Design Results for CSNK2A1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size1500

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 1 To Exon 3 (Pair 1)
Forward (148,19)CGCTGCCGCTTCCACCACAAmplicon SizecDNA: 228 bpgenomic: 35,122
Reverse (375,22)CAAAGCTGGACTTGATGTTTGGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.51 kcal/mol
Forward Dimers-0.484 kcal/mol
Reverse Loops0.432 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.102 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceCGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGT
AAATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACT
AGTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGC
TTCTGAACACAGTGACTGCCAGATCTCCAAACATCAAGTCCAGCTTTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)228148 - 375
NM_001895 (CSNK2A1)111148 - 258
NM_001256686 ()112109 - 220
Exon 1 To Exon 3 (Pair 2)
Forward (149,19)GCTGCCGCTTCCACCACAGAmplicon SizecDNA: 227 bpgenomic: 35,121
Reverse (375,22)CAAAGCTGGACTTGATGTTTGGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.558 kcal/mol
Forward Dimers-0.39 kcal/mol
Reverse Loops0.432 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.102 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGTA
AATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACTA
GTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGCT
TCTGAACACAGTGACTGCCAGATCTCCAAACATCAAGTCCAGCTTTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)227149 - 375
NM_001895 (CSNK2A1)110149 - 258
NM_001256686 ()111110 - 220
Exon 1 To Exon 3 (Pair 1)
Forward (148,19)CGCTGCCGCTTCCACCACAAmplicon SizecDNA: 228 bpgenomic: 35,122
Reverse (375,22)CAAAGCTGGACTTGATGTTTGGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.51 kcal/mol
Forward Dimers-0.484 kcal/mol
Reverse Loops0.432 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.102 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceCGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGT
AAATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACT
AGTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGC
TTCTGAACACAGTGACTGCCAGATCTCCAAACATCAAGTCCAGCTTTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)228148 - 375
NM_001895 (CSNK2A1)111148 - 258
NM_001256686 ()112109 - 220
Exon 1 To Exon 3 (Pair 2)
Forward (149,19)GCTGCCGCTTCCACCACAGAmplicon SizecDNA: 227 bpgenomic: 35,121
Reverse (375,22)CAAAGCTGGACTTGATGTTTGGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.558 kcal/mol
Forward Dimers-0.39 kcal/mol
Reverse Loops0.432 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.102 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGTA
AATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACTA
GTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGCT
TCTGAACACAGTGACTGCCAGATCTCCAAACATCAAGTCCAGCTTTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)227149 - 375
NM_001895 (CSNK2A1)110149 - 258
NM_001256686 ()111110 - 220
Exon 3 To Exon 6 (Pair 1)
Forward (460,22)TACTGGGATTACGAGTCACATGAmplicon SizecDNA: 294 bpgenomic: 9,225
Reverse (753,23)GTCTGTGTTGTTTACGTGTTCAANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.363 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.988 kcal/mol
Reverse Dimers-2.184 kcal/mol
Forward-Reverse Dimers-2.381 kcal/mol
Amplicon Folding0.066 kcal/mol outside primersite
Amplicon SequenceTACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGGTT
CGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATAAT
GAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAATA
AAGATTTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAA
GACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)294460 - 753
NM_001895 (CSNK2A1)294343 - 636
NM_001256686 ()294305 - 598
Exon 3 To Exon 6 (Pair 2)
Forward (460,22)TACTGGGATTACGAGTCACATGAmplicon SizecDNA: 295 bpgenomic: 9,226
Reverse (754,23)AGTCTGTGTTGTTTACGTGTTCANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.363 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.988 kcal/mol
Reverse Dimers-2.184 kcal/mol
Forward-Reverse Dimers-2.381 kcal/mol
Amplicon Folding0.066 kcal/mol outside primersite
Amplicon SequenceTACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGGTT
CGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATAAT
GAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAATA
AAGATTTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAA
GACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001256686 ()295305 - 599
NM_001895 (CSNK2A1)295343 - 637
NM_177559 (CSNK2A1)295460 - 754
Exon 3 To Exon 6 (Pair 3)
Forward (457,22)GAATACTGGGATTACGAGTCACAmplicon SizecDNA: 297 bpgenomic: 9,228
Reverse (753,23)GTCTGTGTTGTTTACGTGTTCAANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.988 kcal/mol
Reverse Dimers-2.184 kcal/mol
Forward-Reverse Dimers-2.381 kcal/mol
Amplicon Folding0.066 kcal/mol outside primersite
Amplicon SequenceGAATACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTG
GTTCGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAAT
AATGAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAA
ATAAAGATTTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTA
AAAGACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001256686 ()297302 - 598
NM_001895 (CSNK2A1)297340 - 636
NM_177559 (CSNK2A1)297457 - 753
Exon 3 To Exon 6 (Pair 4)
Forward (458,23)AATACTGGGATTACGAGTCACATAmplicon SizecDNA: 296 bpgenomic: 9,227
Reverse (753,23)GTCTGTGTTGTTTACGTGTTCAANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.363 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.988 kcal/mol
Reverse Dimers-2.184 kcal/mol
Forward-Reverse Dimers-2.381 kcal/mol
Amplicon Folding0.066 kcal/mol outside primersite
Amplicon SequenceAATACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGG
TTCGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATA
ATGAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAA
TAAAGATTTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAA
AAGACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001895 (CSNK2A1)296341 - 636
NM_001256686 ()296303 - 598
NM_177559 (CSNK2A1)296458 - 753
Exon 3 To Exon 4 (Pair 1)
Forward (350,22)ATCTCCAAACATCAAGTCCAGCAmplicon SizecDNA: 202 bpgenomic: 3,423
Reverse (551,22)ACTTCACTGTATTTACCTCGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.638 kcal/mol
Forward Dimers-0.239 kcal/mol
Reverse Loops2.216 kcal/mol
Reverse Dimers-0.692 kcal/mol
Forward-Reverse Dimers-1.699 kcal/mol
Amplicon Folding-0.108 kcal/mol outside primersite
Amplicon SequenceATCTCCAAACATCAAGTCCAGCTTTGTCCGCCAACCTGTCTGACATGTCGGGACCCGTGC
CAAGCAGGGCCAGAGTTTACACAGATGTTAATACACACAGACCTCGAGAATACTGGGATT
ACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGGTTCGAAAATTAG
GCCGAGGTAAATACAGTGAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001256686 ()202195 - 396
NM_001895 (CSNK2A1)202233 - 434
NM_177559 (CSNK2A1)202350 - 551
Exon 3 To Exon 6 (Pair 5)
Forward (457,22)GAATACTGGGATTACGAGTCACAmplicon SizecDNA: 298 bpgenomic: 9,229
Reverse (754,23)AGTCTGTGTTGTTTACGTGTTCANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.988 kcal/mol
Reverse Dimers-2.184 kcal/mol
Forward-Reverse Dimers-2.381 kcal/mol
Amplicon Folding0.066 kcal/mol outside primersite
Amplicon SequenceGAATACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTG
GTTCGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAAT
AATGAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAA
ATAAAGATTTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTA
AAAGACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)298457 - 754
NM_001895 (CSNK2A1)298340 - 637
NM_001256686 ()298302 - 599
Exon 3 To Exon 6 (Pair 6)
Forward (458,23)AATACTGGGATTACGAGTCACATAmplicon SizecDNA: 297 bpgenomic: 9,228
Reverse (754,23)AGTCTGTGTTGTTTACGTGTTCANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.363 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.988 kcal/mol
Reverse Dimers-2.184 kcal/mol
Forward-Reverse Dimers-2.381 kcal/mol
Amplicon Folding0.066 kcal/mol outside primersite
Amplicon SequenceAATACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGG
TTCGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATA
ATGAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAA
TAAAGATTTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAA
AAGACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001895 (CSNK2A1)297341 - 637
NM_001256686 ()297303 - 599
NM_177559 (CSNK2A1)297458 - 754
Exon 3 To Exon 6 (Pair 1)
Forward (460,22)TACTGGGATTACGAGTCACATGAmplicon SizecDNA: 294 bpgenomic: 9,225
