)CTGTGACTGATTCCAACTCCGAmplicon SizecDNA: 224 bpgenomic: 1,478
Reverse (884,21)GTTTCTCCTGGAAGCAACACCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.102 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-2.648 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceCTGTGACTGATTCCAACTCCGATTCAGAAGATGAAAGTGGAATGAATTTTTTGGAGAAAA
GGGCTTTAAATATAAAGCAAAACAAAGCAATGCTTGCAAAACTCATGTCTGAATTAGAAA
GCTTCCCTGGCTCGTTCCGTGGAAGACATCCCCTCCCAGGCTCCGACTCACAATCAAGGA
GACCGCGAAGGCGTACATTCCCGGGTGTTGCTTCCAGGAGAAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)224424 - 647
NM_031942 (CDCA7)224661 - 884
Exon 4 To Exon 6 (Pair 33)
Forward (666,22)ACTGATTCCAACTCCGATTCAGAmplicon SizecDNA: 219 bpgenomic: 1,473
Reverse (884,21)GTTTCTCCTGGAAGCAACACCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.763 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-2.648 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceACTGATTCCAACTCCGATTCAGAAGATGAAAGTGGAATGAATTTTTTGGAGAAAAGGGCT
TTAAATATAAAGCAAAACAAAGCAATGCTTGCAAAACTCATGTCTGAATTAGAAAGCTTC
CCTGGCTCGTTCCGTGGAAGACATCCCCTCCCAGGCTCCGACTCACAATCAAGGAGACCG
CGAAGGCGTACATTCCCGGGTGTTGCTTCCAGGAGAAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)219666 - 884
NM_145810 (CDCA7)219429 - 647
Exon 4 To Exon 6 (Pair 34)
Forward (659,22)TTCTGTGACTGATTCCAACTCCAmplicon SizecDNA: 226 bpgenomic: 1,480
Reverse (884,21)GTTTCTCCTGGAAGCAACACCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.102 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-2.648 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceTTCTGTGACTGATTCCAACTCCGATTCAGAAGATGAAAGTGGAATGAATTTTTTGGAGAA
AAGGGCTTTAAATATAAAGCAAAACAAAGCAATGCTTGCAAAACTCATGTCTGAATTAGA
AAGCTTCCCTGGCTCGTTCCGTGGAAGACATCCCCTCCCAGGCTCCGACTCACAATCAAG
GAGACCGCGAAGGCGTACATTCCCGGGTGTTGCTTCCAGGAGAAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)226422 - 647
NM_031942 (CDCA7)226659 - 884
Exon 4 To Exon 6 (Pair 35)
Forward (642,20)CGCCAGCCCTCAGAGAATTCAmplicon SizecDNA: 242 bpgenomic: 1,496
Reverse (883,21)TTTCTCCTGGAAGCAACACCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol in 3' area
Forward Dimers-1.356 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-1.792 kcal/mol
Forward-Reverse Dimers-2.494 kcal/mol
Amplicon Folding-1.795 kcal/mol outside primersite
Amplicon SequenceCGCCAGCCCTCAGAGAATTCTGTGACTGATTCCAACTCCGATTCAGAAGATGAAAGTGGA
ATGAATTTTTTGGAGAAAAGGGCTTTAAATATAAAGCAAAACAAAGCAATGCTTGCAAAA
CTCATGTCTGAATTAGAAAGCTTCCCTGGCTCGTTCCGTGGAAGACATCCCCTCCCAGGC
TCCGACTCACAATCAAGGAGACCGCGAAGGCGTACATTCCCGGGTGTTGCTTCCAGGAGA
AA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)242642 - 883
NM_145810 (CDCA7)242405 - 646
Exon 6 To Exon 8 (Pair 1)
Forward (957,20)GAGGAGGAGGAGGAAGAGGAAmplicon SizecDNA: 235 bpgenomic: 1,387
Reverse (1191,22)GACGGCATTGATGACAAGTAGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops999.999 kcal/mol
Forward Dimers1002.55 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-1.064 kcal/mol
Forward-Reverse Dimers0.167 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAGAAAGAGGAAGACCGTGGATGGC
TACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTCCAGATCATCCGTGACCCTTCCG
CATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGAGTTGGAGAACGTCTGCAGCAAT
TCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTACTTGTCATCAATGCCGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)235720 - 954
NM_031942 (CDCA7)235957 - 1191
Exon 6 To Exon 8 (Pair 2)
Forward (953,20)CATGGAGGAGGAGGAGGAAGAmplicon SizecDNA: 242 bpgenomic: 1,394
Reverse (1194,22)TCTGACGGCATTGATGACAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers0.09 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.041 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAGAAAGAGGAAGACCGTGGA
TGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTCCAGATCATCCGTGACCCT
TCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGAGTTGGAGAACGTCTGCAG
CAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTACTTGTCATCAATGCCGTCA
GA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)242953 - 1194
NM_145810 (CDCA7)242716 - 957
Exon 6 To Exon 8 (Pair 3)
Forward (937,20)CCCTTGACGCTCTACCCATGAmplicon SizecDNA: 255 bpgenomic: 1,407
Reverse (1191,22)GACGGCATTGATGACAAGTAGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.47 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-1.064 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAGAA
AGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTCCA
GATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGAGT
TGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTACTT
GTCATCAATGCCGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)255937 - 1191
NM_145810 (CDCA7)255700 - 954
Exon 6 To Exon 8 (Pair 4)
Forward (955,20)TGGAGGAGGAGGAGGAAGAGAmplicon SizecDNA: 237 bpgenomic: 1,389
Reverse (1191,22)GACGGCATTGATGACAAGTAGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops999.711 kcal/mol
Forward Dimers1.896 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-1.064 kcal/mol
Forward-Reverse Dimers0.167 kcal/mol in 3' area
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceTGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAGAAAGAGGAAGACCGTGGATG
GCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTCCAGATCATCCGTGACCCTTC
CGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGAGTTGGAGAACGTCTGCAGCA
ATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTACTTGTCATCAATGCCGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)237955 - 1191
NM_145810 (CDCA7)237718 - 954
Exon 6 To Exon 8 (Pair 5)
Forward (955,20)TGGAGGAGGAGGAGGAAGAGAmplicon SizecDNA: 238 bpgenomic: 1,390
Reverse (1192,22)TGACGGCATTGATGACAAGTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops999.711 kcal/mol
Forward Dimers1.896 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers0.167 kcal/mol in 3' area
