Design Results for CSNK2A2

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 3 To Exon 5 (Pair 10)
Forward (408,24)TTCGTGGTGGAACAAATATCATTAAmplicon SizecDNA: 127 bpgenomic: 12,320
Reverse (534,22)TCTGTCAGGATCTGGTAGAGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.532 kcal/mol in 3' area
Reverse Dimers-0.288 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGA
CACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCC
TGACAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)127408 - 534
Exon 3 To Exon 6 (Pair 74)
Forward (382,22)ACGAGAGGTTAAGATTCTGGAGAmplicon SizecDNA: 223 bpgenomic: 18,173
Reverse (604,21)CATGATTCCCTTGCTGTGGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.298 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.531 kcal/mol in 3' area
Reverse Dimers-1.208 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGA
CACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATAC
AGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGA
ACTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)223382 - 604
Exon 3 To Exon 6 (Pair 73)
Forward (380,23)AAACGAGAGGTTAAGATTCTGGAAmplicon SizecDNA: 216 bpgenomic: 18,166
Reverse (595,21)CTTGCTGTGGCAGTAATCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.375 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.531 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceAAACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATT
GACACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAAT
ACAGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTAT
GAACTACTTAAAGCTCTGGATTACTGCCACAGCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)216380 - 595
Exon 3 To Exon 6 (Pair 72)
Forward (382,22)ACGAGAGGTTAAGATTCTGGAGAmplicon SizecDNA: 215 bpgenomic: 18,165
Reverse (596,21)CCTTGCTGTGGCAGTAATCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.298 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.531 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGA
CACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATAC
AGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGA
ACTACTTAAAGCTCTGGATTACTGCCACAGCAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)215382 - 596
Exon 3 To Exon 6 (Pair 71)
Forward (408,24)TTCGTGGTGGAACAAATATCATTAAmplicon SizecDNA: 203 bpgenomic: 18,153
Reverse (610,21)CCTGTGCATGATTCCCTTGCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.425 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGA
CACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCC
TGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCC
ACAGCAAGGGAATCATGCACAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)203408 - 610
Exon 3 To Exon 6 (Pair 70)
Forward (383,22)CGAGAGGTTAAGATTCTGGAGAAmplicon SizecDNA: 222 bpgenomic: 18,172
Reverse (604,21)CATGATTCCCTTGCTGTGGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.729 kcal/mol
Forward Dimers-0.581 kcal/mol
Reverse Loops0.531 kcal/mol in 3' area
Reverse Dimers-1.208 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceCGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGAC
ACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATACA
GATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGAA
CTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)222383 - 604
Exon 3 To Exon 6 (Pair 69)
Forward (409,24)TCGTGGTGGAACAAATATCATTAAAmplicon SizecDNA: 188 bpgenomic: 18,138
Reverse (596,21)CCTTGCTGTGGCAGTAATCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops0.531 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGAC
ACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCT
GACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCA
CAGCAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)188409 - 596
Exon 3 To Exon 6 (Pair 68)
Forward (408,24)TTCGTGGTGGAACAAATATCATTAAmplicon SizecDNA: 234 bpgenomic: 18,184
Reverse (641,23)GATCTATCATGACATTGTGAGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.413 kcal/mol in 3' area
Reverse Dimers-1.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.784 kcal/mol outside primersite
Amplicon SequenceTTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGA
CACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCC
TGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCC
ACAGCAAGGGAATCATGCACAGGGATGTGAAACCTCACAATGTCATGATAGATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)234408 - 641
Exon 3 To Exon 5 (Pair 9)
Forward (383,22)CGAGAGGTTAAGATTCTGGAGAAmplicon SizecDNA: 153 bpgenomic: 12,346
Reverse (535,21)GTCTGTCAGGATCTGGTAGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.729 kcal/mol
Forward Dimers-0.581 kcal/mol
Reverse Loops1.532 kcal/mol in 3' area
Reverse Dimers-0.318 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceCGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGAC
ACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATACA
GATTTTAAGCAACTCTACCAGATCCTGACAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)153383 - 535
Exon 3 To Exon 6 (Pair 67)
Forward (409,24)TCGTGGTGGAACAAATATCATTAAAmplicon SizecDNA: 201 bpgenomic: 18,151
Reverse (609,21)CTGTGCATGATTCCCTTGCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.425 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGAC
ACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCT
GACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCA
CAGCAAGGGAATCATGCACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)201409 - 609
Exon 3 To Exon 6 (Pair 66)
Forward (409,24)TCGTGGTGGAACAAATATCATTAAAmplicon SizecDNA: 185 bpgenomic: 18,135
Reverse (593,21)TGCTGTGGCAGTAATCCAGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops0.602 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGAC
ACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCT
GACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCA
CAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)185409 - 593
Exon 3 To Exon 6 (Pair 64)
Forward (408,24)TTCGTGGTGGAACAAATATCATTAAmplicon SizecDNA: 199 bpgenomic: 18,149
Reverse (606,21)TGCATGATTCCCTTGCTGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.425 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGA
CACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCC
TGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCC
ACAGCAAGGGAATCATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)199408 - 606
