Design Results for CSNK2A1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 1 To Exon 3 (Pair 32)
Forward (149,19)GCTGCCGCTTCCACCACAGAmplicon SizecDNA: 201 bpgenomic: 35,095
Reverse (349,21)CTGGCAGTCACTGTGTTCAGANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.558 kcal/mol
Forward Dimers-0.39 kcal/mol
Reverse Loops0.254 kcal/mol in 3' area
Reverse Dimers-2.374 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGTA
AATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACTA
GTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGCT
TCTGAACACAGTGACTGCCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)201149 - 349
NM_001256686 ()85110 - 194
NM_001895 (CSNK2A1)84149 - 232
Exon 1 To Exon 3 (Pair 31)
Forward (148,19)CGCTGCCGCTTCCACCACAAmplicon SizecDNA: 203 bpgenomic: 35,097
Reverse (350,21)TCTGGCAGTCACTGTGTTCAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.51 kcal/mol
Forward Dimers-0.484 kcal/mol
Reverse Loops1.065 kcal/mol in 3' area
Reverse Dimers-2.749 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceCGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGT
AAATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACT
AGTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGC
TTCTGAACACAGTGACTGCCAGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)203148 - 350
NM_001256686 ()87109 - 195
NM_001895 (CSNK2A1)86148 - 233
Exon 1 To Exon 3 (Pair 30)
Forward (149,19)GCTGCCGCTTCCACCACAGAmplicon SizecDNA: 206 bpgenomic: 35,100
Reverse (354,21)GAGATCTGGCAGTCACTGTGTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.558 kcal/mol
Forward Dimers-0.39 kcal/mol
Reverse Loops1.401 kcal/mol in 3' area
Reverse Dimers-2.954 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGTA
AATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACTA
GTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGCT
TCTGAACACAGTGACTGCCAGATCTC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)206149 - 354
NM_001256686 ()90110 - 199
NM_001895 (CSNK2A1)89149 - 237
Exon 1 To Exon 3 (Pair 29)
Forward (149,19)GCTGCCGCTTCCACCACAGAmplicon SizecDNA: 209 bpgenomic: 35,103
Reverse (357,21)TTGGAGATCTGGCAGTCACTGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.558 kcal/mol
Forward Dimers-0.39 kcal/mol
Reverse Loops1.658 kcal/mol in 3' area
Reverse Dimers-2.954 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGTA
AATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACTA
GTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGCT
TCTGAACACAGTGACTGCCAGATCTCCAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)209149 - 357
NM_001256686 ()93110 - 202
NM_001895 (CSNK2A1)92149 - 240
Exon 1 To Exon 3 (Pair 28)
Forward (148,19)CGCTGCCGCTTCCACCACAAmplicon SizecDNA: 212 bpgenomic: 35,106
Reverse (359,21)GTTTGGAGATCTGGCAGTCACNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.51 kcal/mol
Forward Dimers-0.484 kcal/mol
Reverse Loops1.941 kcal/mol in 3' area
Reverse Dimers-2.954 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceCGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGT
AAATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACT
AGTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGC
TTCTGAACACAGTGACTGCCAGATCTCCAAAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)212148 - 359
NM_001256686 ()96109 - 204
NM_001895 (CSNK2A1)95148 - 242
Exon 1 To Exon 3 (Pair 27)
Forward (149,19)GCTGCCGCTTCCACCACAGAmplicon SizecDNA: 225 bpgenomic: 35,119
Reverse (373,22)AAGCTGGACTTGATGTTTGGAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.558 kcal/mol
Forward Dimers-0.39 kcal/mol
Reverse Loops0.769 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGTA
AATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACTA
GTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGCT
TCTGAACACAGTGACTGCCAGATCTCCAAACATCAAGTCCAGCTT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)225149 - 373
NM_001256686 ()109110 - 218
NM_001895 (CSNK2A1)108149 - 256
Exon 1 To Exon 3 (Pair 26)
Forward (149,19)GCTGCCGCTTCCACCACAGAmplicon SizecDNA: 213 bpgenomic: 35,107
Reverse (361,22)ATGTTTGGAGATCTGGCAGTCANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.558 kcal/mol
Forward Dimers-0.39 kcal/mol
Reverse Loops1.967 kcal/mol in 3' area
Reverse Dimers-2.954 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGTA
AATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACTA
GTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGCT
TCTGAACACAGTGACTGCCAGATCTCCAAACAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)213149 - 361
NM_001256686 ()97110 - 206
NM_001895 (CSNK2A1)96149 - 244
Exon 1 To Exon 3 (Pair 25)
Forward (149,19)GCTGCCGCTTCCACCACAGAmplicon SizecDNA: 195 bpgenomic: 35,089
Reverse (343,21)GTCACTGTGTTCAGAAGCAGCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.558 kcal/mol
Forward Dimers-0.39 kcal/mol
Reverse Loops0.254 kcal/mol
Reverse Dimers-1.076 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGTA
AATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACTA
GTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGCT
TCTGAACACAGTGAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)195149 - 343
NM_001256686 ()79110 - 188
NM_001895 (CSNK2A1)78149 - 226
Exon 1 To Exon 3 (Pair 24)
Forward (149,19)GCTGCCGCTTCCACCACAGAmplicon SizecDNA: 215 bpgenomic: 35,109
Reverse (363,22)TGATGTTTGGAGATCTGGCAGTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.558 kcal/mol
Forward Dimers-0.39 kcal/mol
Reverse Loops2.474 kcal/mol
Reverse Dimers-2.954 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGTA
AATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACTA
GTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGCT
TCTGAACACAGTGACTGCCAGATCTCCAAACATCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)215149 - 363
NM_001256686 ()99110 - 208
NM_001895 (CSNK2A1)98149 - 246
Exon 1 To Exon 3 (Pair 23)
Forward (149,19)GCTGCCGCTTCCACCACAGAmplicon SizecDNA: 208 bpgenomic: 35,102
Reverse (356,21)TGGAGATCTGGCAGTCACTGTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.558 kcal/mol
Forward Dimers-0.39 kcal/mol
Reverse Loops1.579 kcal/mol in 3' area
Reverse Dimers-2.954 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGTA
AATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACTA
GTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGCT
TCTGAACACAGTGACTGCCAGATCTCCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)208149 - 356
NM_001256686 ()92110 - 201
NM_001895 (CSNK2A1)91149 - 239
Exon 1 To Exon 3 (Pair 22)
Forward (148,19)CGCTGCCGCTTCCACCACAAmplicon SizecDNA: 210 bpgenomic: 35,104
Reverse (357,21)TTGGAGATCTGGCAGTCACTGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.51 kcal/mol
Forward Dimers-0.484 kcal/mol
Reverse Loops1.658 kcal/mol in 3' area
Reverse Dimers-2.954 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceCGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGT
AAATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACT
AGTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGC
TTCTGAACACAGTGACTGCCAGATCTCCAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)210148 - 357
NM_001256686 ()94109 - 202
NM_001895 (CSNK2A1)93148 - 240
Exon 1 To Exon 3 (Pair 21)
Forward (148,19)CGCTGCCGCTTCCACCACAAmplicon SizecDNA: 199 bpgenomic: 35,093
Reverse (346,21)GCAGTCACTGTGTTCAGAAGCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.51 kcal/mol
Forward Dimers-0.484 kcal/mol
Reverse Loops0.254 kcal/mol in 3' area
Reverse Dimers-2.218 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceCGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGT
AAATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACT
AGTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGC
TTCTGAACACAGTGACTGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)199148 - 346
NM_001256686 ()83109 - 191
NM_001895 (CSNK2A1)82148 - 229
Exon 1 To Exon 3 (Pair 20)
Forward (148,19)CGCTGCCGCTTCCACCACAAmplicon SizecDNA: 205 bpgenomic: 35,099
Reverse (352,21)GATCTGGCAGTCACTGTGTTCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.51 kcal/mol
Forward Dimers-0.484 kcal/mol
Reverse Loops1.401 kcal/mol in 3' area
Reverse Dimers-2.749 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceCGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGT
AAATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACT
AGTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGC
TTCTGAACACAGTGACTGCCAGATC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)205148 - 352
NM_001256686 ()89109 - 197
NM_001895 (CSNK2A1)88148 - 235
Exon 1 To Exon 3 (Pair 19)
Forward (148,19)CGCTGCCGCTTCCACCACAAmplicon SizecDNA: 200 bpgenomic: 35,094
Reverse (347,21)GGCAGTCACTGTGTTCAGAAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.51 kcal/mol
Forward Dimers-0.484 kcal/mol
Reverse Loops0.254 kcal/mol in 3' area
Reverse Dimers-2.374 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceCGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGT
AAATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACT
AGTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGC
TTCTGAACACAGTGACTGCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)200148 - 347
NM_001256686 ()84109 - 192
NM_001895 (CSNK2A1)83148 - 230
Exon 1 To Exon 3 (Pair 18)
Forward (148,19)CGCTGCCGCTTCCACCACAAmplicon SizecDNA: 214 bpgenomic: 35,108
Reverse (361,22)ATGTTTGGAGATCTGGCAGTCANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.51 kcal/mol
Forward Dimers-0.484 kcal/mol
Reverse Loops1.967 kcal/mol in 3' area
Reverse Dimers-2.954 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceCGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGT
AAATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACT
AGTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGC
TTCTGAACACAGTGACTGCCAGATCTCCAAACAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)214148 - 361
NM_001256686 ()98109 - 206
NM_001895 (CSNK2A1)97148 - 244
Exon 1 To Exon 3 (Pair 17)
Forward (148,19)CGCTGCCGCTTCCACCACAAmplicon SizecDNA: 209 bpgenomic: 35,103
Reverse (356,21)TGGAGATCTGGCAGTCACTGTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.51 kcal/mol
Forward Dimers-0.484 kcal/mol
Reverse Loops1.579 kcal/mol in 3' area
Reverse Dimers-2.954 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceCGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGT
AAATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACT
AGTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGC
TTCTGAACACAGTGACTGCCAGATCTCCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)209148 - 356
NM_001256686 ()93109 - 201
NM_001895 (CSNK2A1)92148 - 239
Exon 1 To Exon 3 (Pair 16)
Forward (149,19)GCTGCCGCTTCCACCACAGAmplicon SizecDNA: 227 bpgenomic: 35,121
Reverse (375,22)CAAAGCTGGACTTGATGTTTGGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.558 kcal/mol
Forward Dimers-0.39 kcal/mol
Reverse Loops0.432 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGTA
AATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACTA
GTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGCT
TCTGAACACAGTGACTGCCAGATCTCCAAACATCAAGTCCAGCTTTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)227149 - 375
NM_001256686 ()111110 - 220
NM_001895 (CSNK2A1)110149 - 258
Exon 1 To Exon 3 (Pair 15)
Forward (148,19)CGCTGCCGCTTCCACCACAAmplicon SizecDNA: 196 bpgenomic: 35,090
Reverse (343,21)GTCACTGTGTTCAGAAGCAGCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.51 kcal/mol
Forward Dimers-0.484 kcal/mol
Reverse Loops0.254 kcal/mol
Reverse Dimers-1.076 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceCGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGT
AAATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACT
AGTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGC
TTCTGAACACAGTGAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)196148 - 343
NM_001256686 ()80109 - 188
NM_001895 (CSNK2A1)79148 - 226
Exon 1 To Exon 3 (Pair 14)
Forward (148,19)CGCTGCCGCTTCCACCACAAmplicon SizecDNA: 226 bpgenomic: 35,120
Reverse (373,22)AAGCTGGACTTGATGTTTGGAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.51 kcal/mol
Forward Dimers-0.484 kcal/mol
Reverse Loops0.769 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceCGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGT
AAATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACT
AGTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGC
TTCTGAACACAGTGACTGCCAGATCTCCAAACATCAAGTCCAGCTT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)226148 - 373
NM_001256686 ()110109 - 218
NM_001895 (CSNK2A1)109148 - 256
Exon 1 To Exon 3 (Pair 13)
Forward (149,19)GCTGCCGCTTCCACCACAGAmplicon SizecDNA: 211 bpgenomic: 35,105
Reverse (359,21)GTTTGGAGATCTGGCAGTCACNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.558 kcal/mol
Forward Dimers-0.39 kcal/mol
Reverse Loops1.941 kcal/mol in 3' area
Reverse Dimers-2.954 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGTA
AATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACTA
GTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGCT
TCTGAACACAGTGACTGCCAGATCTCCAAAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)211149 - 359
NM_001256686 ()95110 - 204
NM_001895 (CSNK2A1)94149 - 242
Exon 1 To Exon 3 (Pair 12)
Forward (148,19)CGCTGCCGCTTCCACCACAAmplicon SizecDNA: 207 bpgenomic: 35,101
Reverse (354,21)GAGATCTGGCAGTCACTGTGTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.51 kcal/mol
Forward Dimers-0.484 kcal/mol
Reverse Loops1.401 kcal/mol in 3' area
Reverse Dimers-2.954 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceCGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGT
AAATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACT
AGTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGC
TTCTGAACACAGTGACTGCCAGATCTC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)207148 - 354
NM_001256686 ()91109 - 199
NM_001895 (CSNK2A1)90148 - 237
Exon 1 To Exon 3 (Pair 11)
Forward (148,19)CGCTGCCGCTTCCACCACAAmplicon SizecDNA: 225 bpgenomic: 35,119
Reverse (372,22)AGCTGGACTTGATGTTTGGAGANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.51 kcal/mol
Forward Dimers-0.484 kcal/mol
Reverse Loops0.913 kcal/mol
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceCGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGT
AAATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACT
AGTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGC
TTCTGAACACAGTGACTGCCAGATCTCCAAACATCAAGTCCAGCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)225148 - 372
NM_001256686 ()109109 - 217
NM_001895 (CSNK2A1)108148 - 255
Exon 1 To Exon 3 (Pair 10)
Forward (148,19)CGCTGCCGCTTCCACCACAAmplicon SizecDNA: 217 bpgenomic: 35,111
Reverse (364,22)TTGATGTTTGGAGATCTGGCAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.51 kcal/mol
Forward Dimers-0.484 kcal/mol
Reverse Loops2.474 kcal/mol
Reverse Dimers-2.954 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceCGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGT
AAATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACT
AGTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGC
TTCTGAACACAGTGACTGCCAGATCTCCAAACATCAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)217148 - 364
NM_001256686 ()101109 - 209
NM_001895 (CSNK2A1)100148 - 247
Exon 1 To Exon 3 (Pair 9)
Forward (149,19)GCTGCCGCTTCCACCACAGAmplicon SizecDNA: 224 bpgenomic: 35,118
Reverse (372,22)AGCTGGACTTGATGTTTGGAGANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.558 kcal/mol
Forward Dimers-0.39 kcal/mol
Reverse Loops0.913 kcal/mol
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGTA
AATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACTA
GTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGCT
TCTGAACACAGTGACTGCCAGATCTCCAAACATCAAGTCCAGCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)224149 - 372
NM_001256686 ()108110 - 217
NM_001895 (CSNK2A1)107149 - 255
Exon 1 To Exon 3 (Pair 8)
Forward (149,19)GCTGCCGCTTCCACCACAGAmplicon SizecDNA: 198 bpgenomic: 35,092
Reverse (346,21)GCAGTCACTGTGTTCAGAAGCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.558 kcal/mol
Forward Dimers-0.39 kcal/mol
Reverse Loops0.254 kcal/mol in 3' area
Reverse Dimers-2.218 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGTA
AATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACTA
GTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGCT
TCTGAACACAGTGACTGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)198149 - 346
NM_001256686 ()82110 - 191
NM_001895 (CSNK2A1)81149 - 229
Exon 1 To Exon 3 (Pair 7)
Forward (149,19)GCTGCCGCTTCCACCACAGAmplicon SizecDNA: 204 bpgenomic: 35,098
Reverse (352,21)GATCTGGCAGTCACTGTGTTCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.558 kcal/mol