Reverse (753,23)GTCTGTGTTGTTTACGTGTTCAANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.363 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.988 kcal/mol
Reverse Dimers-2.184 kcal/mol
Forward-Reverse Dimers-2.381 kcal/mol
Amplicon Folding0.066 kcal/mol outside primersite
Amplicon SequenceTACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGGTT
CGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATAAT
GAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAATA
AAGATTTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAA
GACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)294460 - 753
NM_001895 (CSNK2A1)294343 - 636
NM_001256686 ()294305 - 598
Exon 3 To Exon 6 (Pair 2)
Forward (460,22)TACTGGGATTACGAGTCACATGAmplicon SizecDNA: 295 bpgenomic: 9,226
Reverse (754,23)AGTCTGTGTTGTTTACGTGTTCANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.363 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.988 kcal/mol
Reverse Dimers-2.184 kcal/mol
Forward-Reverse Dimers-2.381 kcal/mol
Amplicon Folding0.066 kcal/mol outside primersite
Amplicon SequenceTACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGGTT
CGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATAAT
GAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAATA
AAGATTTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAA
GACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)295460 - 754
NM_001256686 ()295305 - 599
NM_001895 (CSNK2A1)295343 - 637
Exon 3 To Exon 6 (Pair 3)
Forward (457,22)GAATACTGGGATTACGAGTCACAmplicon SizecDNA: 297 bpgenomic: 9,228
Reverse (753,23)GTCTGTGTTGTTTACGTGTTCAANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.988 kcal/mol
Reverse Dimers-2.184 kcal/mol
Forward-Reverse Dimers-2.381 kcal/mol
Amplicon Folding0.066 kcal/mol outside primersite
Amplicon SequenceGAATACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTG
GTTCGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAAT
AATGAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAA
ATAAAGATTTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTA
AAAGACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001256686 ()297302 - 598
NM_001895 (CSNK2A1)297340 - 636
NM_177559 (CSNK2A1)297457 - 753
Exon 3 To Exon 4 (Pair 1)
Forward (350,22)ATCTCCAAACATCAAGTCCAGCAmplicon SizecDNA: 202 bpgenomic: 3,423
Reverse (551,22)ACTTCACTGTATTTACCTCGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.638 kcal/mol
Forward Dimers-0.239 kcal/mol
Reverse Loops2.216 kcal/mol
Reverse Dimers-0.692 kcal/mol
Forward-Reverse Dimers-1.699 kcal/mol
Amplicon Folding-0.108 kcal/mol outside primersite
Amplicon SequenceATCTCCAAACATCAAGTCCAGCTTTGTCCGCCAACCTGTCTGACATGTCGGGACCCGTGC
CAAGCAGGGCCAGAGTTTACACAGATGTTAATACACACAGACCTCGAGAATACTGGGATT
ACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGGTTCGAAAATTAG
GCCGAGGTAAATACAGTGAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001256686 ()202195 - 396
NM_001895 (CSNK2A1)202233 - 434
NM_177559 (CSNK2A1)202350 - 551
Exon 3 To Exon 6 (Pair 4)
Forward (458,23)AATACTGGGATTACGAGTCACATAmplicon SizecDNA: 296 bpgenomic: 9,227
Reverse (753,23)GTCTGTGTTGTTTACGTGTTCAANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.363 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.988 kcal/mol
Reverse Dimers-2.184 kcal/mol
Forward-Reverse Dimers-2.381 kcal/mol
Amplicon Folding0.066 kcal/mol outside primersite
Amplicon SequenceAATACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGG
TTCGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATA
ATGAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAA
TAAAGATTTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAA
AAGACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)296458 - 753
NM_001895 (CSNK2A1)296341 - 636
NM_001256686 ()296303 - 598
Exon 3 To Exon 6 (Pair 5)
Forward (457,22)GAATACTGGGATTACGAGTCACAmplicon SizecDNA: 298 bpgenomic: 9,229
Reverse (754,23)AGTCTGTGTTGTTTACGTGTTCANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.988 kcal/mol
Reverse Dimers-2.184 kcal/mol
Forward-Reverse Dimers-2.381 kcal/mol
Amplicon Folding0.066 kcal/mol outside primersite
Amplicon SequenceGAATACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTG
GTTCGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAAT
AATGAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAA
ATAAAGATTTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTA
AAAGACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)298457 - 754
NM_001256686 ()298302 - 599
NM_001895 (CSNK2A1)298340 - 637
Exon 3 To Exon 6 (Pair 6)
Forward (458,23)AATACTGGGATTACGAGTCACATAmplicon SizecDNA: 297 bpgenomic: 9,228
Reverse (754,23)AGTCTGTGTTGTTTACGTGTTCANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.363 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.988 kcal/mol
Reverse Dimers-2.184 kcal/mol
Forward-Reverse Dimers-2.381 kcal/mol
Amplicon Folding0.066 kcal/mol outside primersite
Amplicon SequenceAATACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGG
TTCGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATA
ATGAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAA
TAAAGATTTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAA
AAGACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)297458 - 754
NM_001895 (CSNK2A1)297341 - 637
NM_001256686 ()297303 - 599
Exon 5 To Exon 8 (Pair 1)
Forward (646,22)TTGGAGAATTTGAGAGGAGGTCAmplicon SizecDNA: 201 bpgenomic: 4,120
Reverse (846,22)TCCCATGCTGTGACAATAATCCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers-1.335 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCT
GTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTG
TACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTG
GATTATTGTCACAGCATGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)201646 - 846
NM_177560 (CSNK2A1)201319 - 519
NM_001895 (CSNK2A1)201529 - 729
NM_001256686 ()201491 - 691
Exon 5 To Exon 8 (Pair 2)
Forward (649,21)GAGAATTTGAGAGGAGGTCCCAmplicon SizecDNA: 206 bpgenomic: 4,125
Reverse (854,22)TGCATAATTCCCATGCTGTGACNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.345 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.072 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.202 kcal/mol
Amplicon Folding0.031 kcal/mol inside primersite
Amplicon SequenceGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTG
TCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTAC
CAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGAT
TATTGTCACAGCATGGGAATTATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)206649 - 854
NM_177560 (CSNK2A1)206322 - 527
NM_001895 (CSNK2A1)206532 - 737
NM_001256686 ()206494 - 699
Exon 5 To Exon 8 (Pair 3)
Forward (648,21)GGAGAATTTGAGAGGAGGTCCAmplicon SizecDNA: 206 bpgenomic: 4,125
Reverse (853,22)GCATAATTCCCATGCTGTGACANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.464 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.343 kcal/mol
Reverse Dimers-1.514 kcal/mol
Forward-Reverse Dimers-1.202 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGT
GTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTA
CCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGA
TTATTGTCACAGCATGGGAATTATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001895 (CSNK2A1)206531 - 736
NM_001256686 ()206493 - 698
NM_177559 (CSNK2A1)206648 - 853
NM_177560 (CSNK2A1)206321 - 526
Exon 5 To Exon 8 (Pair 4)
Forward (649,21)GAGAATTTGAGAGGAGGTCCCAmplicon SizecDNA: 202 bpgenomic: 4,121
Reverse (850,24)TAATTCCCATGCTGTGACAATAATNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.345 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers-1.202 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTG
TCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTAC
CAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGAT
TATTGTCACAGCATGGGAATTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177560 (CSNK2A1)202322 - 523
NM_177559 (CSNK2A1)202649 - 850
NM_001256686 ()202494 - 695
NM_001895 (CSNK2A1)202532 - 733
Exon 5 To Exon 8 (Pair 5)
Forward (646,22)TTGGAGAATTTGAGAGGAGGTCAmplicon SizecDNA: 208 bpgenomic: 4,127
Reverse (853,22)GCATAATTCCCATGCTGTGACANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-1.062 kcal/mol
Reverse Loops1.343 kcal/mol
Reverse Dimers-1.514 kcal/mol
Forward-Reverse Dimers-1.335 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCT
GTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTG
TACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTG
GATTATTGTCACAGCATGGGAATTATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)208646 - 853