Exon 3 To Exon 6 (Pair 65)
Forward (383,22)CGAGAGGTTAAGATTCTGGAGAAmplicon SizecDNA: 214 bpgenomic: 18,164
Reverse (596,21)CCTTGCTGTGGCAGTAATCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.729 kcal/mol
Forward Dimers-0.581 kcal/mol
Reverse Loops0.531 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceCGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGAC
ACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATACA
GATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGAA
CTACTTAAAGCTCTGGATTACTGCCACAGCAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)214383 - 596
Exon 3 To Exon 5 (Pair 8)
Forward (409,24)TCGTGGTGGAACAAATATCATTAAAmplicon SizecDNA: 127 bpgenomic: 12,320
Reverse (535,21)GTCTGTCAGGATCTGGTAGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.532 kcal/mol in 3' area
Reverse Dimers-0.318 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGAC
ACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCT
GACAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)127409 - 535
Exon 3 To Exon 6 (Pair 63)
Forward (382,22)ACGAGAGGTTAAGATTCTGGAGAmplicon SizecDNA: 231 bpgenomic: 18,181
Reverse (612,21)TCCCTGTGCATGATTCCCTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.298 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops2.253 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGA
CACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATAC
AGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGA
ACTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCACAGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)231382 - 612
Exon 3 To Exon 6 (Pair 62)
Forward (382,22)ACGAGAGGTTAAGATTCTGGAGAmplicon SizecDNA: 229 bpgenomic: 18,179
Reverse (610,21)CCTGTGCATGATTCCCTTGCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.298 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.425 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGA
CACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATAC
AGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGA
ACTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCACAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)229382 - 610
Exon 3 To Exon 6 (Pair 61)
Forward (383,22)CGAGAGGTTAAGATTCTGGAGAAmplicon SizecDNA: 225 bpgenomic: 18,175
Reverse (607,21)GTGCATGATTCCCTTGCTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.729 kcal/mol
Forward Dimers-0.581 kcal/mol
Reverse Loops1.425 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceCGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGAC
ACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATACA
GATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGAA
CTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)225383 - 607
Exon 3 To Exon 6 (Pair 60)
Forward (380,23)AAACGAGAGGTTAAGATTCTGGAAmplicon SizecDNA: 221 bpgenomic: 18,171
Reverse (600,22)ATTCCCTTGCTGTGGCAGTAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.375 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.531 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceAAACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATT
GACACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAAT
ACAGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTAT
GAACTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)221380 - 600
Exon 3 To Exon 6 (Pair 59)
Forward (409,24)TCGTGGTGGAACAAATATCATTAAAmplicon SizecDNA: 237 bpgenomic: 18,187
Reverse (645,23)TGGTGATCTATCATGACATTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.784 kcal/mol outside primersite
Amplicon SequenceTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGAC
ACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCT
GACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCA
CAGCAAGGGAATCATGCACAGGGATGTGAAACCTCACAATGTCATGATAGATCACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)237409 - 645
Exon 3 To Exon 6 (Pair 58)
Forward (408,24)TTCGTGGTGGAACAAATATCATTAAmplicon SizecDNA: 191 bpgenomic: 18,141
Reverse (598,21)TCCCTTGCTGTGGCAGTAATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops0.531 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGA
CACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCC
TGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCC
ACAGCAAGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)191408 - 598
Exon 3 To Exon 6 (Pair 57)
Forward (409,24)TCGTGGTGGAACAAATATCATTAAAmplicon SizecDNA: 199 bpgenomic: 18,149
Reverse (607,21)GTGCATGATTCCCTTGCTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.425 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGAC
ACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCT
GACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCA
CAGCAAGGGAATCATGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)199409 - 607
Exon 3 To Exon 5 (Pair 7)
Forward (409,24)TCGTGGTGGAACAAATATCATTAAAmplicon SizecDNA: 126 bpgenomic: 12,319
Reverse (534,22)TCTGTCAGGATCTGGTAGAGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.532 kcal/mol in 3' area
Reverse Dimers-0.288 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGAC
ACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCT
GACAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)126409 - 534
Exon 3 To Exon 6 (Pair 55)
Forward (408,24)TTCGTGGTGGAACAAATATCATTAAmplicon SizecDNA: 205 bpgenomic: 18,155
Reverse (612,21)TCCCTGTGCATGATTCCCTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops2.253 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGA
CACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCC
TGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCC
ACAGCAAGGGAATCATGCACAGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)205408 - 612
Exon 3 To Exon 6 (Pair 56)
Forward (409,24)TCGTGGTGGAACAAATATCATTAAAmplicon SizecDNA: 190 bpgenomic: 18,140
Reverse (598,21)TCCCTTGCTGTGGCAGTAATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops0.531 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGAC
ACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCT
GACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCA
CAGCAAGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)190409 - 598
Exon 3 To Exon 6 (Pair 54)
Forward (382,22)ACGAGAGGTTAAGATTCTGGAGAmplicon SizecDNA: 225 bpgenomic: 18,175