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceTGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAGAAAGAGGAAGACCGTGGATG
GCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTCCAGATCATCCGTGACCCTTC
CGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGAGTTGGAGAACGTCTGCAGCA
ATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTACTTGTCATCAATGCCGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)238955 - 1192
NM_145810 (CDCA7)238718 - 955
Exon 6 To Exon 8 (Pair 6)
Forward (937,20)CCCTTGACGCTCTACCCATGAmplicon SizecDNA: 260 bpgenomic: 1,412
Reverse (1196,22)CTTCTGACGGCATTGATGACAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.47 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops1.224 kcal/mol in 3' area
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAGAA
AGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTCCA
GATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGAGT
TGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTACTT
GTCATCAATGCCGTCAGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)260937 - 1196
NM_145810 (CDCA7)260700 - 959
Exon 6 To Exon 8 (Pair 7)
Forward (983,22)CATGTTGGTGAGAAAGAGGAAGAmplicon SizecDNA: 215 bpgenomic: 1,367
Reverse (1197,22)TCTTCTGACGGCATTGATGACANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.832 kcal/mol
Forward Dimers0.222 kcal/mol
Reverse Loops1.224 kcal/mol in 3' area
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.71 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCATGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAG
AAGCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAAT
TACAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTC
ACTGGGCTCTACTTGTCATCAATGCCGTCAGAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)215746 - 960
NM_031942 (CDCA7)215983 - 1197
Exon 6 To Exon 8 (Pair 8)
Forward (935,20)GTCCCTTGACGCTCTACCCAAmplicon SizecDNA: 265 bpgenomic: 1,417
Reverse (1199,22)AGTCTTCTGACGGCATTGATGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.56 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops1.224 kcal/mol in 3' area
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceGTCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAG
AAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTC
CAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGA
GTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTAC
TTGTCATCAATGCCGTCAGAAGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)265935 - 1199
NM_145810 (CDCA7)265698 - 962
Exon 6 To Exon 8 (Pair 9)
Forward (961,22)AGGAGGAGGAAGAGGATAAGTAAmplicon SizecDNA: 237 bpgenomic: 1,389
Reverse (1197,22)TCTTCTGACGGCATTGATGACANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.885 kcal/mol
Forward Dimers-0.046 kcal/mol
Reverse Loops1.224 kcal/mol in 3' area
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.428 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACA
TGAATGAAGATGACCTGCCCAGAAGCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATA
TAATTCGCCCAGTGGAAGAAATTACAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTC
GAGAGAAGATATATAACCGTTCACTGGGCTCTACTTGTCATCAATGCCGTCAGAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)237961 - 1197
NM_145810 (CDCA7)237724 - 960
Exon 6 To Exon 8 (Pair 10)
Forward (983,22)CATGTTGGTGAGAAAGAGGAAGAmplicon SizecDNA: 218 bpgenomic: 1,370
Reverse (1200,22)TAGTCTTCTGACGGCATTGATGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.832 kcal/mol
Forward Dimers0.222 kcal/mol
Reverse Loops1.233 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.71 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCATGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAG
AAGCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAAT
TACAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTC
ACTGGGCTCTACTTGTCATCAATGCCGTCAGAAGACTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)218746 - 963
NM_031942 (CDCA7)218983 - 1200
Exon 6 To Exon 8 (Pair 11)
Forward (935,20)GTCCCTTGACGCTCTACCCAAmplicon SizecDNA: 266 bpgenomic: 1,418
Reverse (1200,22)TAGTCTTCTGACGGCATTGATGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.56 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops1.233 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceGTCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAG
AAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTC
CAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGA
GTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTAC
TTGTCATCAATGCCGTCAGAAGACTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)266935 - 1200
NM_145810 (CDCA7)266698 - 963
Exon 6 To Exon 8 (Pair 12)
Forward (931,20)TCGGGTCCCTTGACGCTCTAAmplicon SizecDNA: 272 bpgenomic: 1,424
Reverse (1202,23)AATAGTCTTCTGACGGCATTGATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.269 kcal/mol
Forward Dimers-1.836 kcal/mol
Reverse Loops1.233 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceTCGGGTCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGG
TGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTC
GCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGG
AGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCT
CTACTTGTCATCAATGCCGTCAGAAGACTATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)272694 - 965
NM_031942 (CDCA7)272931 - 1202
Exon 6 To Exon 8 (Pair 13)
Forward (935,20)GTCCCTTGACGCTCTACCCAAmplicon SizecDNA: 257 bpgenomic: 1,409
Reverse (1191,22)GACGGCATTGATGACAAGTAGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.56 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-1.064 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceGTCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAG
AAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTC
CAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGA
GTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTAC
TTGTCATCAATGCCGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)257935 - 1191