NM_177560 (CSNK2A1)208319 - 526
NM_001895 (CSNK2A1)208529 - 736
NM_001256686 ()208491 - 698
Exon 5 To Exon 8 (Pair 6)
Forward (650,22)AGAATTTGAGAGGAGGTCCCAAAmplicon SizecDNA: 206 bpgenomic: 4,125
Reverse (855,22)GTGCATAATTCCCATGCTGTGANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.001 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.072 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.202 kcal/mol
Amplicon Folding0.031 kcal/mol inside primersite
Amplicon SequenceAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTGT
CACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTACC
AGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGATT
ATTGTCACAGCATGGGAATTATGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177560 (CSNK2A1)206323 - 528
NM_001256686 ()206495 - 700
NM_177559 (CSNK2A1)206650 - 855
NM_001895 (CSNK2A1)206533 - 738
Exon 5 To Exon 8 (Pair 7)
Forward (646,22)TTGGAGAATTTGAGAGGAGGTCAmplicon SizecDNA: 209 bpgenomic: 4,128
Reverse (854,22)TGCATAATTCCCATGCTGTGACNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-1.062 kcal/mol
Reverse Loops1.072 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.335 kcal/mol
Amplicon Folding0.031 kcal/mol inside primersite
Amplicon SequenceTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCT
GTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTG
TACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTG
GATTATTGTCACAGCATGGGAATTATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177560 (CSNK2A1)209319 - 527
NM_001256686 ()209491 - 699
NM_177559 (CSNK2A1)209646 - 854
NM_001895 (CSNK2A1)209529 - 737
Exon 5 To Exon 8 (Pair 8)
Forward (650,22)AGAATTTGAGAGGAGGTCCCAAAmplicon SizecDNA: 201 bpgenomic: 4,120
Reverse (850,24)TAATTCCCATGCTGTGACAATAATNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.001 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers-1.202 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTGT
CACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTACC
AGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGATT
ATTGTCACAGCATGGGAATTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)201650 - 850
NM_001895 (CSNK2A1)201533 - 733
NM_177560 (CSNK2A1)201323 - 523
NM_001256686 ()201495 - 695
Exon 5 To Exon 8 (Pair 9)
Forward (648,21)GGAGAATTTGAGAGGAGGTCCAmplicon SizecDNA: 193 bpgenomic: 4,112
Reverse (840,21)GCTGTGACAATAATCCAGGGCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.464 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops2.093 kcal/mol in 3' area
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers-1.153 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGT
GTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTA
CCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGA
TTATTGTCACAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001895 (CSNK2A1)193531 - 723
NM_177559 (CSNK2A1)193648 - 840
NM_001256686 ()193493 - 685
NM_177560 (CSNK2A1)193321 - 513
Exon 5 To Exon 8 (Pair 10)
Forward (648,21)GGAGAATTTGAGAGGAGGTCCAmplicon SizecDNA: 203 bpgenomic: 4,122
Reverse (850,24)TAATTCCCATGCTGTGACAATAATNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.464 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers-1.202 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGT
GTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTA
CCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGA
TTATTGTCACAGCATGGGAATTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177560 (CSNK2A1)203321 - 523
NM_001256686 ()203493 - 695
NM_177559 (CSNK2A1)203648 - 850
NM_001895 (CSNK2A1)203531 - 733
Exon 5 To Exon 8 (Pair 11)
Forward (648,21)GGAGAATTTGAGAGGAGGTCCAmplicon SizecDNA: 199 bpgenomic: 4,118
Reverse (846,22)TCCCATGCTGTGACAATAATCCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.464 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGT
GTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTA
CCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGA
TTATTGTCACAGCATGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)199648 - 846
NM_001895 (CSNK2A1)199531 - 729
NM_001256686 ()199493 - 691
NM_177560 (CSNK2A1)199321 - 519
Exon 5 To Exon 8 (Pair 12)
Forward (646,22)TTGGAGAATTTGAGAGGAGGTCAmplicon SizecDNA: 205 bpgenomic: 4,124
Reverse (850,24)TAATTCCCATGCTGTGACAATAATNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers-1.335 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCT
GTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTG
TACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTG
GATTATTGTCACAGCATGGGAATTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)205646 - 850
NM_177560 (CSNK2A1)205319 - 523
NM_001256686 ()205491 - 695
NM_001895 (CSNK2A1)205529 - 733
Exon 5 To Exon 8 (Pair 13)
Forward (648,21)GGAGAATTTGAGAGGAGGTCCAmplicon SizecDNA: 201 bpgenomic: 4,120
Reverse (848,23)ATTCCCATGCTGTGACAATAATCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.464 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGT
GTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTA
CCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGA
TTATTGTCACAGCATGGGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)201648 - 848
NM_001895 (CSNK2A1)201531 - 731
NM_001256686 ()201493 - 693
NM_177560 (CSNK2A1)201321 - 521
Exon 5 To Exon 8 (Pair 14)
Forward (648,21)GGAGAATTTGAGAGGAGGTCCAmplicon SizecDNA: 208 bpgenomic: 4,127
Reverse (855,22)GTGCATAATTCCCATGCTGTGANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.464 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.072 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.202 kcal/mol
Amplicon Folding0.031 kcal/mol inside primersite
Amplicon SequenceGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGT
GTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTA
CCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGA
TTATTGTCACAGCATGGGAATTATGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)208648 - 855
NM_001256686 ()208493 - 700
NM_177560 (CSNK2A1)208321 - 528
NM_001895 (CSNK2A1)208531 - 738
Exon 5 To Exon 8 (Pair 15)
Forward (649,21)GAGAATTTGAGAGGAGGTCCCAmplicon SizecDNA: 198 bpgenomic: 4,117
Reverse (846,22)TCCCATGCTGTGACAATAATCCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.345 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTG
TCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTAC
CAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGAT
TATTGTCACAGCATGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)198649 - 846
NM_001256686 ()198494 - 691
NM_177560 (CSNK2A1)198322 - 519
NM_001895 (CSNK2A1)198532 - 729
Exon 5 To Exon 8 (Pair 16)
Forward (646,22)TTGGAGAATTTGAGAGGAGGTCAmplicon SizecDNA: 203 bpgenomic: 4,122
Reverse (848,23)ATTCCCATGCTGTGACAATAATCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers-1.335 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCT
GTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTG
TACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTG
GATTATTGTCACAGCATGGGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)203646 - 848
NM_001895 (CSNK2A1)203529 - 731
NM_001256686 ()203491 - 693
NM_177560 (CSNK2A1)203319 - 521
Exon 5 To Exon 8 (Pair 17)
Forward (649,21)GAGAATTTGAGAGGAGGTCCCAmplicon SizecDNA: 207 bpgenomic: 4,126
Reverse (855,22)GTGCATAATTCCCATGCTGTGANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.345 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.072 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.202 kcal/mol
Amplicon Folding0.031 kcal/mol inside primersite
Amplicon SequenceGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTG
TCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTAC
CAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGAT
TATTGTCACAGCATGGGAATTATGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)207649 - 855
NM_001895 (CSNK2A1)207532 - 738
NM_001256686 ()207494 - 700
NM_177560 (CSNK2A1)207322 - 528
Exon 5 To Exon 8 (Pair 18)
Forward (649,21)GAGAATTTGAGAGGAGGTCCCAmplicon SizecDNA: 205 bpgenomic: 4,124
Reverse (853,22)GCATAATTCCCATGCTGTGACANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.345 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.343 kcal/mol
Reverse Dimers-1.514 kcal/mol
Forward-Reverse Dimers-1.202 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTG
TCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTAC
CAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGAT
TATTGTCACAGCATGGGAATTATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)205649 - 853