Forward Dimers-0.39 kcal/mol
Reverse Loops1.401 kcal/mol in 3' area
Reverse Dimers-2.749 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGTA
AATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACTA
GTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGCT
TCTGAACACAGTGACTGCCAGATC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)204149 - 352
NM_001256686 ()88110 - 197
NM_001895 (CSNK2A1)87149 - 235
Exon 1 To Exon 3 (Pair 6)
Forward (149,19)GCTGCCGCTTCCACCACAGAmplicon SizecDNA: 216 bpgenomic: 35,110
Reverse (364,22)TTGATGTTTGGAGATCTGGCAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.558 kcal/mol
Forward Dimers-0.39 kcal/mol
Reverse Loops2.474 kcal/mol
Reverse Dimers-2.954 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGTA
AATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACTA
GTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGCT
TCTGAACACAGTGACTGCCAGATCTCCAAACATCAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)216149 - 364
NM_001256686 ()100110 - 209
NM_001895 (CSNK2A1)99149 - 247
Exon 1 To Exon 3 (Pair 5)
Forward (148,19)CGCTGCCGCTTCCACCACAAmplicon SizecDNA: 216 bpgenomic: 35,110
Reverse (363,22)TGATGTTTGGAGATCTGGCAGTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.51 kcal/mol
Forward Dimers-0.484 kcal/mol
Reverse Loops2.474 kcal/mol
Reverse Dimers-2.954 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceCGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGT
AAATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACT
AGTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGC
TTCTGAACACAGTGACTGCCAGATCTCCAAACATCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)216148 - 363
NM_001256686 ()100109 - 208
NM_001895 (CSNK2A1)99148 - 246
Exon 1 To Exon 3 (Pair 4)
Forward (149,19)GCTGCCGCTTCCACCACAGAmplicon SizecDNA: 202 bpgenomic: 35,096
Reverse (350,21)TCTGGCAGTCACTGTGTTCAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.558 kcal/mol
Forward Dimers-0.39 kcal/mol
Reverse Loops1.065 kcal/mol in 3' area
Reverse Dimers-2.749 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGTA
AATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACTA
GTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGCT
TCTGAACACAGTGACTGCCAGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)202149 - 350
NM_001256686 ()86110 - 195
NM_001895 (CSNK2A1)85149 - 233
Exon 1 To Exon 3 (Pair 3)
Forward (148,19)CGCTGCCGCTTCCACCACAAmplicon SizecDNA: 202 bpgenomic: 35,096
Reverse (349,21)CTGGCAGTCACTGTGTTCAGANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.51 kcal/mol
Forward Dimers-0.484 kcal/mol
Reverse Loops0.254 kcal/mol in 3' area
Reverse Dimers-2.374 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceCGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGT
AAATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACT
AGTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGC
TTCTGAACACAGTGACTGCCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)202148 - 349
NM_001256686 ()86109 - 194
NM_001895 (CSNK2A1)85148 - 232
Exon 1 To Exon 3 (Pair 2)
Forward (149,19)GCTGCCGCTTCCACCACAGAmplicon SizecDNA: 199 bpgenomic: 35,093
Reverse (347,21)GGCAGTCACTGTGTTCAGAAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.558 kcal/mol
Forward Dimers-0.39 kcal/mol
Reverse Loops0.254 kcal/mol in 3' area
Reverse Dimers-2.374 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGTA
AATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACTA
GTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGCT
TCTGAACACAGTGACTGCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)199149 - 347
NM_001256686 ()83110 - 192
NM_001895 (CSNK2A1)82149 - 230
Exon 1 To Exon 3 (Pair 1)
Forward (148,19)CGCTGCCGCTTCCACCACAAmplicon SizecDNA: 228 bpgenomic: 35,122
Reverse (375,22)CAAAGCTGGACTTGATGTTTGGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.51 kcal/mol
Forward Dimers-0.484 kcal/mol
Reverse Loops0.432 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.782 kcal/mol outside primersite
Amplicon SequenceCGCTGCCGCTTCCACCACAGCTCTATCAAGGCTTGTCAAGCAGTGTGCTCATCACATGGT
AAATCATGCAGCGTGGAACCTCATAAAATCTCCAAGAAACATCATTCACCCATACTGACT
AGTTTCACATCTCTTTGTTTGAAGAAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGC
TTCTGAACACAGTGACTGCCAGATCTCCAAACATCAAGTCCAGCTTTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)228148 - 375
NM_001256686 ()112109 - 220
NM_001895 (CSNK2A1)111148 - 258
Exon 3 To Exon 4 (Pair 15)
Forward (460,22)TACTGGGATTACGAGTCACATGAmplicon SizecDNA: 92 bpgenomic: 3,313
Reverse (551,22)ACTTCACTGTATTTACCTCGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.363 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops2.216 kcal/mol
Reverse Dimers-0.692 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.066 kcal/mol outside primersite
Amplicon SequenceTACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGGTT
CGAAAATTAGGCCGAGGTAAATACAGTGAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)92460 - 551
NM_001256686 ()92305 - 396
NM_001895 (CSNK2A1)92343 - 434
Exon 3 To Exon 6 (Pair 6)
Forward (460,22)TACTGGGATTACGAGTCACATGAmplicon SizecDNA: 295 bpgenomic: 9,226
Reverse (754,23)AGTCTGTGTTGTTTACGTGTTCANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.363 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.988 kcal/mol
Reverse Dimers-2.184 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.066 kcal/mol outside primersite
Amplicon SequenceTACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGGTT
CGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATAAT
GAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAATA
AAGATTTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAA
GACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)295460 - 754
NM_001256686 ()295305 - 599
NM_001895 (CSNK2A1)295343 - 637
Exon 3 To Exon 4 (Pair 14)
Forward (339,21)GTGACTGCCAGATCTCCAAACAmplicon SizecDNA: 213 bpgenomic: 3,434
Reverse (551,22)ACTTCACTGTATTTACCTCGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol
Forward Dimers-3 kcal/mol
Reverse Loops2.216 kcal/mol
Reverse Dimers-0.692 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.108 kcal/mol outside primersite
Amplicon SequenceGTGACTGCCAGATCTCCAAACATCAAGTCCAGCTTTGTCCGCCAACCTGTCTGACATGTC
GGGACCCGTGCCAAGCAGGGCCAGAGTTTACACAGATGTTAATACACACAGACCTCGAGA
ATACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGGT
TCGAAAATTAGGCCGAGGTAAATACAGTGAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)213339 - 551
NM_001256686 ()213184 - 396
NM_001895 (CSNK2A1)213222 - 434
Exon 3 To Exon 5 (Pair 3)
Forward (460,22)TACTGGGATTACGAGTCACATGAmplicon SizecDNA: 208 bpgenomic: 8,612
Reverse (667,22)GACCTCCTCTCAAATTCTCCAANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.363 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops2.186 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.066 kcal/mol outside primersite
Amplicon SequenceTACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGGTT
CGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATAAT
GAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAATA
AAGATTTTGGAGAATTTGAGAGGAGGTC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)208460 - 667
NM_001256686 ()208305 - 512
NM_001895 (CSNK2A1)208343 - 550
Exon 3 To Exon 4 (Pair 13)
Forward (345,22)GCCAGATCTCCAAACATCAAGTAmplicon SizecDNA: 207 bpgenomic: 3,428
Reverse (551,22)ACTTCACTGTATTTACCTCGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.147 kcal/mol in 3' area
Forward Dimers-3 kcal/mol
Reverse Loops2.216 kcal/mol
Reverse Dimers-0.692 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.108 kcal/mol outside primersite
Amplicon SequenceGCCAGATCTCCAAACATCAAGTCCAGCTTTGTCCGCCAACCTGTCTGACATGTCGGGACC
CGTGCCAAGCAGGGCCAGAGTTTACACAGATGTTAATACACACAGACCTCGAGAATACTG
GGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGGTTCGAAA
ATTAGGCCGAGGTAAATACAGTGAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)207345 - 551
NM_001256686 ()207190 - 396
NM_001895 (CSNK2A1)207228 - 434
Exon 3 To Exon 4 (Pair 12)
Forward (458,23)AATACTGGGATTACGAGTCACATAmplicon SizecDNA: 94 bpgenomic: 3,315
Reverse (551,22)ACTTCACTGTATTTACCTCGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.363 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops2.216 kcal/mol