NM_145810 (CDCA7)257698 - 954
Exon 6 To Exon 8 (Pair 14)
Forward (935,20)GTCCCTTGACGCTCTACCCAAmplicon SizecDNA: 258 bpgenomic: 1,410
Reverse (1192,22)TGACGGCATTGATGACAAGTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.56 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceGTCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAG
AAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTC
CAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGA
GTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTAC
TTGTCATCAATGCCGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)258935 - 1192
NM_145810 (CDCA7)258698 - 955
Exon 6 To Exon 8 (Pair 15)
Forward (931,20)TCGGGTCCCTTGACGCTCTAAmplicon SizecDNA: 261 bpgenomic: 1,413
Reverse (1191,22)GACGGCATTGATGACAAGTAGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.269 kcal/mol
Forward Dimers-1.836 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-1.064 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceTCGGGTCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGG
TGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTC
GCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGG
AGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCT
CTACTTGTCATCAATGCCGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)261931 - 1191
NM_145810 (CDCA7)261694 - 954
Exon 6 To Exon 8 (Pair 16)
Forward (935,20)GTCCCTTGACGCTCTACCCAAmplicon SizecDNA: 262 bpgenomic: 1,414
Reverse (1196,22)CTTCTGACGGCATTGATGACAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.56 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops1.224 kcal/mol in 3' area
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceGTCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAG
AAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTC
CAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGA
GTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTAC
TTGTCATCAATGCCGTCAGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)262698 - 959
NM_031942 (CDCA7)262935 - 1196
Exon 6 To Exon 8 (Pair 17)
Forward (931,20)TCGGGTCCCTTGACGCTCTAAmplicon SizecDNA: 269 bpgenomic: 1,421
Reverse (1199,22)AGTCTTCTGACGGCATTGATGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.269 kcal/mol
Forward Dimers-1.836 kcal/mol
Reverse Loops1.224 kcal/mol in 3' area
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceTCGGGTCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGG
TGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTC
GCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGG
AGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCT
CTACTTGTCATCAATGCCGTCAGAAGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)269931 - 1199
NM_145810 (CDCA7)269694 - 962
Exon 6 To Exon 8 (Pair 18)
Forward (935,20)GTCCCTTGACGCTCTACCCAAmplicon SizecDNA: 263 bpgenomic: 1,415
Reverse (1197,22)TCTTCTGACGGCATTGATGACANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.56 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops1.224 kcal/mol in 3' area
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceGTCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAG
AAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTC
CAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGA
GTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTAC
TTGTCATCAATGCCGTCAGAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)263698 - 960
NM_031942 (CDCA7)263935 - 1197
Exon 6 To Exon 8 (Pair 19)
Forward (931,20)TCGGGTCCCTTGACGCTCTAAmplicon SizecDNA: 267 bpgenomic: 1,419
Reverse (1197,22)TCTTCTGACGGCATTGATGACANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.269 kcal/mol
Forward Dimers-1.836 kcal/mol
Reverse Loops1.224 kcal/mol in 3' area
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceTCGGGTCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGG
TGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTC
GCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGG
AGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCT
CTACTTGTCATCAATGCCGTCAGAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)267694 - 960
NM_031942 (CDCA7)267931 - 1197
Exon 6 To Exon 8 (Pair 20)
Forward (983,22)CATGTTGGTGAGAAAGAGGAAGAmplicon SizecDNA: 220 bpgenomic: 1,372
Reverse (1202,23)AATAGTCTTCTGACGGCATTGATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.832 kcal/mol
Forward Dimers0.222 kcal/mol
Reverse Loops1.233 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.71 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCATGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAG
AAGCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAAT
TACAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTC
ACTGGGCTCTACTTGTCATCAATGCCGTCAGAAGACTATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)220746 - 965
NM_031942 (CDCA7)220983 - 1202
Exon 6 To Exon 8 (Pair 21)
Forward (983,22)CATGTTGGTGAGAAAGAGGAAGAmplicon SizecDNA: 209 bpgenomic: 1,361
Reverse (1191,22)GACGGCATTGATGACAAGTAGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.832 kcal/mol
Forward Dimers0.222 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-1.064 kcal/mol
Forward-Reverse Dimers-1.71 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCATGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAG
AAGCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAAT
TACAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTC
ACTGGGCTCTACTTGTCATCAATGCCGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)209746 - 954
NM_031942 (CDCA7)209983 - 1191
Exon 6 To Exon 8 (Pair 22)
Forward (985,22)TGTTGGTGAGAAAGAGGAAGACAmplicon SizecDNA: 213 bpgenomic: 1,365
Reverse (1197,22)TCTTCTGACGGCATTGATGACANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.642 kcal/mol
Forward Dimers0.222 kcal/mol in 3' area
Reverse Loops1.224 kcal/mol in 3' area