NM_001895 (CSNK2A1)205532 - 736
NM_177560 (CSNK2A1)205322 - 526
NM_001256686 ()205494 - 698
Exon 5 To Exon 8 (Pair 19)
Forward (650,22)AGAATTTGAGAGGAGGTCCCAAAmplicon SizecDNA: 199 bpgenomic: 4,118
Reverse (848,23)ATTCCCATGCTGTGACAATAATCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.001 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTGT
CACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTACC
AGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGATT
ATTGTCACAGCATGGGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001895 (CSNK2A1)199533 - 731
NM_001256686 ()199495 - 693
NM_177560 (CSNK2A1)199323 - 521
NM_177559 (CSNK2A1)199650 - 848
Exon 5 To Exon 8 (Pair 20)
Forward (649,21)GAGAATTTGAGAGGAGGTCCCAmplicon SizecDNA: 200 bpgenomic: 4,119
Reverse (848,23)ATTCCCATGCTGTGACAATAATCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.345 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTG
TCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTAC
CAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGAT
TATTGTCACAGCATGGGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)200649 - 848
NM_001895 (CSNK2A1)200532 - 731
NM_001256686 ()200494 - 693
NM_177560 (CSNK2A1)200322 - 521
Exon 5 To Exon 8 (Pair 21)
Forward (650,22)AGAATTTGAGAGGAGGTCCCAAAmplicon SizecDNA: 204 bpgenomic: 4,123
Reverse (853,22)GCATAATTCCCATGCTGTGACANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.001 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.343 kcal/mol
Reverse Dimers-1.514 kcal/mol
Forward-Reverse Dimers-1.202 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTGT
CACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTACC
AGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGATT
ATTGTCACAGCATGGGAATTATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001256686 ()204495 - 698
NM_177560 (CSNK2A1)204323 - 526
NM_001895 (CSNK2A1)204533 - 736
NM_177559 (CSNK2A1)204650 - 853
Exon 5 To Exon 8 (Pair 22)
Forward (650,22)AGAATTTGAGAGGAGGTCCCAAAmplicon SizecDNA: 205 bpgenomic: 4,124
Reverse (854,22)TGCATAATTCCCATGCTGTGACNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.001 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.072 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.202 kcal/mol
Amplicon Folding0.031 kcal/mol inside primersite
Amplicon SequenceAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTGT
CACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTACC
AGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGATT
ATTGTCACAGCATGGGAATTATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)205650 - 854
NM_001895 (CSNK2A1)205533 - 737
NM_177560 (CSNK2A1)205323 - 527
NM_001256686 ()205495 - 699
Exon 5 To Exon 8 (Pair 23)
Forward (648,21)GGAGAATTTGAGAGGAGGTCCAmplicon SizecDNA: 207 bpgenomic: 4,126
Reverse (854,22)TGCATAATTCCCATGCTGTGACNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.464 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.072 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.202 kcal/mol
Amplicon Folding0.031 kcal/mol inside primersite
Amplicon SequenceGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGT
GTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTA
CCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGA
TTATTGTCACAGCATGGGAATTATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177560 (CSNK2A1)207321 - 527
NM_001256686 ()207493 - 699
NM_001895 (CSNK2A1)207531 - 737
NM_177559 (CSNK2A1)207648 - 854
Exon 5 To Exon 8 (Pair 24)
Forward (650,22)AGAATTTGAGAGGAGGTCCCAAAmplicon SizecDNA: 197 bpgenomic: 4,116
Reverse (846,22)TCCCATGCTGTGACAATAATCCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.001 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTGT
CACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTACC
AGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGATT
ATTGTCACAGCATGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)197650 - 846
NM_001256686 ()197495 - 691
NM_177560 (CSNK2A1)197323 - 519
NM_001895 (CSNK2A1)197533 - 729
Exon 5 To Exon 8 (Pair 25)
Forward (646,22)TTGGAGAATTTGAGAGGAGGTCAmplicon SizecDNA: 210 bpgenomic: 4,129
Reverse (855,22)GTGCATAATTCCCATGCTGTGANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-1.062 kcal/mol
Reverse Loops1.072 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.335 kcal/mol
Amplicon Folding0.031 kcal/mol inside primersite
Amplicon SequenceTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCT
GTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTG
TACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTG
GATTATTGTCACAGCATGGGAATTATGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001895 (CSNK2A1)210529 - 738
NM_177560 (CSNK2A1)210319 - 528
NM_001256686 ()210491 - 700
NM_177559 (CSNK2A1)210646 - 855
Exon 5 To Exon 8 (Pair 1)
Forward (646,22)TTGGAGAATTTGAGAGGAGGTCAmplicon SizecDNA: 201 bpgenomic: 4,120
Reverse (846,22)TCCCATGCTGTGACAATAATCCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers-1.335 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCT
GTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTG
TACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTG
GATTATTGTCACAGCATGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177560 (CSNK2A1)201319 - 519
NM_001256686 ()201491 - 691
NM_001895 (CSNK2A1)201529 - 729
NM_177559 (CSNK2A1)201646 - 846
Exon 5 To Exon 8 (Pair 2)
Forward (649,21)GAGAATTTGAGAGGAGGTCCCAmplicon SizecDNA: 206 bpgenomic: 4,125
Reverse (854,22)TGCATAATTCCCATGCTGTGACNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.345 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.072 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.202 kcal/mol
Amplicon Folding0.031 kcal/mol inside primersite
Amplicon SequenceGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTG
TCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTAC
CAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGAT
TATTGTCACAGCATGGGAATTATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)206649 - 854
NM_177560 (CSNK2A1)206322 - 527
NM_001256686 ()206494 - 699
NM_001895 (CSNK2A1)206532 - 737
Exon 5 To Exon 8 (Pair 3)
Forward (648,21)GGAGAATTTGAGAGGAGGTCCAmplicon SizecDNA: 206 bpgenomic: 4,125
Reverse (853,22)GCATAATTCCCATGCTGTGACANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.464 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.343 kcal/mol
Reverse Dimers-1.514 kcal/mol
Forward-Reverse Dimers-1.202 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGT
GTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTA
CCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGA
TTATTGTCACAGCATGGGAATTATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001895 (CSNK2A1)206531 - 736
NM_001256686 ()206493 - 698
NM_177560 (CSNK2A1)206321 - 526
NM_177559 (CSNK2A1)206648 - 853
Exon 5 To Exon 8 (Pair 4)
Forward (649,21)GAGAATTTGAGAGGAGGTCCCAmplicon SizecDNA: 202 bpgenomic: 4,121
Reverse (850,24)TAATTCCCATGCTGTGACAATAATNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.345 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers-1.202 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTG
TCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTAC
CAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGAT
TATTGTCACAGCATGGGAATTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)202649 - 850
NM_177560 (CSNK2A1)202322 - 523
NM_001256686 ()202494 - 695
NM_001895 (CSNK2A1)202532 - 733
Exon 5 To Exon 8 (Pair 5)
Forward (646,22)TTGGAGAATTTGAGAGGAGGTCAmplicon SizecDNA: 208 bpgenomic: 4,127
Reverse (853,22)GCATAATTCCCATGCTGTGACANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-1.062 kcal/mol
Reverse Loops1.343 kcal/mol
Reverse Dimers-1.514 kcal/mol
Forward-Reverse Dimers-1.335 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCT
GTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTG
TACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTG
GATTATTGTCACAGCATGGGAATTATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001895 (CSNK2A1)208529 - 736
NM_177560 (CSNK2A1)208319 - 526
NM_001256686 ()208491 - 698
NM_177559 (CSNK2A1)208646 - 853
Exon 5 To Exon 8 (Pair 6)
Forward (650,22)AGAATTTGAGAGGAGGTCCCAAAmplicon SizecDNA: 206 bpgenomic: 4,125
Reverse (855,22)GTGCATAATTCCCATGCTGTGANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.001 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.072 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.202 kcal/mol
Amplicon Folding0.031 kcal/mol inside primersite
Amplicon SequenceAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTGT
CACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTACC
AGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGATT
ATTGTCACAGCATGGGAATTATGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)206650 - 855
NM_177560 (CSNK2A1)206323 - 528
NM_001256686 ()206495 - 700
NM_001895 (CSNK2A1)206533 - 738
Exon 5 To Exon 8 (Pair 7)
Forward (646,22)TTGGAGAATTTGAGAGGAGGTCAmplicon SizecDNA: 209 bpgenomic: 4,128
Reverse (854,22)TGCATAATTCCCATGCTGTGACNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-1.062 kcal/mol
Reverse Loops1.072 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.335 kcal/mol
Amplicon Folding0.031 kcal/mol inside primersite
Amplicon SequenceTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCT
GTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTG
TACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTG
GATTATTGTCACAGCATGGGAATTATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001256686 ()209491 - 699
NM_177560 (CSNK2A1)209319 - 527
NM_001895 (CSNK2A1)209529 - 737
NM_177559 (CSNK2A1)209646 - 854
Exon 5 To Exon 8 (Pair 8)
Forward (650,22)AGAATTTGAGAGGAGGTCCCAAAmplicon SizecDNA: 201 bpgenomic: 4,120
Reverse (850,24)TAATTCCCATGCTGTGACAATAATNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.001 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers-1.202 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTGT
CACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTACC
AGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGATT
ATTGTCACAGCATGGGAATTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177560 (CSNK2A1)201323 - 523
NM_001256686 ()201495 - 695
NM_001895 (CSNK2A1)201533 - 733
NM_177559 (CSNK2A1)201650 - 850
Exon 5 To Exon 8 (Pair 9)
Forward (648,21)GGAGAATTTGAGAGGAGGTCCAmplicon SizecDNA: 193 bpgenomic: 4,112
Reverse (840,21)GCTGTGACAATAATCCAGGGCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.464 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops2.093 kcal/mol in 3' area
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers-1.153 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGT
GTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTA
CCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGA
TTATTGTCACAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001895 (CSNK2A1)193531 - 723
NM_001256686 ()193493 - 685
NM_177560 (CSNK2A1)193321 - 513
NM_177559 (CSNK2A1)193648 - 840
Exon 5 To Exon 8 (Pair 10)
Forward (648,21)GGAGAATTTGAGAGGAGGTCCAmplicon SizecDNA: 203 bpgenomic: 4,122
Reverse (850,24)TAATTCCCATGCTGTGACAATAATNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.464 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers-1.202 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGT
GTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTA
CCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGA
TTATTGTCACAGCATGGGAATTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177560 (CSNK2A1)203321 - 523
NM_001256686 ()203493 - 695
NM_001895 (CSNK2A1)203531 - 733
NM_177559 (CSNK2A1)203648 - 850
Exon 5 To Exon 8 (Pair 11)
Forward (648,21)GGAGAATTTGAGAGGAGGTCCAmplicon SizecDNA: 199 bpgenomic: 4,118
Reverse (846,22)TCCCATGCTGTGACAATAATCCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.464 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGT
GTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTA
CCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGA
TTATTGTCACAGCATGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)199648 - 846
NM_177560 (CSNK2A1)199321 - 519
NM_001256686 ()199493 - 691
NM_001895 (CSNK2A1)199531 - 729
Exon 5 To Exon 8 (Pair 12)
Forward (646,22)TTGGAGAATTTGAGAGGAGGTCAmplicon SizecDNA: 205 bpgenomic: 4,124
Reverse (850,24)TAATTCCCATGCTGTGACAATAATNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers-1.335 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCT
GTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTG
TACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTG
GATTATTGTCACAGCATGGGAATTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)205646 - 850
NM_001895 (CSNK2A1)205529 - 733
NM_177560 (CSNK2A1)205319 - 523
NM_001256686 ()205491 - 695
Exon 5 To Exon 8 (Pair 13)
Forward (648,21)GGAGAATTTGAGAGGAGGTCCAmplicon SizecDNA: 201 bpgenomic: 4,120
Reverse (848,23)ATTCCCATGCTGTGACAATAATCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.464 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGT
GTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTA
CCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGA
TTATTGTCACAGCATGGGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001895 (CSNK2A1)201531 - 731
NM_177560 (CSNK2A1)201321 - 521
NM_001256686 ()201493 - 693
NM_177559 (CSNK2A1)201648 - 848
Exon 5 To Exon 8 (Pair 14)
Forward (648,21)GGAGAATTTGAGAGGAGGTCCAmplicon SizecDNA: 208 bpgenomic: 4,127
Reverse (855,22)GTGCATAATTCCCATGCTGTGANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.464 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.072 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.202 kcal/mol
Amplicon Folding0.031 kcal/mol inside primersite
Amplicon SequenceGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGT
GTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTA
CCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGA
TTATTGTCACAGCATGGGAATTATGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)208648 - 855
NM_001895 (CSNK2A1)208531 - 738
NM_001256686 ()208493 - 700
NM_177560 (CSNK2A1)208321 - 528
Exon 5 To Exon 8 (Pair 15)
Forward (649,21)GAGAATTTGAGAGGAGGTCCCAmplicon SizecDNA: 198 bpgenomic: 4,117
Reverse (846,22)TCCCATGCTGTGACAATAATCCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.345 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTG
TCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTAC
CAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGAT
TATTGTCACAGCATGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177560 (CSNK2A1)198322 - 519
NM_001256686 ()198494 - 691
NM_001895 (CSNK2A1)198532 - 729
NM_177559 (CSNK2A1)198649 - 846
Exon 5 To Exon 8 (Pair 16)
Forward (646,22)TTGGAGAATTTGAGAGGAGGTCAmplicon SizecDNA: 203 bpgenomic: 4,122
Reverse (848,23)ATTCCCATGCTGTGACAATAATCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers-1.335 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCT
GTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTG
TACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTG
GATTATTGTCACAGCATGGGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001256686 ()203491 - 693
NM_177560 (CSNK2A1)203319 - 521
NM_001895 (CSNK2A1)203529 - 731
NM_177559 (CSNK2A1)203646 - 848
Exon 5 To Exon 8 (Pair 17)
Forward (649,21)GAGAATTTGAGAGGAGGTCCCAmplicon SizecDNA: 207 bpgenomic: 4,126
Reverse (855,22)GTGCATAATTCCCATGCTGTGANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.345 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.072 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.202 kcal/mol
Amplicon Folding0.031 kcal/mol inside primersite
Amplicon SequenceGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTG
TCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTAC
CAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGAT
TATTGTCACAGCATGGGAATTATGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177560 (CSNK2A1)207322 - 528
NM_001256686 ()207494 - 700
NM_001895 (CSNK2A1)207532 - 738
NM_177559 (CSNK2A1)207649 - 855
Exon 5 To Exon 8 (Pair 18)
Forward (649,21)GAGAATTTGAGAGGAGGTCCCAmplicon SizecDNA: 205 bpgenomic: 4,124
Reverse (853,22)GCATAATTCCCATGCTGTGACANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.345 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.343 kcal/mol
Reverse Dimers-1.514 kcal/mol
Forward-Reverse Dimers-1.202 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTG
TCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTAC
CAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGAT
TATTGTCACAGCATGGGAATTATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)205649 - 853
NM_001256686 ()205494 - 698
NM_177560 (CSNK2A1)205322 - 526
NM_001895 (CSNK2A1)205532 - 736
Exon 5 To Exon 8 (Pair 19)
Forward (650,22)AGAATTTGAGAGGAGGTCCCAAAmplicon SizecDNA: 199 bpgenomic: 4,118
Reverse (848,23)ATTCCCATGCTGTGACAATAATCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.001 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTGT
CACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTACC
AGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGATT
ATTGTCACAGCATGGGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)199650 - 848
NM_001256686 ()199495 - 693
NM_177560 (CSNK2A1)199323 - 521
NM_001895 (CSNK2A1)199533 - 731
Exon 5 To Exon 8 (Pair 20)
Forward (649,21)GAGAATTTGAGAGGAGGTCCCAmplicon SizecDNA: 200 bpgenomic: 4,119
Reverse (848,23)ATTCCCATGCTGTGACAATAATCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.345 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTG
TCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTAC
CAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGAT
TATTGTCACAGCATGGGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001895 (CSNK2A1)200532 - 731
NM_001256686 ()200494 - 693
NM_177560 (CSNK2A1)200322 - 521
NM_177559 (CSNK2A1)200649 - 848
Exon 5 To Exon 8 (Pair 21)
Forward (650,22)AGAATTTGAGAGGAGGTCCCAAAmplicon SizecDNA: 204 bpgenomic: 4,123
Reverse (853,22)GCATAATTCCCATGCTGTGACANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.001 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.343 kcal/mol
Reverse Dimers-1.514 kcal/mol
Forward-Reverse Dimers-1.202 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTGT
CACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTACC
AGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGATT
ATTGTCACAGCATGGGAATTATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)204650 - 853
NM_177560 (CSNK2A1)204323 - 526
NM_001256686 ()204495 - 698
NM_001895 (CSNK2A1)204533 - 736
Exon 5 To Exon 8 (Pair 22)
Forward (650,22)AGAATTTGAGAGGAGGTCCCAAAmplicon SizecDNA: 205 bpgenomic: 4,124
Reverse (854,22)TGCATAATTCCCATGCTGTGACNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.001 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.072 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.202 kcal/mol
Amplicon Folding0.031 kcal/mol inside primersite
Amplicon SequenceAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTGT
CACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTACC
AGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGATT
ATTGTCACAGCATGGGAATTATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001895 (CSNK2A1)205533 - 737
NM_177560 (CSNK2A1)205323 - 527
NM_001256686 ()205495 - 699
NM_177559 (CSNK2A1)205650 - 854
Exon 5 To Exon 8 (Pair 23)
Forward (648,21)GGAGAATTTGAGAGGAGGTCCAmplicon SizecDNA: 207 bpgenomic: 4,126
Reverse (854,22)TGCATAATTCCCATGCTGTGACNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.464 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.072 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.202 kcal/mol
Amplicon Folding0.031 kcal/mol inside primersite
Amplicon SequenceGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGT
GTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTA
CCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGA
TTATTGTCACAGCATGGGAATTATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)207648 - 854
NM_001895 (CSNK2A1)207531 - 737
NM_001256686 ()207493 - 699
NM_177560 (CSNK2A1)207321 - 527
Exon 5 To Exon 8 (Pair 24)
Forward (650,22)AGAATTTGAGAGGAGGTCCCAAAmplicon SizecDNA: 197 bpgenomic: 4,116
Reverse (846,22)TCCCATGCTGTGACAATAATCCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.001 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTGT
CACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTACC
AGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGATT
ATTGTCACAGCATGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001895 (CSNK2A1)197533 - 729
NM_177560 (CSNK2A1)197323 - 519
NM_001256686 ()197495 - 691
NM_177559 (CSNK2A1)197650 - 846
Exon 5 To Exon 8 (Pair 25)
Forward (646,22)TTGGAGAATTTGAGAGGAGGTCAmplicon SizecDNA: 210 bpgenomic: 4,129
Reverse (855,22)GTGCATAATTCCCATGCTGTGANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-1.062 kcal/mol
Reverse Loops1.072 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.335 kcal/mol
Amplicon Folding0.031 kcal/mol inside primersite
Amplicon SequenceTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCT
GTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTG
TACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTG
GATTATTGTCACAGCATGGGAATTATGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)210646 - 855
NM_177560 (CSNK2A1)210319 - 528
NM_001895 (CSNK2A1)210529 - 738
NM_001256686 ()210491 - 700
Exon 6 To Exon 9 (Pair 1)
Forward (737,23)ACGTAAACAACACAGACTTCAAGAmplicon SizecDNA: 233 bpgenomic: 6,979
Reverse (969,23)AACTCGGACATTATATTCTTGGCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-1.816 kcal/mol
Reverse Loops1.99 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCGAT
TTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCACA
GAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAATAG
ACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)233737 - 969
NM_177560 (CSNK2A1)233410 - 642
NM_001895 (CSNK2A1)233620 - 852
NM_001256686 ()233582 - 814
Exon 6 To Exon 9 (Pair 2)
Forward (736,23)CACGTAAACAACACAGACTTCAAAmplicon SizecDNA: 235 bpgenomic: 6,981
Reverse (970,23)CAACTCGGACATTATATTCTTGGNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-2.764 kcal/mol
Reverse Loops1.99 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceCACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCGA
TTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCAC
AGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAATA
GACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)235736 - 970
NM_177560 (CSNK2A1)235409 - 643
NM_001895 (CSNK2A1)235619 - 853
NM_001256686 ()235581 - 815
Exon 6 To Exon 9 (Pair 3)
Forward (731,23)TTGAACACGTAAACAACACAGACAmplicon SizecDNA: 264 bpgenomic: 7,010
Reverse (994,21)CAGGACCTTTGAAGTATCGGGNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-2.764 kcal/mol
Reverse Loops1.828 kcal/mol
Reverse Dimers-2.94 kcal/mol
Forward-Reverse Dimers-0.798 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceTTGAACACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATA
TTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTA
TGCACAGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGAC
TAATAGACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTG
CTTCCCGATACTTCAAAGGTCCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177560 (CSNK2A1)264404 - 667
NM_177559 (CSNK2A1)264731 - 994
NM_001256686 ()264576 - 839
NM_001895 (CSNK2A1)264614 - 877
Exon 6 To Exon 9 (Pair 4)
Forward (734,23)AACACGTAAACAACACAGACTTCAmplicon SizecDNA: 241 bpgenomic: 6,987
Reverse (974,23)GAAGCAACTCGGACATTATATTCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-2.764 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAACACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTC
GATTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGC
ACAGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAA
TAGACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTGCTT
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)241734 - 974
NM_177560 (CSNK2A1)241407 - 647
NM_001895 (CSNK2A1)241617 - 857
NM_001256686 ()241579 - 819
Exon 6 To Exon 9 (Pair 5)
Forward (734,23)AACACGTAAACAACACAGACTTCAmplicon SizecDNA: 238 bpgenomic: 6,984
Reverse (971,23)GCAACTCGGACATTATATTCTTGNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-2.764 kcal/mol
Reverse Loops1.99 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAACACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTC
GATTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGC
ACAGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAA
TAGACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001256686 ()238579 - 816
NM_001895 (CSNK2A1)238617 - 854
NM_177560 (CSNK2A1)238407 - 644
NM_177559 (CSNK2A1)238734 - 971
Exon 6 To Exon 9 (Pair 6)
Forward (737,23)ACGTAAACAACACAGACTTCAAGAmplicon SizecDNA: 238 bpgenomic: 6,984
Reverse (974,23)GAAGCAACTCGGACATTATATTCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-1.816 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCGAT
TTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCACA
GAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAATAG
ACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTGCTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)238737 - 974
NM_177560 (CSNK2A1)238410 - 647
NM_001895 (CSNK2A1)238620 - 857
NM_001256686 ()238582 - 819
Exon 6 To Exon 9 (Pair 7)
Forward (734,23)AACACGTAAACAACACAGACTTCAmplicon SizecDNA: 243 bpgenomic: 6,989
Reverse (976,22)GGGAAGCAACTCGGACATTATANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-2.764 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAACACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTC
GATTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGC
ACAGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAA
TAGACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTGCTT
CCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)243734 - 976
NM_177560 (CSNK2A1)243407 - 649
NM_001895 (CSNK2A1)243617 - 859
NM_001256686 ()243579 - 821
Exon 6 To Exon 9 (Pair 8)
Forward (731,23)TTGAACACGTAAACAACACAGACAmplicon SizecDNA: 263 bpgenomic: 7,009
Reverse (993,22)AGGACCTTTGAAGTATCGGGAANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-2.764 kcal/mol
Reverse Loops1.611 kcal/mol in 3' area
Reverse Dimers-1.992 kcal/mol
Forward-Reverse Dimers-0.798 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceTTGAACACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATA
TTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTA
TGCACAGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGAC
TAATAGACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTG
CTTCCCGATACTTCAAAGGTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)263731 - 993
NM_001895 (CSNK2A1)263614 - 876
NM_177560 (CSNK2A1)263404 - 666
NM_001256686 ()263576 - 838
Exon 6 To Exon 9 (Pair 9)
Forward (736,23)CACGTAAACAACACAGACTTCAAAmplicon SizecDNA: 234 bpgenomic: 6,980
Reverse (969,23)AACTCGGACATTATATTCTTGGCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-2.764 kcal/mol
Reverse Loops1.99 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceCACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCGA
TTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCAC
AGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAATA
GACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001895 (CSNK2A1)234619 - 852
NM_177559 (CSNK2A1)234736 - 969
NM_001256686 ()234581 - 814
NM_177560 (CSNK2A1)234409 - 642
Exon 6 To Exon 9 (Pair 10)
Forward (734,23)AACACGTAAACAACACAGACTTCAmplicon SizecDNA: 240 bpgenomic: 6,986
Reverse (973,24)AAGCAACTCGGACATTATATTCTTNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-2.764 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAACACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTC
GATTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGC
ACAGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAA
TAGACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001895 (CSNK2A1)240617 - 856
NM_177559 (CSNK2A1)240734 - 973
NM_001256686 ()240579 - 818
NM_177560 (CSNK2A1)240407 - 646
Exon 6 To Exon 9 (Pair 11)
Forward (734,23)AACACGTAAACAACACAGACTTCAmplicon SizecDNA: 242 bpgenomic: 6,988
Reverse (975,23)GGAAGCAACTCGGACATTATATTNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-2.764 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAACACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTC
GATTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGC
ACAGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAA
TAGACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTGCTT
CC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001256686 ()242579 - 820
NM_177560 (CSNK2A1)242407 - 648
NM_001895 (CSNK2A1)242617 - 858
NM_177559 (CSNK2A1)242734 - 975
Exon 6 To Exon 9 (Pair 12)
Forward (735,23)ACACGTAAACAACACAGACTTCAAmplicon SizecDNA: 239 bpgenomic: 6,985
Reverse (973,24)AAGCAACTCGGACATTATATTCTTNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-2.764 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceACACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCG
ATTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCA
CAGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAAT
AGACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)239735 - 973
NM_001895 (CSNK2A1)239618 - 856
NM_177560 (CSNK2A1)239408 - 646
NM_001256686 ()239580 - 818
Exon 6 To Exon 9 (Pair 13)
Forward (737,23)ACGTAAACAACACAGACTTCAAGAmplicon SizecDNA: 234 bpgenomic: 6,980
Reverse (970,23)CAACTCGGACATTATATTCTTGGNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-1.816 kcal/mol
Reverse Loops1.99 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCGAT
TTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCACA
GAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAATAG
ACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001256686 ()234582 - 815
NM_177560 (CSNK2A1)234410 - 643
NM_001895 (CSNK2A1)234620 - 853
NM_177559 (CSNK2A1)234737 - 970
Exon 6 To Exon 9 (Pair 14)
Forward (737,23)ACGTAAACAACACAGACTTCAAGAmplicon SizecDNA: 235 bpgenomic: 6,981
Reverse (971,23)GCAACTCGGACATTATATTCTTGNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-1.816 kcal/mol
Reverse Loops1.99 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCGAT
TTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCACA
GAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAATAG
ACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177560 (CSNK2A1)235410 - 644
NM_001256686 ()235582 - 816
NM_177559 (CSNK2A1)235737 - 971
NM_001895 (CSNK2A1)235620 - 854
Exon 6 To Exon 9 (Pair 15)
Forward (735,23)ACACGTAAACAACACAGACTTCAAmplicon SizecDNA: 235 bpgenomic: 6,981
Reverse (969,23)AACTCGGACATTATATTCTTGGCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-2.764 kcal/mol
Reverse Loops1.99 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceACACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCG
ATTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCA
CAGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAAT
AGACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177560 (CSNK2A1)235408 - 642
NM_001256686 ()235580 - 814
NM_001895 (CSNK2A1)235618 - 852
NM_177559 (CSNK2A1)235735 - 969
Exon 6 To Exon 9 (Pair 16)
Forward (734,23)AACACGTAAACAACACAGACTTCAmplicon SizecDNA: 245 bpgenomic: 6,991
Reverse (978,21)TCGGGAAGCAACTCGGACATTNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-2.764 kcal/mol
Reverse Loops1.49 kcal/mol
Reverse Dimers-0.982 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAACACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTC
GATTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGC
ACAGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAA
TAGACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTGCTT
CCCGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)245734 - 978
NM_001895 (CSNK2A1)245617 - 861
NM_177560 (CSNK2A1)245407 - 651
NM_001256686 ()245579 - 823
Exon 6 To Exon 9 (Pair 17)
Forward (735,23)ACACGTAAACAACACAGACTTCAAmplicon SizecDNA: 240 bpgenomic: 6,986
Reverse (974,23)GAAGCAACTCGGACATTATATTCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-2.764 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceACACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCG
ATTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCA
CAGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAAT
AGACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTGCTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)240735 - 974
NM_177560 (CSNK2A1)240408 - 647
NM_001256686 ()240580 - 819
NM_001895 (CSNK2A1)240618 - 857
Exon 6 To Exon 9 (Pair 18)
Forward (737,23)ACGTAAACAACACAGACTTCAAGAmplicon SizecDNA: 237 bpgenomic: 6,983
Reverse (973,24)AAGCAACTCGGACATTATATTCTTNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-1.816 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCGAT
TTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCACA
GAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAATAG
ACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)237737 - 973
NM_001895 (CSNK2A1)237620 - 856
NM_177560 (CSNK2A1)237410 - 646
NM_001256686 ()237582 - 818
Exon 6 To Exon 9 (Pair 19)
Forward (735,23)ACACGTAAACAACACAGACTTCAAmplicon SizecDNA: 236 bpgenomic: 6,982
Reverse (970,23)CAACTCGGACATTATATTCTTGGNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-2.764 kcal/mol
Reverse Loops1.99 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceACACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCG
ATTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCA
CAGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAAT
AGACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001895 (CSNK2A1)236618 - 853
NM_001256686 ()236580 - 815
NM_177560 (CSNK2A1)236408 - 643
NM_177559 (CSNK2A1)236735 - 970
Exon 6 To Exon 9 (Pair 20)
Forward (736,23)CACGTAAACAACACAGACTTCAAAmplicon SizecDNA: 238 bpgenomic: 6,984
Reverse (973,24)AAGCAACTCGGACATTATATTCTTNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-2.764 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceCACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCGA
TTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCAC
AGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAATA
GACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001256686 ()238581 - 818
NM_177560 (CSNK2A1)238409 - 646
NM_001895 (CSNK2A1)238619 - 856
NM_177559 (CSNK2A1)238736 - 973
Exon 6 To Exon 9 (Pair 21)
Forward (734,23)AACACGTAAACAACACAGACTTCAmplicon SizecDNA: 237 bpgenomic: 6,983
Reverse (970,23)CAACTCGGACATTATATTCTTGGNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-2.764 kcal/mol
Reverse Loops1.99 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAACACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTC
GATTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGC
ACAGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAA
TAGACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)237734 - 970
NM_001256686 ()237579 - 815
NM_177560 (CSNK2A1)237407 - 643
NM_001895 (CSNK2A1)237617 - 853
Exon 6 To Exon 9 (Pair 22)
Forward (731,23)TTGAACACGTAAACAACACAGACAmplicon SizecDNA: 260 bpgenomic: 7,006
Reverse (990,22)ACCTTTGAAGTATCGGGAAGCANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-2.764 kcal/mol
Reverse Loops1.611 kcal/mol
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-0.798 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceTTGAACACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATA
TTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTA
TGCACAGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGAC
TAATAGACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTG
CTTCCCGATACTTCAAAGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177560 (CSNK2A1)260404 - 663
NM_001256686 ()260576 - 835
NM_001895 (CSNK2A1)260614 - 873
NM_177559 (CSNK2A1)260731 - 990
Exon 6 To Exon 9 (Pair 23)
Forward (734,23)AACACGTAAACAACACAGACTTCAmplicon SizecDNA: 244 bpgenomic: 6,990
Reverse (977,21)CGGGAAGCAACTCGGACATTANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-2.764 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-0.677 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAACACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTC
GATTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGC
ACAGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAA
TAGACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTGCTT
CCCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)244734 - 977
NM_001895 (CSNK2A1)244617 - 860
NM_177560 (CSNK2A1)244407 - 650
NM_001256686 ()244579 - 822
Exon 6 To Exon 9 (Pair 24)
Forward (736,23)CACGTAAACAACACAGACTTCAAAmplicon SizecDNA: 236 bpgenomic: 6,982
Reverse (971,23)GCAACTCGGACATTATATTCTTGNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-2.764 kcal/mol
Reverse Loops1.99 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceCACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCGA
TTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCAC
AGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAATA
GACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)236736 - 971
NM_001895 (CSNK2A1)236619 - 854
NM_001256686 ()236581 - 816
NM_177560 (CSNK2A1)236409 - 644
Exon 6 To Exon 9 (Pair 25)
Forward (734,23)AACACGTAAACAACACAGACTTCAmplicon SizecDNA: 236 bpgenomic: 6,982
Reverse (969,23)AACTCGGACATTATATTCTTGGCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-2.764 kcal/mol
Reverse Loops1.99 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAACACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTC
GATTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGC
ACAGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAA
TAGACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001895 (CSNK2A1)236617 - 852
NM_177560 (CSNK2A1)236407 - 642
NM_001256686 ()236579 - 814
NM_177559 (CSNK2A1)236734 - 969
Exon 6 To Exon 9 (Pair 26)
Forward (736,23)CACGTAAACAACACAGACTTCAAAmplicon SizecDNA: 239 bpgenomic: 6,985
Reverse (974,23)GAAGCAACTCGGACATTATATTCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-2.764 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceCACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCGA
TTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCAC
AGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAATA
GACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTGCTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)239736 - 974
NM_001895 (CSNK2A1)239619 - 857
NM_177560 (CSNK2A1)239409 - 647
NM_001256686 ()239581 - 819
Exon 6 To Exon 9 (Pair 27)
Forward (735,23)ACACGTAAACAACACAGACTTCAAmplicon SizecDNA: 237 bpgenomic: 6,983
Reverse (971,23)GCAACTCGGACATTATATTCTTGNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-2.764 kcal/mol
Reverse Loops1.99 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceACACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCG
ATTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCA
CAGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAAT
AGACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)237735 - 971
NM_001895 (CSNK2A1)237618 - 854
NM_177560 (CSNK2A1)237408 - 644
NM_001256686 ()237580 - 816
Exon 6 To Exon 9 (Pair 1)
Forward (737,23)ACGTAAACAACACAGACTTCAAGAmplicon SizecDNA: 233 bpgenomic: 6,979
Reverse (969,23)AACTCGGACATTATATTCTTGGCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-1.816 kcal/mol
Reverse Loops1.99 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCGAT
TTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCACA
GAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAATAG
ACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001895 (CSNK2A1)233620 - 852
NM_001256686 ()233582 - 814
NM_177560 (CSNK2A1)233410 - 642
NM_177559 (CSNK2A1)233737 - 969
Exon 6 To Exon 9 (Pair 2)
Forward (736,23)CACGTAAACAACACAGACTTCAAAmplicon SizecDNA: 235 bpgenomic: 6,981
Reverse (970,23)CAACTCGGACATTATATTCTTGGNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-2.764 kcal/mol
Reverse Loops1.99 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceCACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCGA
TTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCAC
AGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAATA
GACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177560 (CSNK2A1)235409 - 643
NM_001256686 ()235581 - 815
NM_001895 (CSNK2A1)235619 - 853
NM_177559 (CSNK2A1)235736 - 970
Exon 6 To Exon 9 (Pair 3)
Forward (731,23)TTGAACACGTAAACAACACAGACAmplicon SizecDNA: 264 bpgenomic: 7,010
Reverse (994,21)CAGGACCTTTGAAGTATCGGGNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-2.764 kcal/mol
Reverse Loops1.828 kcal/mol
Reverse Dimers-2.94 kcal/mol
Forward-Reverse Dimers-0.798 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceTTGAACACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATA
TTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTA
TGCACAGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGAC
TAATAGACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTG
CTTCCCGATACTTCAAAGGTCCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001895 (CSNK2A1)264614 - 877
NM_001256686 ()264576 - 839
NM_177560 (CSNK2A1)264404 - 667
NM_177559 (CSNK2A1)264731 - 994
Exon 6 To Exon 9 (Pair 4)
Forward (734,23)AACACGTAAACAACACAGACTTCAmplicon SizecDNA: 241 bpgenomic: 6,987
Reverse (974,23)GAAGCAACTCGGACATTATATTCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-2.764 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAACACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTC
GATTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGC
ACAGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAA
TAGACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTGCTT
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)241734 - 974
NM_001895 (CSNK2A1)241617 - 857
NM_177560 (CSNK2A1)241407 - 647
NM_001256686 ()241579 - 819
Exon 6 To Exon 9 (Pair 5)
Forward (734,23)AACACGTAAACAACACAGACTTCAmplicon SizecDNA: 238 bpgenomic: 6,984
Reverse (971,23)GCAACTCGGACATTATATTCTTGNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-2.764 kcal/mol
Reverse Loops1.99 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAACACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTC
GATTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGC
ACAGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAA
TAGACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001895 (CSNK2A1)238617 - 854
NM_001256686 ()238579 - 816
NM_177560 (CSNK2A1)238407 - 644
NM_177559 (CSNK2A1)238734 - 971
 

See below for some more details.

Program Output:

Loading ...