Design Results for CHDH

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 3 (Pair 1)
Forward (313,22)CAATCACAAAGAGTGTGTAGGCAmplicon SizecDNA: 144 bpgenomic: 17,005
Reverse (456,22)TAGGAGACACCACATGCTTCTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.196 kcal/mol
Forward Dimers-0.611 kcal/mol
Reverse Loops0.827 kcal/mol
Reverse Dimers-1.092 kcal/mol
Forward-Reverse Dimers-2.07 kcal/mol
Amplicon Folding-1.171 kcal/mol outside primersite
Amplicon SequenceCAATCACAAAGAGTGTGTAGGCCAGCCCCGGTCACAGAGTGCACCGTATCCTGTCACTTC
TGGATGTGAGGGAGAAGTGAGTCATCTCATTCCCCTCCGTGGATCAGAGGACTTGGACTA
GATAGAAGCATGTGGTGTCTCCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018397 (CHDH)144313 - 456
Exon 2 To Exon 3 (Pair 2)
Forward (313,22)CAATCACAAAGAGTGTGTAGGCAmplicon SizecDNA: 133 bpgenomic: 16,994
Reverse (445,23)ACATGCTTCTATCTAGTCCAAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.196 kcal/mol
Forward Dimers-0.611 kcal/mol
Reverse Loops2.399 kcal/mol
Reverse Dimers-1.092 kcal/mol
Forward-Reverse Dimers-1.452 kcal/mol
Amplicon Folding-1.171 kcal/mol outside primersite
Amplicon SequenceCAATCACAAAGAGTGTGTAGGCCAGCCCCGGTCACAGAGTGCACCGTATCCTGTCACTTC
TGGATGTGAGGGAGAAGTGAGTCATCTCATTCCCCTCCGTGGATCAGAGGACTTGGACTA
GATAGAAGCATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018397 (CHDH)133313 - 445
Exon 2 To Exon 3 (Pair 3)
Forward (313,22)CAATCACAAAGAGTGTGTAGGCAmplicon SizecDNA: 139 bpgenomic: 17,000
Reverse (451,22)GACACCACATGCTTCTATCTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.196 kcal/mol
Forward Dimers-0.611 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-1.092 kcal/mol
Forward-Reverse Dimers-2.07 kcal/mol
Amplicon Folding-1.171 kcal/mol outside primersite
Amplicon SequenceCAATCACAAAGAGTGTGTAGGCCAGCCCCGGTCACAGAGTGCACCGTATCCTGTCACTTC
TGGATGTGAGGGAGAAGTGAGTCATCTCATTCCCCTCCGTGGATCAGAGGACTTGGACTA
GATAGAAGCATGTGGTGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018397 (CHDH)139313 - 451
Exon 2 To Exon 3 (Pair 4)
Forward (313,22)CAATCACAAAGAGTGTGTAGGCAmplicon SizecDNA: 143 bpgenomic: 17,004
Reverse (455,22)AGGAGACACCACATGCTTCTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.196 kcal/mol
Forward Dimers-0.611 kcal/mol
Reverse Loops0.827 kcal/mol
Reverse Dimers-1.092 kcal/mol
Forward-Reverse Dimers-2.07 kcal/mol
Amplicon Folding-1.171 kcal/mol outside primersite
Amplicon SequenceCAATCACAAAGAGTGTGTAGGCCAGCCCCGGTCACAGAGTGCACCGTATCCTGTCACTTC
TGGATGTGAGGGAGAAGTGAGTCATCTCATTCCCCTCCGTGGATCAGAGGACTTGGACTA
GATAGAAGCATGTGGTGTCTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018397 (CHDH)143313 - 455
Exon 2 To Exon 3 (Pair 5)
Forward (313,22)CAATCACAAAGAGTGTGTAGGCAmplicon SizecDNA: 141 bpgenomic: 17,002
Reverse (453,22)GAGACACCACATGCTTCTATCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.196 kcal/mol
Forward Dimers-0.611 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-1.092 kcal/mol
Forward-Reverse Dimers-2.07 kcal/mol
Amplicon Folding-1.171 kcal/mol outside primersite
Amplicon SequenceCAATCACAAAGAGTGTGTAGGCCAGCCCCGGTCACAGAGTGCACCGTATCCTGTCACTTC
TGGATGTGAGGGAGAAGTGAGTCATCTCATTCCCCTCCGTGGATCAGAGGACTTGGACTA
GATAGAAGCATGTGGTGTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018397 (CHDH)141313 - 453
 

See below for some more details.

Program Output:

Loading ...