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.71 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceTGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAA
GCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTA
CAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCAC
TGGGCTCTACTTGTCATCAATGCCGTCAGAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)213748 - 960
NM_031942 (CDCA7)213985 - 1197
Exon 6 To Exon 8 (Pair 23)
Forward (935,20)GTCCCTTGACGCTCTACCCAAmplicon SizecDNA: 260 bpgenomic: 1,412
Reverse (1194,22)TCTGACGGCATTGATGACAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.56 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceGTCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAG
AAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTC
CAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGA
GTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTAC
TTGTCATCAATGCCGTCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)260935 - 1194
NM_145810 (CDCA7)260698 - 957
Exon 6 To Exon 8 (Pair 24)
Forward (953,20)CATGGAGGAGGAGGAGGAAGAmplicon SizecDNA: 239 bpgenomic: 1,391
Reverse (1191,22)GACGGCATTGATGACAAGTAGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers0.09 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-1.064 kcal/mol
Forward-Reverse Dimers-1.041 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAGAAAGAGGAAGACCGTGGA
TGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTCCAGATCATCCGTGACCCT
TCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGAGTTGGAGAACGTCTGCAG
CAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTACTTGTCATCAATGCCGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)239716 - 954
NM_031942 (CDCA7)239953 - 1191
Exon 6 To Exon 8 (Pair 25)
Forward (985,22)TGTTGGTGAGAAAGAGGAAGACAmplicon SizecDNA: 210 bpgenomic: 1,362
Reverse (1194,22)TCTGACGGCATTGATGACAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.642 kcal/mol
Forward Dimers0.222 kcal/mol in 3' area
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.71 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceTGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAA
GCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTA
CAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCAC
TGGGCTCTACTTGTCATCAATGCCGTCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)210748 - 957
NM_031942 (CDCA7)210985 - 1194
Exon 6 To Exon 8 (Pair 26)
Forward (931,20)TCGGGTCCCTTGACGCTCTAAmplicon SizecDNA: 264 bpgenomic: 1,416
Reverse (1194,22)TCTGACGGCATTGATGACAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.269 kcal/mol
Forward Dimers-1.836 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceTCGGGTCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGG
TGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTC
GCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGG
AGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCT
CTACTTGTCATCAATGCCGTCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)264931 - 1194
NM_145810 (CDCA7)264694 - 957
Exon 6 To Exon 8 (Pair 27)
Forward (924,19)CGGATCCTCGGGTCCCTTGAmplicon SizecDNA: 277 bpgenomic: 1,429
Reverse (1200,22)TAGTCTTCTGACGGCATTGATGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.142 kcal/mol in 3' area
Forward Dimers-2.386 kcal/mol
Reverse Loops1.233 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-0.597 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCGGATCCTCGGGTCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTAC
ATGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGA
AGCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATT
ACAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCA
CTGGGCTCTACTTGTCATCAATGCCGTCAGAAGACTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)277687 - 963
NM_031942 (CDCA7)277924 - 1200
Exon 6 To Exon 8 (Pair 28)
Forward (985,22)TGTTGGTGAGAAAGAGGAAGACAmplicon SizecDNA: 208 bpgenomic: 1,360
Reverse (1192,22)TGACGGCATTGATGACAAGTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.642 kcal/mol
Forward Dimers0.222 kcal/mol in 3' area
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.71 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceTGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAA
GCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTA
CAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCAC
TGGGCTCTACTTGTCATCAATGCCGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)208748 - 955
NM_031942 (CDCA7)208985 - 1192
Exon 6 To Exon 8 (Pair 29)
Forward (953,20)CATGGAGGAGGAGGAGGAAGAmplicon SizecDNA: 241 bpgenomic: 1,393
Reverse (1193,22)CTGACGGCATTGATGACAAGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers0.09 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.041 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAGAAAGAGGAAGACCGTGGA
TGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTCCAGATCATCCGTGACCCT
TCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGAGTTGGAGAACGTCTGCAG
CAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTACTTGTCATCAATGCCGTCA
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)241953 - 1193
NM_145810 (CDCA7)241716 - 956
Exon 6 To Exon 8 (Pair 30)
Forward (985,22)TGTTGGTGAGAAAGAGGAAGACAmplicon SizecDNA: 209 bpgenomic: 1,361
Reverse (1193,22)CTGACGGCATTGATGACAAGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.642 kcal/mol
Forward Dimers0.222 kcal/mol in 3' area
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.71 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceTGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAA
GCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTA
CAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCAC
TGGGCTCTACTTGTCATCAATGCCGTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)209985 - 1193
NM_145810 (CDCA7)209748 - 956
Exon 6 To Exon 8 (Pair 31)
Forward (961,22)AGGAGGAGGAAGAGGATAAGTAAmplicon SizecDNA: 239 bpgenomic: 1,391