Reverse Dimers-0.692 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.066 kcal/mol outside primersite
Amplicon SequenceAATACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGG
TTCGAAAATTAGGCCGAGGTAAATACAGTGAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)94458 - 551
NM_001256686 ()94303 - 396
NM_001895 (CSNK2A1)94341 - 434
Exon 3 To Exon 4 (Pair 11)
Forward (344,22)TGCCAGATCTCCAAACATCAAGAmplicon SizecDNA: 208 bpgenomic: 3,429
Reverse (551,22)ACTTCACTGTATTTACCTCGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.579 kcal/mol in 3' area
Forward Dimers-3 kcal/mol
Reverse Loops2.216 kcal/mol
Reverse Dimers-0.692 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.108 kcal/mol outside primersite
Amplicon SequenceTGCCAGATCTCCAAACATCAAGTCCAGCTTTGTCCGCCAACCTGTCTGACATGTCGGGAC
CCGTGCCAAGCAGGGCCAGAGTTTACACAGATGTTAATACACACAGACCTCGAGAATACT
GGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGGTTCGAA
AATTAGGCCGAGGTAAATACAGTGAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)208344 - 551
NM_001256686 ()208189 - 396
NM_001895 (CSNK2A1)208227 - 434
Exon 3 To Exon 4 (Pair 10)
Forward (296,22)CAGGTCTGAAACAAGGTCTTACAmplicon SizecDNA: 256 bpgenomic: 3,477
Reverse (551,22)ACTTCACTGTATTTACCTCGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol
Forward Dimers-1.606 kcal/mol
Reverse Loops2.216 kcal/mol
Reverse Dimers-0.692 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.108 kcal/mol outside primersite
Amplicon SequenceCAGGTCTGAAACAAGGTCTTACCCCCAGCTGCTTCTGAACACAGTGACTGCCAGATCTCC
AAACATCAAGTCCAGCTTTGTCCGCCAACCTGTCTGACATGTCGGGACCCGTGCCAAGCA
GGGCCAGAGTTTACACAGATGTTAATACACACAGACCTCGAGAATACTGGGATTACGAGT
CACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGGTTCGAAAATTAGGCCGAG
GTAAATACAGTGAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)256296 - 551
NM_001256686 ()257140 - 396
NM_001895 (CSNK2A1)256179 - 434
Exon 3 To Exon 4 (Pair 9)
Forward (340,22)TGACTGCCAGATCTCCAAACATAmplicon SizecDNA: 212 bpgenomic: 3,433
Reverse (551,22)ACTTCACTGTATTTACCTCGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol
Forward Dimers-3 kcal/mol
Reverse Loops2.216 kcal/mol
Reverse Dimers-0.692 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.108 kcal/mol outside primersite
Amplicon SequenceTGACTGCCAGATCTCCAAACATCAAGTCCAGCTTTGTCCGCCAACCTGTCTGACATGTCG
GGACCCGTGCCAAGCAGGGCCAGAGTTTACACAGATGTTAATACACACAGACCTCGAGAA
TACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGGTT
CGAAAATTAGGCCGAGGTAAATACAGTGAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)212340 - 551
NM_001256686 ()212185 - 396
NM_001895 (CSNK2A1)212223 - 434
Exon 3 To Exon 4 (Pair 8)
Forward (457,22)GAATACTGGGATTACGAGTCACAmplicon SizecDNA: 95 bpgenomic: 3,316
Reverse (551,22)ACTTCACTGTATTTACCTCGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops2.216 kcal/mol
Reverse Dimers-0.692 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.066 kcal/mol outside primersite
Amplicon SequenceGAATACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTG
GTTCGAAAATTAGGCCGAGGTAAATACAGTGAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)95457 - 551
NM_001256686 ()95302 - 396
NM_001895 (CSNK2A1)95340 - 434
Exon 3 To Exon 6 (Pair 5)
Forward (457,22)GAATACTGGGATTACGAGTCACAmplicon SizecDNA: 298 bpgenomic: 9,229
Reverse (754,23)AGTCTGTGTTGTTTACGTGTTCANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.988 kcal/mol
Reverse Dimers-2.184 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.066 kcal/mol outside primersite
Amplicon SequenceGAATACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTG
GTTCGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAAT
AATGAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAA
ATAAAGATTTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTA
AAAGACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)298457 - 754
NM_001256686 ()298302 - 599
NM_001895 (CSNK2A1)298340 - 637
Exon 3 To Exon 4 (Pair 7)
Forward (342,22)ACTGCCAGATCTCCAAACATCAAmplicon SizecDNA: 210 bpgenomic: 3,431
Reverse (551,22)ACTTCACTGTATTTACCTCGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol
Forward Dimers-3 kcal/mol
Reverse Loops2.216 kcal/mol
Reverse Dimers-0.692 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.108 kcal/mol outside primersite
Amplicon SequenceACTGCCAGATCTCCAAACATCAAGTCCAGCTTTGTCCGCCAACCTGTCTGACATGTCGGG
ACCCGTGCCAAGCAGGGCCAGAGTTTACACAGATGTTAATACACACAGACCTCGAGAATA
CTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGGTTCG
AAAATTAGGCCGAGGTAAATACAGTGAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)210342 - 551
NM_001256686 ()210187 - 396
NM_001895 (CSNK2A1)210225 - 434
Exon 3 To Exon 4 (Pair 6)
Forward (294,23)AACAGGTCTGAAACAAGGTCTTAAmplicon SizecDNA: 258 bpgenomic: 3,479
Reverse (551,22)ACTTCACTGTATTTACCTCGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.893 kcal/mol
Forward Dimers-2.692 kcal/mol
Reverse Loops2.216 kcal/mol
Reverse Dimers-0.692 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.108 kcal/mol outside primersite
Amplicon SequenceAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGCTTCTGAACACAGTGACTGCCAGATCT
CCAAACATCAAGTCCAGCTTTGTCCGCCAACCTGTCTGACATGTCGGGACCCGTGCCAAG
CAGGGCCAGAGTTTACACAGATGTTAATACACACAGACCTCGAGAATACTGGGATTACGA
GTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGGTTCGAAAATTAGGCCG
AGGTAAATACAGTGAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)258294 - 551
NM_001256686 ()259138 - 396
NM_001895 (CSNK2A1)258177 - 434
Exon 3 To Exon 5 (Pair 2)
Forward (458,23)AATACTGGGATTACGAGTCACATAmplicon SizecDNA: 210 bpgenomic: 8,614
Reverse (667,22)GACCTCCTCTCAAATTCTCCAANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.363 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops2.186 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.066 kcal/mol outside primersite
Amplicon SequenceAATACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGG
TTCGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATA
ATGAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAA
TAAAGATTTTGGAGAATTTGAGAGGAGGTC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)210458 - 667
NM_001256686 ()210303 - 512
NM_001895 (CSNK2A1)210341 - 550
Exon 3 To Exon 4 (Pair 5)
Forward (293,23)AAACAGGTCTGAAACAAGGTCTTAmplicon SizecDNA: 259 bpgenomic: 3,480
Reverse (551,22)ACTTCACTGTATTTACCTCGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.893 kcal/mol
Forward Dimers-2.692 kcal/mol
Reverse Loops2.216 kcal/mol
Reverse Dimers-0.692 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.108 kcal/mol outside primersite
Amplicon SequenceAAACAGGTCTGAAACAAGGTCTTACCCCCAGCTGCTTCTGAACACAGTGACTGCCAGATC
TCCAAACATCAAGTCCAGCTTTGTCCGCCAACCTGTCTGACATGTCGGGACCCGTGCCAA
GCAGGGCCAGAGTTTACACAGATGTTAATACACACAGACCTCGAGAATACTGGGATTACG
AGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGGTTCGAAAATTAGGCC
GAGGTAAATACAGTGAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)259293 - 551
NM_001256686 ()260137 - 396
NM_001895 (CSNK2A1)259176 - 434
Exon 3 To Exon 4 (Pair 4)
Forward (343,22)CTGCCAGATCTCCAAACATCAAAmplicon SizecDNA: 209 bpgenomic: 3,430
Reverse (551,22)ACTTCACTGTATTTACCTCGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.086 kcal/mol
Forward Dimers-3 kcal/mol
Reverse Loops2.216 kcal/mol
Reverse Dimers-0.692 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.108 kcal/mol outside primersite
Amplicon SequenceCTGCCAGATCTCCAAACATCAAGTCCAGCTTTGTCCGCCAACCTGTCTGACATGTCGGGA
CCCGTGCCAAGCAGGGCCAGAGTTTACACAGATGTTAATACACACAGACCTCGAGAATAC
TGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGGTTCGA
AAATTAGGCCGAGGTAAATACAGTGAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)209343 - 551
NM_001256686 ()209188 - 396
NM_001895 (CSNK2A1)209226 - 434
Exon 3 To Exon 6 (Pair 4)
Forward (458,23)AATACTGGGATTACGAGTCACATAmplicon SizecDNA: 296 bpgenomic: 9,227
Reverse (753,23)GTCTGTGTTGTTTACGTGTTCAANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.363 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.988 kcal/mol
Reverse Dimers-2.184 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.066 kcal/mol outside primersite
Amplicon SequenceAATACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGG
TTCGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATA
ATGAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAA
TAAAGATTTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAA
AAGACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)296458 - 753