Reverse (1199,22)AGTCTTCTGACGGCATTGATGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.885 kcal/mol
Forward Dimers-0.046 kcal/mol
Reverse Loops1.224 kcal/mol in 3' area
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.428 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACA
TGAATGAAGATGACCTGCCCAGAAGCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATA
TAATTCGCCCAGTGGAAGAAATTACAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTC
GAGAGAAGATATATAACCGTTCACTGGGCTCTACTTGTCATCAATGCCGTCAGAAGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)239961 - 1199
NM_145810 (CDCA7)239724 - 962
Exon 6 To Exon 8 (Pair 32)
Forward (985,22)TGTTGGTGAGAAAGAGGAAGACAmplicon SizecDNA: 211 bpgenomic: 1,363
Reverse (1195,22)TTCTGACGGCATTGATGACAAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.642 kcal/mol
Forward Dimers0.222 kcal/mol in 3' area
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.71 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceTGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAA
GCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTA
CAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCAC
TGGGCTCTACTTGTCATCAATGCCGTCAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)211985 - 1195
NM_145810 (CDCA7)211748 - 958
Exon 6 To Exon 8 (Pair 33)
Forward (961,22)AGGAGGAGGAAGAGGATAAGTAAmplicon SizecDNA: 235 bpgenomic: 1,387
Reverse (1195,22)TTCTGACGGCATTGATGACAAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.885 kcal/mol
Forward Dimers-0.046 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-0.826 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACA
TGAATGAAGATGACCTGCCCAGAAGCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATA
TAATTCGCCCAGTGGAAGAAATTACAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTC
GAGAGAAGATATATAACCGTTCACTGGGCTCTACTTGTCATCAATGCCGTCAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)235961 - 1195
NM_145810 (CDCA7)235724 - 958
Exon 6 To Exon 8 (Pair 34)
Forward (931,20)TCGGGTCCCTTGACGCTCTAAmplicon SizecDNA: 265 bpgenomic: 1,417
Reverse (1195,22)TTCTGACGGCATTGATGACAAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.269 kcal/mol
Forward Dimers-1.836 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceTCGGGTCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGG
TGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTC
GCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGG
AGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCT
CTACTTGTCATCAATGCCGTCAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)265931 - 1195
NM_145810 (CDCA7)265694 - 958
Exon 6 To Exon 8 (Pair 35)
Forward (937,20)CCCTTGACGCTCTACCCATGAmplicon SizecDNA: 256 bpgenomic: 1,408
Reverse (1192,22)TGACGGCATTGATGACAAGTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.47 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAGAA
AGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTCCA
GATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGAGT
TGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTACTT
GTCATCAATGCCGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)256700 - 955
NM_031942 (CDCA7)256937 - 1192
Exon 6 To Exon 8 (Pair 36)
Forward (953,20)CATGGAGGAGGAGGAGGAAGAmplicon SizecDNA: 248 bpgenomic: 1,400
Reverse (1200,22)TAGTCTTCTGACGGCATTGATGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers0.09 kcal/mol
Reverse Loops1.233 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-0.785 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAGAAAGAGGAAGACCGTGGA
TGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTCCAGATCATCCGTGACCCT
TCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGAGTTGGAGAACGTCTGCAG
CAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTACTTGTCATCAATGCCGTCA
GAAGACTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)248953 - 1200
NM_145810 (CDCA7)248716 - 963
Exon 6 To Exon 8 (Pair 37)
Forward (983,22)CATGTTGGTGAGAAAGAGGAAGAmplicon SizecDNA: 213 bpgenomic: 1,365
Reverse (1195,22)TTCTGACGGCATTGATGACAAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.832 kcal/mol
Forward Dimers0.222 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.71 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCATGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAG
AAGCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAAT
TACAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTC
ACTGGGCTCTACTTGTCATCAATGCCGTCAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)213746 - 958
NM_031942 (CDCA7)213983 - 1195
Exon 6 To Exon 8 (Pair 38)
Forward (935,20)GTCCCTTGACGCTCTACCCAAmplicon SizecDNA: 261 bpgenomic: 1,413
Reverse (1195,22)TTCTGACGGCATTGATGACAAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.56 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceGTCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAG
AAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTC
CAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGA
GTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTAC
TTGTCATCAATGCCGTCAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)261698 - 958
NM_031942 (CDCA7)261935 - 1195
Exon 6 To Exon 8 (Pair 39)
Forward (931,20)TCGGGTCCCTTGACGCTCTAAmplicon SizecDNA: 263 bpgenomic: 1,415
Reverse (1193,22)CTGACGGCATTGATGACAAGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.269 kcal/mol
Forward Dimers-1.836 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceTCGGGTCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGG
TGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTC
GCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGG
AGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCT
CTACTTGTCATCAATGCCGTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)263931 - 1193
NM_145810 (CDCA7)263694 - 956
Exon 6 To Exon 8 (Pair 40)
Forward (953,20)CATGGAGGAGGAGGAGGAAGAmplicon SizecDNA: 243 bpgenomic: 1,395
Reverse (1195,22)TTCTGACGGCATTGATGACAAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers0.09 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.041 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAGAAAGAGGAAGACCGTGGA
TGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTCCAGATCATCCGTGACCCT
TCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGAGTTGGAGAACGTCTGCAG
CAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTACTTGTCATCAATGCCGTCA
GAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)243953 - 1195
NM_145810 (CDCA7)243716 - 958
Exon 6 To Exon 8 (Pair 41)
Forward (961,22)AGGAGGAGGAAGAGGATAAGTAAmplicon SizecDNA: 234 bpgenomic: 1,386
Reverse (1194,22)TCTGACGGCATTGATGACAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.885 kcal/mol
Forward Dimers-0.046 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-0.826 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACA
TGAATGAAGATGACCTGCCCAGAAGCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATA
TAATTCGCCCAGTGGAAGAAATTACAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTC
GAGAGAAGATATATAACCGTTCACTGGGCTCTACTTGTCATCAATGCCGTCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)234961 - 1194
NM_145810 (CDCA7)234724 - 957
Exon 6 To Exon 8 (Pair 42)
Forward (937,20)CCCTTGACGCTCTACCCATGAmplicon SizecDNA: 261 bpgenomic: 1,413
Reverse (1197,22)TCTTCTGACGGCATTGATGACANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.47 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops1.224 kcal/mol in 3' area
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAGAA
AGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTCCA
GATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGAGT
TGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTACTT
GTCATCAATGCCGTCAGAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)261937 - 1197
NM_145810 (CDCA7)261700 - 960
Exon 6 To Exon 8 (Pair 43)
Forward (961,22)AGGAGGAGGAAGAGGATAAGTAAmplicon SizecDNA: 236 bpgenomic: 1,388
Reverse (1196,22)CTTCTGACGGCATTGATGACAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.885 kcal/mol
Forward Dimers-0.046 kcal/mol
Reverse Loops1.224 kcal/mol in 3' area
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.123 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACA
TGAATGAAGATGACCTGCCCAGAAGCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATA
TAATTCGCCCAGTGGAAGAAATTACAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTC
GAGAGAAGATATATAACCGTTCACTGGGCTCTACTTGTCATCAATGCCGTCAGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)236961 - 1196
NM_145810 (CDCA7)236724 - 959
Exon 6 To Exon 8 (Pair 44)
Forward (983,22)CATGTTGGTGAGAAAGAGGAAGAmplicon SizecDNA: 211 bpgenomic: 1,363
Reverse (1193,22)CTGACGGCATTGATGACAAGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.832 kcal/mol
Forward Dimers0.222 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.71 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCATGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAG
AAGCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAAT
TACAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTC
ACTGGGCTCTACTTGTCATCAATGCCGTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)211983 - 1193
NM_145810 (CDCA7)211746 - 956
Exon 6 To Exon 8 (Pair 45)
Forward (937,20)CCCTTGACGCTCTACCCATGAmplicon SizecDNA: 257 bpgenomic: 1,409
Reverse (1193,22)CTGACGGCATTGATGACAAGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.47 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAGAA
AGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTCCA
GATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGAGT
TGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTACTT
GTCATCAATGCCGTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)257700 - 956
NM_031942 (CDCA7)257937 - 1193
Exon 6 To Exon 8 (Pair 46)
Forward (985,22)TGTTGGTGAGAAAGAGGAAGACAmplicon SizecDNA: 207 bpgenomic: 1,359
Reverse (1191,22)GACGGCATTGATGACAAGTAGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.642 kcal/mol
Forward Dimers0.222 kcal/mol in 3' area
Reverse Loops1.224 kcal/mol
Reverse Dimers-1.064 kcal/mol
Forward-Reverse Dimers-1.71 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceTGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAA
GCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTA
CAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCAC
TGGGCTCTACTTGTCATCAATGCCGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)207985 - 1191
NM_145810 (CDCA7)207748 - 954
Exon 6 To Exon 8 (Pair 47)
Forward (931,20)TCGGGTCCCTTGACGCTCTAAmplicon SizecDNA: 266 bpgenomic: 1,418
Reverse (1196,22)CTTCTGACGGCATTGATGACAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.269 kcal/mol
Forward Dimers-1.836 kcal/mol
Reverse Loops1.224 kcal/mol in 3' area
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceTCGGGTCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGG
TGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTC
GCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGG
AGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCT
CTACTTGTCATCAATGCCGTCAGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)266694 - 959
NM_031942 (CDCA7)266931 - 1196
Exon 6 To Exon 8 (Pair 48)
Forward (924,19)CGGATCCTCGGGTCCCTTGAmplicon SizecDNA: 276 bpgenomic: 1,428
Reverse (1199,22)AGTCTTCTGACGGCATTGATGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.142 kcal/mol in 3' area
Forward Dimers-2.386 kcal/mol
Reverse Loops1.224 kcal/mol in 3' area
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-0.597 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCGGATCCTCGGGTCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTAC
ATGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGA
AGCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATT
ACAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCA
CTGGGCTCTACTTGTCATCAATGCCGTCAGAAGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)276687 - 962
NM_031942 (CDCA7)276924 - 1199
Exon 6 To Exon 8 (Pair 49)
Forward (953,20)CATGGAGGAGGAGGAGGAAGAmplicon SizecDNA: 240 bpgenomic: 1,392
Reverse (1192,22)TGACGGCATTGATGACAAGTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops999.188 kcal/mol
Forward Dimers0.09 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.041 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAGAAAGAGGAAGACCGTGGA
TGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTCCAGATCATCCGTGACCCT
TCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGAGTTGGAGAACGTCTGCAG
CAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTACTTGTCATCAATGCCGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)240716 - 955
NM_031942 (CDCA7)240953 - 1192
Exon 6 To Exon 8 (Pair 50)
Forward (985,22)TGTTGGTGAGAAAGAGGAAGACAmplicon SizecDNA: 212 bpgenomic: 1,364
Reverse (1196,22)CTTCTGACGGCATTGATGACAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.642 kcal/mol
Forward Dimers0.222 kcal/mol in 3' area
Reverse Loops1.224 kcal/mol in 3' area
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.71 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceTGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAA
GCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTA
CAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCAC
TGGGCTCTACTTGTCATCAATGCCGTCAGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)212985 - 1196
NM_145810 (CDCA7)212748 - 959
Exon 6 To Exon 8 (Pair 51)
Forward (931,20)TCGGGTCCCTTGACGCTCTAAmplicon SizecDNA: 262 bpgenomic: 1,414
Reverse (1192,22)TGACGGCATTGATGACAAGTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.269 kcal/mol
Forward Dimers-1.836 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceTCGGGTCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGG
TGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTC
GCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGG
AGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCT
CTACTTGTCATCAATGCCGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)262694 - 955
NM_031942 (CDCA7)262931 - 1192
Exon 6 To Exon 8 (Pair 52)
Forward (983,22)CATGTTGGTGAGAAAGAGGAAGAmplicon SizecDNA: 210 bpgenomic: 1,362
Reverse (1192,22)TGACGGCATTGATGACAAGTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.832 kcal/mol
Forward Dimers0.222 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.71 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCATGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAG
AAGCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAAT
TACAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTC
ACTGGGCTCTACTTGTCATCAATGCCGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)210746 - 955
NM_031942 (CDCA7)210983 - 1192
Exon 6 To Exon 8 (Pair 53)
Forward (961,22)AGGAGGAGGAAGAGGATAAGTAAmplicon SizecDNA: 240 bpgenomic: 1,392
Reverse (1200,22)TAGTCTTCTGACGGCATTGATGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.885 kcal/mol
Forward Dimers-0.046 kcal/mol
Reverse Loops1.233 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.428 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACA
TGAATGAAGATGACCTGCCCAGAAGCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATA
TAATTCGCCCAGTGGAAGAAATTACAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTC
GAGAGAAGATATATAACCGTTCACTGGGCTCTACTTGTCATCAATGCCGTCAGAAGACTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)240724 - 963
NM_031942 (CDCA7)240961 - 1200
Exon 6 To Exon 8 (Pair 54)
Forward (924,19)CGGATCCTCGGGTCCCTTGAmplicon SizecDNA: 279 bpgenomic: 1,431
Reverse (1202,23)AATAGTCTTCTGACGGCATTGATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.142 kcal/mol in 3' area
Forward Dimers-2.386 kcal/mol
Reverse Loops1.233 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-0.597 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCGGATCCTCGGGTCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTAC
ATGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGA
AGCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATT
ACAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCA
CTGGGCTCTACTTGTCATCAATGCCGTCAGAAGACTATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)279924 - 1202
NM_145810 (CDCA7)279687 - 965
Exon 6 To Exon 8 (Pair 55)
Forward (937,20)CCCTTGACGCTCTACCCATGAmplicon SizecDNA: 258 bpgenomic: 1,410
Reverse (1194,22)TCTGACGGCATTGATGACAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.47 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAGAA
AGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTCCA
GATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGAGT
TGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTACTT
GTCATCAATGCCGTCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)258700 - 957
NM_031942 (CDCA7)258937 - 1194
Exon 6 To Exon 8 (Pair 56)
Forward (937,20)CCCTTGACGCTCTACCCATGAmplicon SizecDNA: 264 bpgenomic: 1,416
Reverse (1200,22)TAGTCTTCTGACGGCATTGATGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.47 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops1.233 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAGAA
AGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTCCA
GATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGAGT
TGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTACTT
GTCATCAATGCCGTCAGAAGACTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)264937 - 1200
NM_145810 (CDCA7)264700 - 963
Exon 6 To Exon 8 (Pair 57)
Forward (937,20)CCCTTGACGCTCTACCCATGAmplicon SizecDNA: 263 bpgenomic: 1,415
Reverse (1199,22)AGTCTTCTGACGGCATTGATGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.47 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops1.224 kcal/mol in 3' area
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAGAA
AGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTCCA
GATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGAGT
TGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTACTT
GTCATCAATGCCGTCAGAAGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)263937 - 1199
NM_145810 (CDCA7)263700 - 962
Exon 6 To Exon 8 (Pair 58)
Forward (983,22)CATGTTGGTGAGAAAGAGGAAGAmplicon SizecDNA: 212 bpgenomic: 1,364
Reverse (1194,22)TCTGACGGCATTGATGACAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.832 kcal/mol
Forward Dimers0.222 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.71 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCATGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAG
AAGCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAAT
TACAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTC
ACTGGGCTCTACTTGTCATCAATGCCGTCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)212746 - 957
NM_031942 (CDCA7)212983 - 1194
Exon 6 To Exon 8 (Pair 59)
Forward (935,20)GTCCCTTGACGCTCTACCCAAmplicon SizecDNA: 259 bpgenomic: 1,411
Reverse (1193,22)CTGACGGCATTGATGACAAGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.56 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceGTCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAG
AAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTC
CAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGA
GTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTAC
TTGTCATCAATGCCGTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)259935 - 1193
NM_145810 (CDCA7)259698 - 956
Exon 6 To Exon 8 (Pair 60)
Forward (935,20)GTCCCTTGACGCTCTACCCAAmplicon SizecDNA: 268 bpgenomic: 1,420
Reverse (1202,23)AATAGTCTTCTGACGGCATTGATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.56 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops1.233 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceGTCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAG
AAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTC
CAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGA
GTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTAC
TTGTCATCAATGCCGTCAGAAGACTATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)268935 - 1202
NM_145810 (CDCA7)268698 - 965
Exon 6 To Exon 8 (Pair 61)
Forward (983,22)CATGTTGGTGAGAAAGAGGAAGAmplicon SizecDNA: 214 bpgenomic: 1,366
Reverse (1196,22)CTTCTGACGGCATTGATGACAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.832 kcal/mol
Forward Dimers0.222 kcal/mol
Reverse Loops1.224 kcal/mol in 3' area
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.71 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCATGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAG
AAGCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAAT
TACAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTC
ACTGGGCTCTACTTGTCATCAATGCCGTCAGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)214746 - 959
NM_031942 (CDCA7)214983 - 1196
Exon 6 To Exon 8 (Pair 62)
Forward (957,20)GAGGAGGAGGAGGAAGAGGAAmplicon SizecDNA: 236 bpgenomic: 1,388
Reverse (1192,22)TGACGGCATTGATGACAAGTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops999.999 kcal/mol
Forward Dimers1002.55 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers0.167 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAGAAAGAGGAAGACCGTGGATGGC
TACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTCCAGATCATCCGTGACCCTTCCG
CATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGAGTTGGAGAACGTCTGCAGCAAT
TCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTACTTGTCATCAATGCCGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031942 (CDCA7)236957 - 1192
NM_145810 (CDCA7)236720 - 955
Exon 6 To Exon 8 (Pair 63)
Forward (983,22)CATGTTGGTGAGAAAGAGGAAGAmplicon SizecDNA: 217 bpgenomic: 1,369
Reverse (1199,22)AGTCTTCTGACGGCATTGATGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.832 kcal/mol
Forward Dimers0.222 kcal/mol
Reverse Loops1.224 kcal/mol in 3' area
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.71 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCATGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAG
AAGCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAAT
TACAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTC
ACTGGGCTCTACTTGTCATCAATGCCGTCAGAAGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)217746 - 962
NM_031942 (CDCA7)217983 - 1199
Exon 6 To Exon 8 (Pair 64)
Forward (937,20)CCCTTGACGCTCTACCCATGAmplicon SizecDNA: 259 bpgenomic: 1,411
Reverse (1195,22)TTCTGACGGCATTGATGACAAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.47 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAGAA
AGAGGAAGACCGTGGATGGCTACATGAATGAAGATGACCTGCCCAGAAGCCGTCGCTCCA
GATCATCCGTGACCCTTCCGCATATAATTCGCCCAGTGGAAGAAATTACAGAGGAGGAGT
TGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATATATAACCGTTCACTGGGCTCTACTT
GTCATCAATGCCGTCAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)259700 - 958
NM_031942 (CDCA7)259937 - 1195
Exon 6 To Exon 8 (Pair 65)
Forward (961,22)AGGAGGAGGAAGAGGATAAGTAAmplicon SizecDNA: 242 bpgenomic: 1,394
Reverse (1202,23)AATAGTCTTCTGACGGCATTGATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.885 kcal/mol
Forward Dimers-0.046 kcal/mol
Reverse Loops1.233 kcal/mol
Reverse Dimers-2.428 kcal/mol
Forward-Reverse Dimers-1.428 kcal/mol
Amplicon Folding-1.134 kcal/mol outside primersite
Amplicon SequenceAGGAGGAGGAAGAGGATAAGTACATGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACA
TGAATGAAGATGACCTGCCCAGAAGCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATA
TAATTCGCCCAGTGGAAGAAATTACAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTC
GAGAGAAGATATATAACCGTTCACTGGGCTCTACTTGTCATCAATGCCGTCAGAAGACTA
TT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_145810 (CDCA7)242724 - 965
NM_031942 (CDCA7)242961 - 1202
 

See below for some more details.

Program Output:

Loading ...