NM_001256686 ()296303 - 598
NM_001895 (CSNK2A1)296341 - 636
Exon 3 To Exon 5 (Pair 1)
Forward (457,22)GAATACTGGGATTACGAGTCACAmplicon SizecDNA: 211 bpgenomic: 8,615
Reverse (667,22)GACCTCCTCTCAAATTCTCCAANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops2.186 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.066 kcal/mol outside primersite
Amplicon SequenceGAATACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTG
GTTCGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAAT
AATGAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAA
ATAAAGATTTTGGAGAATTTGAGAGGAGGTC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)211457 - 667
NM_001256686 ()211302 - 512
NM_001895 (CSNK2A1)211340 - 550
Exon 3 To Exon 6 (Pair 3)
Forward (458,23)AATACTGGGATTACGAGTCACATAmplicon SizecDNA: 297 bpgenomic: 9,228
Reverse (754,23)AGTCTGTGTTGTTTACGTGTTCANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.363 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.988 kcal/mol
Reverse Dimers-2.184 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.066 kcal/mol outside primersite
Amplicon SequenceAATACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGG
TTCGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATA
ATGAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAA
TAAAGATTTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAA
AAGACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)297458 - 754
NM_001256686 ()297303 - 599
NM_001895 (CSNK2A1)297341 - 637
Exon 3 To Exon 6 (Pair 2)
Forward (457,22)GAATACTGGGATTACGAGTCACAmplicon SizecDNA: 297 bpgenomic: 9,228
Reverse (753,23)GTCTGTGTTGTTTACGTGTTCAANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.988 kcal/mol
Reverse Dimers-2.184 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.066 kcal/mol outside primersite
Amplicon SequenceGAATACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTG
GTTCGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAAT
AATGAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAA
ATAAAGATTTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTA
AAAGACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)297457 - 753
NM_001256686 ()297302 - 598
NM_001895 (CSNK2A1)297340 - 636
Exon 3 To Exon 4 (Pair 3)
Forward (346,22)CCAGATCTCCAAACATCAAGTCAmplicon SizecDNA: 206 bpgenomic: 3,427
Reverse (551,22)ACTTCACTGTATTTACCTCGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.638 kcal/mol in 3' area
Forward Dimers-3 kcal/mol
Reverse Loops2.216 kcal/mol
Reverse Dimers-0.692 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.108 kcal/mol outside primersite
Amplicon SequenceCCAGATCTCCAAACATCAAGTCCAGCTTTGTCCGCCAACCTGTCTGACATGTCGGGACCC
GTGCCAAGCAGGGCCAGAGTTTACACAGATGTTAATACACACAGACCTCGAGAATACTGG
GATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGGTTCGAAAA
TTAGGCCGAGGTAAATACAGTGAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)206346 - 551
NM_001256686 ()206191 - 396
NM_001895 (CSNK2A1)206229 - 434
Exon 3 To Exon 4 (Pair 2)
Forward (350,22)ATCTCCAAACATCAAGTCCAGCAmplicon SizecDNA: 202 bpgenomic: 3,423
Reverse (551,22)ACTTCACTGTATTTACCTCGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.638 kcal/mol
Forward Dimers-0.239 kcal/mol
Reverse Loops2.216 kcal/mol
Reverse Dimers-0.692 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.108 kcal/mol outside primersite
Amplicon SequenceATCTCCAAACATCAAGTCCAGCTTTGTCCGCCAACCTGTCTGACATGTCGGGACCCGTGC
CAAGCAGGGCCAGAGTTTACACAGATGTTAATACACACAGACCTCGAGAATACTGGGATT
ACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGGTTCGAAAATTAG
GCCGAGGTAAATACAGTGAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)202350 - 551
NM_001256686 ()202195 - 396
NM_001895 (CSNK2A1)202233 - 434
Exon 3 To Exon 4 (Pair 1)
Forward (347,22)CAGATCTCCAAACATCAAGTCCAmplicon SizecDNA: 205 bpgenomic: 3,426
Reverse (551,22)ACTTCACTGTATTTACCTCGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.638 kcal/mol in 3' area
Forward Dimers-3 kcal/mol
Reverse Loops2.216 kcal/mol
Reverse Dimers-0.692 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.108 kcal/mol outside primersite
Amplicon SequenceCAGATCTCCAAACATCAAGTCCAGCTTTGTCCGCCAACCTGTCTGACATGTCGGGACCCG
TGCCAAGCAGGGCCAGAGTTTACACAGATGTTAATACACACAGACCTCGAGAATACTGGG
ATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGGTTCGAAAAT
TAGGCCGAGGTAAATACAGTGAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)205347 - 551
NM_001256686 ()205192 - 396
NM_001895 (CSNK2A1)205230 - 434
Exon 3 To Exon 6 (Pair 1)
Forward (460,22)TACTGGGATTACGAGTCACATGAmplicon SizecDNA: 294 bpgenomic: 9,225
Reverse (753,23)GTCTGTGTTGTTTACGTGTTCAANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.363 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.988 kcal/mol
Reverse Dimers-2.184 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.066 kcal/mol outside primersite
Amplicon SequenceTACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGGTT
CGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATAAT
GAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAATA
AAGATTTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAA
GACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)294460 - 753
NM_001256686 ()294305 - 598
NM_001895 (CSNK2A1)294343 - 636
Exon 4 To Exon 6 (Pair 6)
Forward (526,22)TTAGGCCGAGGTAAATACAGTGAmplicon SizecDNA: 228 bpgenomic: 5,938
Reverse (753,23)GTCTGTGTTGTTTACGTGTTCAANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.892 kcal/mol in 3' area
Forward Dimers-2.42 kcal/mol
Reverse Loops1.988 kcal/mol
Reverse Dimers-2.184 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.202 kcal/mol outside primersite
Amplicon SequenceTTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATAATGAAAAA
GTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAATAAAGATT
TTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCT
GTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 4 To Exon 5 (Pair 3)
Forward (528,22)AGGCCGAGGTAAATACAGTGAAAmplicon SizecDNA: 140 bpgenomic: 5,323
Reverse (667,22)GACCTCCTCTCAAATTCTCCAANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.892 kcal/mol
Forward Dimers-2.42 kcal/mol
Reverse Loops2.186 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.51 kcal/mol inside primersite
Amplicon SequenceAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATAATGAAAAAGT
TGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAATAAAGATTTT
GGAGAATTTGAGAGGAGGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)140528 - 667
NM_177560 (CSNK2A1)140201 - 340
NM_001256686 ()140373 - 512
NM_001895 (CSNK2A1)140411 - 550
Exon 4 To Exon 6 (Pair 5)
Forward (527,22)TAGGCCGAGGTAAATACAGTGAAmplicon SizecDNA: 227 bpgenomic: 5,937
Reverse (753,23)GTCTGTGTTGTTTACGTGTTCAANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.892 kcal/mol
Forward Dimers-2.42 kcal/mol
Reverse Loops1.988 kcal/mol
Reverse Dimers-2.184 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.202 kcal/mol outside primersite
Amplicon SequenceTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATAATGAAAAAG
TTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAATAAAGATTT
TGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTG
TGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)227527 - 753
NM_177560 (CSNK2A1)227200 - 426
NM_001256686 ()227372 - 598
NM_001895 (CSNK2A1)227410 - 636
Exon 4 To Exon 6 (Pair 4)
Forward (528,22)AGGCCGAGGTAAATACAGTGAAAmplicon SizecDNA: 227 bpgenomic: 5,937
Reverse (754,23)AGTCTGTGTTGTTTACGTGTTCANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.892 kcal/mol
Forward Dimers-2.42 kcal/mol
Reverse Loops1.988 kcal/mol
Reverse Dimers-2.184 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.202 kcal/mol outside primersite
Amplicon SequenceAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATAATGAAAAAGT
TGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAATAAAGATTTT
GGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGT
GTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)227528 - 754
NM_177560 (CSNK2A1)227201 - 427
NM_001256686 ()227373 - 599
NM_001895 (CSNK2A1)227411 - 637
Exon 4 To Exon 6 (Pair 3)
Forward (528,22)AGGCCGAGGTAAATACAGTGAAAmplicon SizecDNA: 226 bpgenomic: 5,936
Reverse (753,23)GTCTGTGTTGTTTACGTGTTCAANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.892 kcal/mol
Forward Dimers-2.42 kcal/mol
Reverse Loops1.988 kcal/mol
Reverse Dimers-2.184 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.202 kcal/mol outside primersite
Amplicon SequenceAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATAATGAAAAAGT
TGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAATAAAGATTTT
GGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGT
GTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)226528 - 753
NM_177560 (CSNK2A1)226201 - 426
NM_001256686 ()226373 - 598
NM_001895 (CSNK2A1)226411 - 636
Exon 4 To Exon 5 (Pair 2)
Forward (527,22)TAGGCCGAGGTAAATACAGTGAAmplicon SizecDNA: 141 bpgenomic: 5,324
Reverse (667,22)GACCTCCTCTCAAATTCTCCAANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.892 kcal/mol
Forward Dimers-2.42 kcal/mol
Reverse Loops2.186 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.51 kcal/mol inside primersite
Amplicon SequenceTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATAATGAAAAAG
TTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAATAAAGATTT
TGGAGAATTTGAGAGGAGGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)141527 - 667
NM_177560 (CSNK2A1)141200 - 340
NM_001256686 ()141372 - 512
NM_001895 (CSNK2A1)141410 - 550
Exon 4 To Exon 6 (Pair 2)
Forward (526,22)TTAGGCCGAGGTAAATACAGTGAmplicon SizecDNA: 229 bpgenomic: 5,939
Reverse (754,23)AGTCTGTGTTGTTTACGTGTTCANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.892 kcal/mol in 3' area
Forward Dimers-2.42 kcal/mol
Reverse Loops1.988 kcal/mol
Reverse Dimers-2.184 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.202 kcal/mol outside primersite
Amplicon SequenceTTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATAATGAAAAA
GTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAATAAAGATT
TTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCT
GTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)229526 - 754
NM_177560 (CSNK2A1)229199 - 427
NM_001256686 ()229371 - 599
NM_001895 (CSNK2A1)229409 - 637
Exon 4 To Exon 5 (Pair 1)
Forward (526,22)TTAGGCCGAGGTAAATACAGTGAmplicon SizecDNA: 142 bpgenomic: 5,325
Reverse (667,22)GACCTCCTCTCAAATTCTCCAANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.892 kcal/mol in 3' area
Forward Dimers-2.42 kcal/mol
Reverse Loops2.186 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.51 kcal/mol inside primersite
Amplicon SequenceTTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATAATGAAAAA
GTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAATAAAGATT
TTGGAGAATTTGAGAGGAGGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)142526 - 667
NM_177560 (CSNK2A1)142199 - 340
NM_001256686 ()142371 - 512
NM_001895 (CSNK2A1)142409 - 550
Exon 4 To Exon 6 (Pair 1)
Forward (527,22)TAGGCCGAGGTAAATACAGTGAAmplicon SizecDNA: 228 bpgenomic: 5,938
Reverse (754,23)AGTCTGTGTTGTTTACGTGTTCANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.892 kcal/mol
Forward Dimers-2.42 kcal/mol
Reverse Loops1.988 kcal/mol
Reverse Dimers-2.184 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.202 kcal/mol outside primersite
Amplicon SequenceTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATAATGAAAAAG
TTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAATAAAGATTT
TGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTG
TGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 8 (Pair 44)
Forward (649,21)GAGAATTTGAGAGGAGGTCCCAmplicon SizecDNA: 192 bpgenomic: 4,111
Reverse (840,21)GCTGTGACAATAATCCAGGGCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.345 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops2.093 kcal/mol in 3' area
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTG
TCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTAC
CAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGAT
TATTGTCACAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)192649 - 840
NM_177560 (CSNK2A1)192322 - 513
NM_001256686 ()192494 - 685
NM_001895 (CSNK2A1)192532 - 723
Exon 5 To Exon 8 (Pair 43)
Forward (649,21)GAGAATTTGAGAGGAGGTCCCAmplicon SizecDNA: 206 bpgenomic: 4,125
Reverse (854,22)TGCATAATTCCCATGCTGTGACNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.345 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.072 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.031 kcal/mol inside primersite
Amplicon SequenceGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTG
TCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTAC
CAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGAT
TATTGTCACAGCATGGGAATTATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)206649 - 854
NM_177560 (CSNK2A1)206322 - 527
NM_001256686 ()206494 - 699
NM_001895 (CSNK2A1)206532 - 737
Exon 5 To Exon 8 (Pair 42)
Forward (648,21)GGAGAATTTGAGAGGAGGTCCAmplicon SizecDNA: 206 bpgenomic: 4,125
Reverse (853,22)GCATAATTCCCATGCTGTGACANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.464 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.343 kcal/mol
Reverse Dimers-1.514 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGT
GTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTA
CCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGA
TTATTGTCACAGCATGGGAATTATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)206648 - 853
NM_177560 (CSNK2A1)206321 - 526
NM_001256686 ()206493 - 698
NM_001895 (CSNK2A1)206531 - 736
Exon 5 To Exon 8 (Pair 41)
Forward (650,22)AGAATTTGAGAGGAGGTCCCAAAmplicon SizecDNA: 195 bpgenomic: 4,114
Reverse (844,22)CCATGCTGTGACAATAATCCAGNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.001 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTGT
CACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTACC
AGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGATT
ATTGTCACAGCATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)195650 - 844
NM_177560 (CSNK2A1)195323 - 517
NM_001256686 ()195495 - 689
NM_001895 (CSNK2A1)195533 - 727
Exon 5 To Exon 8 (Pair 40)
Forward (648,21)GGAGAATTTGAGAGGAGGTCCAmplicon SizecDNA: 208 bpgenomic: 4,127
Reverse (855,22)GTGCATAATTCCCATGCTGTGANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.464 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.072 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.031 kcal/mol inside primersite
Amplicon SequenceGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGT
GTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTA
CCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGA
TTATTGTCACAGCATGGGAATTATGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)208648 - 855
NM_177560 (CSNK2A1)208321 - 528
NM_001256686 ()208493 - 700
NM_001895 (CSNK2A1)208531 - 738
Exon 5 To Exon 8 (Pair 39)
Forward (648,21)GGAGAATTTGAGAGGAGGTCCAmplicon SizecDNA: 197 bpgenomic: 4,116
Reverse (844,22)CCATGCTGTGACAATAATCCAGNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.464 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGT
GTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTA
CCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGA
TTATTGTCACAGCATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)197648 - 844
NM_177560 (CSNK2A1)197321 - 517
NM_001256686 ()197493 - 689
NM_001895 (CSNK2A1)197531 - 727
Exon 5 To Exon 8 (Pair 38)
Forward (650,22)AGAATTTGAGAGGAGGTCCCAAAmplicon SizecDNA: 196 bpgenomic: 4,115
Reverse (845,22)CCCATGCTGTGACAATAATCCANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.001 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTGT
CACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTACC
AGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGATT
ATTGTCACAGCATGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)196650 - 845
NM_177560 (CSNK2A1)196323 - 518
NM_001256686 ()196495 - 690
NM_001895 (CSNK2A1)196533 - 728
Exon 5 To Exon 8 (Pair 37)
Forward (646,22)TTGGAGAATTTGAGAGGAGGTCAmplicon SizecDNA: 195 bpgenomic: 4,114
Reverse (840,21)GCTGTGACAATAATCCAGGGCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-1.062 kcal/mol
Reverse Loops2.093 kcal/mol in 3' area
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCT
GTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTG
TACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTG
GATTATTGTCACAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)195646 - 840
NM_177560 (CSNK2A1)195319 - 513
NM_001256686 ()195491 - 685
NM_001895 (CSNK2A1)195529 - 723
Exon 5 To Exon 8 (Pair 36)
Forward (646,22)TTGGAGAATTTGAGAGGAGGTCAmplicon SizecDNA: 198 bpgenomic: 4,117
Reverse (843,22)CATGCTGTGACAATAATCCAGGNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-1.062 kcal/mol
Reverse Loops1.572 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCT
GTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTG
TACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTG
GATTATTGTCACAGCATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)198646 - 843
NM_177560 (CSNK2A1)198319 - 516
NM_001256686 ()198491 - 688
NM_001895 (CSNK2A1)198529 - 726
Exon 5 To Exon 8 (Pair 35)
Forward (649,21)GAGAATTTGAGAGGAGGTCCCAmplicon SizecDNA: 202 bpgenomic: 4,121
Reverse (850,24)TAATTCCCATGCTGTGACAATAATNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.345 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTG
TCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTAC
CAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGAT
TATTGTCACAGCATGGGAATTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)202649 - 850
NM_177560 (CSNK2A1)202322 - 523
NM_001256686 ()202494 - 695
NM_001895 (CSNK2A1)202532 - 733
Exon 5 To Exon 8 (Pair 34)
Forward (650,22)AGAATTTGAGAGGAGGTCCCAAAmplicon SizecDNA: 206 bpgenomic: 4,125
Reverse (855,22)GTGCATAATTCCCATGCTGTGANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.001 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.072 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.031 kcal/mol inside primersite
Amplicon SequenceAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTGT
CACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTACC
AGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGATT
ATTGTCACAGCATGGGAATTATGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)206650 - 855
NM_177560 (CSNK2A1)206323 - 528
NM_001256686 ()206495 - 700
NM_001895 (CSNK2A1)206533 - 738
Exon 5 To Exon 8 (Pair 33)
Forward (648,21)GGAGAATTTGAGAGGAGGTCCAmplicon SizecDNA: 196 bpgenomic: 4,115
Reverse (843,22)CATGCTGTGACAATAATCCAGGNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.464 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.572 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGT
GTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTA
CCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGA
TTATTGTCACAGCATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)196648 - 843
NM_177560 (CSNK2A1)196321 - 516
NM_001256686 ()196493 - 688
NM_001895 (CSNK2A1)196531 - 726
Exon 5 To Exon 8 (Pair 32)
Forward (650,22)AGAATTTGAGAGGAGGTCCCAAAmplicon SizecDNA: 197 bpgenomic: 4,116
Reverse (846,22)TCCCATGCTGTGACAATAATCCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.001 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTGT
CACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTACC
AGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGATT
ATTGTCACAGCATGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)197650 - 846
NM_177560 (CSNK2A1)197323 - 519
NM_001256686 ()197495 - 691
NM_001895 (CSNK2A1)197533 - 729
Exon 5 To Exon 8 (Pair 31)
Forward (649,21)GAGAATTTGAGAGGAGGTCCCAmplicon SizecDNA: 205 bpgenomic: 4,124
Reverse (853,22)GCATAATTCCCATGCTGTGACANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.345 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.343 kcal/mol
Reverse Dimers-1.514 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTG
TCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTAC
CAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGAT
TATTGTCACAGCATGGGAATTATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)205649 - 853
NM_177560 (CSNK2A1)205322 - 526
NM_001256686 ()205494 - 698
NM_001895 (CSNK2A1)205532 - 736
Exon 5 To Exon 8 (Pair 30)
Forward (646,22)TTGGAGAATTTGAGAGGAGGTCAmplicon SizecDNA: 208 bpgenomic: 4,127
Reverse (853,22)GCATAATTCCCATGCTGTGACANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-1.062 kcal/mol
Reverse Loops1.343 kcal/mol
Reverse Dimers-1.514 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCT
GTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTG
TACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTG
GATTATTGTCACAGCATGGGAATTATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)208646 - 853
NM_177560 (CSNK2A1)208319 - 526
NM_001256686 ()208491 - 698
NM_001895 (CSNK2A1)208529 - 736
Exon 5 To Exon 8 (Pair 29)
Forward (649,21)GAGAATTTGAGAGGAGGTCCCAmplicon SizecDNA: 196 bpgenomic: 4,115
Reverse (844,22)CCATGCTGTGACAATAATCCAGNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.345 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTG
TCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTAC
CAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGAT
TATTGTCACAGCATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)196649 - 844
NM_177560 (CSNK2A1)196322 - 517
NM_001256686 ()196494 - 689
NM_001895 (CSNK2A1)196532 - 727
Exon 5 To Exon 8 (Pair 28)
Forward (650,22)AGAATTTGAGAGGAGGTCCCAAAmplicon SizecDNA: 201 bpgenomic: 4,120
Reverse (850,24)TAATTCCCATGCTGTGACAATAATNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.001 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTGT
CACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTACC
AGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGATT
ATTGTCACAGCATGGGAATTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)201650 - 850
NM_177560 (CSNK2A1)201323 - 523
NM_001256686 ()201495 - 695
NM_001895 (CSNK2A1)201533 - 733
Exon 5 To Exon 8 (Pair 27)
Forward (648,21)GGAGAATTTGAGAGGAGGTCCAmplicon SizecDNA: 195 bpgenomic: 4,114
Reverse (842,22)ATGCTGTGACAATAATCCAGGGNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.464 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops2.066 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGT
GTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTA
CCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGA
TTATTGTCACAGCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)195648 - 842
NM_177560 (CSNK2A1)195321 - 515
NM_001256686 ()195493 - 687
NM_001895 (CSNK2A1)195531 - 725
Exon 5 To Exon 8 (Pair 26)
Forward (648,21)GGAGAATTTGAGAGGAGGTCCAmplicon SizecDNA: 207 bpgenomic: 4,126
Reverse (854,22)TGCATAATTCCCATGCTGTGACNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.464 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.072 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.031 kcal/mol inside primersite
Amplicon SequenceGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGT
GTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTA
CCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGA
TTATTGTCACAGCATGGGAATTATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)207648 - 854
NM_177560 (CSNK2A1)207321 - 527
NM_001256686 ()207493 - 699
NM_001895 (CSNK2A1)207531 - 737
Exon 5 To Exon 8 (Pair 25)
Forward (648,21)GGAGAATTTGAGAGGAGGTCCAmplicon SizecDNA: 201 bpgenomic: 4,120
Reverse (848,23)ATTCCCATGCTGTGACAATAATCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.464 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGT
GTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTA
CCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGA
TTATTGTCACAGCATGGGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)201648 - 848
NM_177560 (CSNK2A1)201321 - 521
NM_001256686 ()201493 - 693
NM_001895 (CSNK2A1)201531 - 731
Exon 5 To Exon 8 (Pair 24)
Forward (646,22)TTGGAGAATTTGAGAGGAGGTCAmplicon SizecDNA: 197 bpgenomic: 4,116
Reverse (842,22)ATGCTGTGACAATAATCCAGGGNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-1.062 kcal/mol
Reverse Loops2.066 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCT
GTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTG
TACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTG
GATTATTGTCACAGCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)197646 - 842
NM_177560 (CSNK2A1)197319 - 515
NM_001256686 ()197491 - 687
NM_001895 (CSNK2A1)197529 - 725
Exon 5 To Exon 8 (Pair 23)
Forward (649,21)GAGAATTTGAGAGGAGGTCCCAmplicon SizecDNA: 194 bpgenomic: 4,113
Reverse (842,22)ATGCTGTGACAATAATCCAGGGNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.345 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops2.066 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTG
TCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTAC
CAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGAT
TATTGTCACAGCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)194649 - 842
NM_177560 (CSNK2A1)194322 - 515
NM_001256686 ()194494 - 687
NM_001895 (CSNK2A1)194532 - 725
Exon 5 To Exon 8 (Pair 22)
Forward (646,22)TTGGAGAATTTGAGAGGAGGTCAmplicon SizecDNA: 210 bpgenomic: 4,129
Reverse (855,22)GTGCATAATTCCCATGCTGTGANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-1.062 kcal/mol
Reverse Loops1.072 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.031 kcal/mol inside primersite
Amplicon SequenceTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCT
GTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTG
TACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTG
GATTATTGTCACAGCATGGGAATTATGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)210646 - 855
NM_177560 (CSNK2A1)210319 - 528
NM_001256686 ()210491 - 700
NM_001895 (CSNK2A1)210529 - 738
Exon 5 To Exon 8 (Pair 21)
Forward (646,22)TTGGAGAATTTGAGAGGAGGTCAmplicon SizecDNA: 200 bpgenomic: 4,119
Reverse (845,22)CCCATGCTGTGACAATAATCCANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCT
GTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTG
TACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTG
GATTATTGTCACAGCATGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)200646 - 845
NM_177560 (CSNK2A1)200319 - 518
NM_001256686 ()200491 - 690
NM_001895 (CSNK2A1)200529 - 728
Exon 5 To Exon 8 (Pair 20)
Forward (646,22)TTGGAGAATTTGAGAGGAGGTCAmplicon SizecDNA: 203 bpgenomic: 4,122
Reverse (848,23)ATTCCCATGCTGTGACAATAATCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCT
GTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTG
TACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTG
GATTATTGTCACAGCATGGGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)203646 - 848
NM_177560 (CSNK2A1)203319 - 521
NM_001256686 ()203491 - 693
NM_001895 (CSNK2A1)203529 - 731
Exon 5 To Exon 8 (Pair 19)
Forward (648,21)GGAGAATTTGAGAGGAGGTCCAmplicon SizecDNA: 199 bpgenomic: 4,118
Reverse (846,22)TCCCATGCTGTGACAATAATCCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.464 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGT
GTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTA
CCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGA
TTATTGTCACAGCATGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)199648 - 846
NM_177560 (CSNK2A1)199321 - 519
NM_001256686 ()199493 - 691
NM_001895 (CSNK2A1)199531 - 729
Exon 5 To Exon 8 (Pair 18)
Forward (649,21)GAGAATTTGAGAGGAGGTCCCAmplicon SizecDNA: 198 bpgenomic: 4,117
Reverse (846,22)TCCCATGCTGTGACAATAATCCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.345 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTG
TCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTAC
CAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGAT
TATTGTCACAGCATGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)198649 - 846
NM_177560 (CSNK2A1)198322 - 519
NM_001256686 ()198494 - 691
NM_001895 (CSNK2A1)198532 - 729
Exon 5 To Exon 8 (Pair 17)
Forward (646,22)TTGGAGAATTTGAGAGGAGGTCAmplicon SizecDNA: 199 bpgenomic: 4,118
Reverse (844,22)CCATGCTGTGACAATAATCCAGNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCT
GTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTG
TACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTG
GATTATTGTCACAGCATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)199646 - 844
NM_177560 (CSNK2A1)199319 - 517
NM_001256686 ()199491 - 689
NM_001895 (CSNK2A1)199529 - 727
Exon 5 To Exon 8 (Pair 16)
Forward (650,22)AGAATTTGAGAGGAGGTCCCAAAmplicon SizecDNA: 199 bpgenomic: 4,118
Reverse (848,23)ATTCCCATGCTGTGACAATAATCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.001 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTGT
CACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTACC
AGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGATT
ATTGTCACAGCATGGGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)199650 - 848
NM_177560 (CSNK2A1)199323 - 521
NM_001256686 ()199495 - 693
NM_001895 (CSNK2A1)199533 - 731
Exon 5 To Exon 8 (Pair 15)
Forward (649,21)GAGAATTTGAGAGGAGGTCCCAmplicon SizecDNA: 207 bpgenomic: 4,126
Reverse (855,22)GTGCATAATTCCCATGCTGTGANr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.345 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.072 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.031 kcal/mol inside primersite
Amplicon SequenceGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTG
TCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTAC
CAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGAT
TATTGTCACAGCATGGGAATTATGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)207649 - 855
NM_177560 (CSNK2A1)207322 - 528
NM_001256686 ()207494 - 700
NM_001895 (CSNK2A1)207532 - 738
Exon 5 To Exon 8 (Pair 14)
Forward (649,21)GAGAATTTGAGAGGAGGTCCCAmplicon SizecDNA: 195 bpgenomic: 4,114
Reverse (843,22)CATGCTGTGACAATAATCCAGGNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.345 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.572 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTG
TCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTAC
CAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGAT
TATTGTCACAGCATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)195649 - 843
NM_177560 (CSNK2A1)195322 - 516
NM_001256686 ()195494 - 688
NM_001895 (CSNK2A1)195532 - 726
Exon 5 To Exon 8 (Pair 13)
Forward (646,22)TTGGAGAATTTGAGAGGAGGTCAmplicon SizecDNA: 209 bpgenomic: 4,128
Reverse (854,22)TGCATAATTCCCATGCTGTGACNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-1.062 kcal/mol
Reverse Loops1.072 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.031 kcal/mol inside primersite
Amplicon SequenceTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCT
GTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTG
TACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTG
GATTATTGTCACAGCATGGGAATTATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)209646 - 854
NM_177560 (CSNK2A1)209319 - 527
NM_001256686 ()209491 - 699
NM_001895 (CSNK2A1)209529 - 737
Exon 5 To Exon 8 (Pair 12)
Forward (646,22)TTGGAGAATTTGAGAGGAGGTCAmplicon SizecDNA: 201 bpgenomic: 4,120
Reverse (846,22)TCCCATGCTGTGACAATAATCCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.474 kcal/mol
Forward Dimers-1.062 kcal/mol
Reverse Loops1.361 kcal/mol
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCT
GTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTG
TACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTG
GATTATTGTCACAGCATGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)201646 - 846
NM_177560 (CSNK2A1)201319 - 519
NM_001256686 ()201491 - 691
NM_001895 (CSNK2A1)201529 - 729
Exon 5 To Exon 8 (Pair 11)
Forward (648,21)GGAGAATTTGAGAGGAGGTCCAmplicon SizecDNA: 193 bpgenomic: 4,112
Reverse (840,21)GCTGTGACAATAATCCAGGGCNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.464 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops2.093 kcal/mol in 3' area
Reverse Dimers-0.522 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.054 kcal/mol outside primersite
Amplicon SequenceGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGT
GTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTA
CCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGA
TTATTGTCACAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)193648 - 840
NM_177560 (CSNK2A1)193321 - 513
NM_001256686 ()193493 - 685
NM_001895 (CSNK2A1)193531 - 723
Exon 5 To Exon 8 (Pair 10)
Forward (650,22)AGAATTTGAGAGGAGGTCCCAAAmplicon SizecDNA: 205 bpgenomic: 4,124
Reverse (854,22)TGCATAATTCCCATGCTGTGACNr. of Isoforms 4 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.001 kcal/mol in 3' area
Forward Dimers-1.062 kcal/mol
Reverse Loops1.072 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.031 kcal/mol inside primersite
Amplicon SequenceAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTGT
CACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTACC
AGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGATT
ATTGTCACAGCATGGGAATTATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_177559 (CSNK2A1)205650 - 854
NM_177560 (CSNK2A1)205323 - 527
NM_001256686 ()205495 - 699
NM_001895 (CSNK2A1)205533 - 737
 

See below for some more details.

Program Output:

Loading ...