Reverse (606,21)TGCATGATTCCCTTGCTGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.298 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.425 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGA
CACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATAC
AGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGA
ACTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)225382 - 606
Exon 3 To Exon 6 (Pair 53)
Forward (409,24)TCGTGGTGGAACAAATATCATTAAAmplicon SizecDNA: 232 bpgenomic: 18,182
Reverse (640,24)ATCTATCATGACATTGTGAGGTTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.413 kcal/mol
Reverse Dimers-1.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.784 kcal/mol outside primersite
Amplicon SequenceTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGAC
ACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCT
GACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCA
CAGCAAGGGAATCATGCACAGGGATGTGAAACCTCACAATGTCATGATAGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)232409 - 640
Exon 3 To Exon 6 (Pair 52)
Forward (409,24)TCGTGGTGGAACAAATATCATTAAAmplicon SizecDNA: 235 bpgenomic: 18,185
Reverse (643,23)GTGATCTATCATGACATTGTGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.413 kcal/mol in 3' area
Reverse Dimers-1.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.784 kcal/mol outside primersite
Amplicon SequenceTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGAC
ACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCT
GACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCA
CAGCAAGGGAATCATGCACAGGGATGTGAAACCTCACAATGTCATGATAGATCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)235409 - 643
Exon 3 To Exon 6 (Pair 51)
Forward (382,22)ACGAGAGGTTAAGATTCTGGAGAmplicon SizecDNA: 233 bpgenomic: 18,183
Reverse (614,21)CATCCCTGTGCATGATTCCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.298 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.844 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGA
CACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATAC
AGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGA
ACTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCACAGGGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)233382 - 614
Exon 3 To Exon 6 (Pair 50)
Forward (380,23)AAACGAGAGGTTAAGATTCTGGAAmplicon SizecDNA: 225 bpgenomic: 18,175
Reverse (604,21)CATGATTCCCTTGCTGTGGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.375 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.531 kcal/mol in 3' area
Reverse Dimers-1.208 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceAAACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATT
GACACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAAT
ACAGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTAT
GAACTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)225380 - 604
Exon 3 To Exon 6 (Pair 49)
Forward (380,23)AAACGAGAGGTTAAGATTCTGGAAmplicon SizecDNA: 227 bpgenomic: 18,177
Reverse (606,21)TGCATGATTCCCTTGCTGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.375 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.425 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceAAACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATT
GACACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAAT
ACAGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTAT
GAACTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)227380 - 606
Exon 3 To Exon 6 (Pair 48)
Forward (382,22)ACGAGAGGTTAAGATTCTGGAGAmplicon SizecDNA: 217 bpgenomic: 18,167
Reverse (598,21)TCCCTTGCTGTGGCAGTAATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.298 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.531 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGA
CACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATAC
AGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGA
ACTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)217382 - 598
Exon 3 To Exon 6 (Pair 47)
Forward (408,24)TTCGTGGTGGAACAAATATCATTAAmplicon SizecDNA: 189 bpgenomic: 18,139
Reverse (596,21)CCTTGCTGTGGCAGTAATCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops0.531 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGA
CACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCC
TGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCC
ACAGCAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)189408 - 596
Exon 3 To Exon 6 (Pair 46)
Forward (408,24)TTCGTGGTGGAACAAATATCATTAAmplicon SizecDNA: 237 bpgenomic: 18,187
Reverse (644,23)GGTGATCTATCATGACATTGTGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.413 kcal/mol in 3' area
Reverse Dimers-1.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.784 kcal/mol outside primersite
Amplicon SequenceTTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGA
CACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCC
TGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCC
ACAGCAAGGGAATCATGCACAGGGATGTGAAACCTCACAATGTCATGATAGATCACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)237408 - 644
Exon 3 To Exon 6 (Pair 45)
Forward (380,23)AAACGAGAGGTTAAGATTCTGGAAmplicon SizecDNA: 214 bpgenomic: 18,164
Reverse (593,21)TGCTGTGGCAGTAATCCAGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.375 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.602 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceAAACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATT
GACACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAAT
ACAGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTAT
GAACTACTTAAAGCTCTGGATTACTGCCACAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)214380 - 593
Exon 3 To Exon 5 (Pair 6)
Forward (383,22)CGAGAGGTTAAGATTCTGGAGAAmplicon SizecDNA: 152 bpgenomic: 12,345
Reverse (534,22)TCTGTCAGGATCTGGTAGAGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.729 kcal/mol
Forward Dimers-0.581 kcal/mol
Reverse Loops1.532 kcal/mol in 3' area
Reverse Dimers-0.288 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceCGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGAC
ACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATACA
GATTTTAAGCAACTCTACCAGATCCTGACAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)152383 - 534
Exon 3 To Exon 6 (Pair 44)
Forward (383,22)CGAGAGGTTAAGATTCTGGAGAAmplicon SizecDNA: 211 bpgenomic: 18,161
Reverse (593,21)TGCTGTGGCAGTAATCCAGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.729 kcal/mol
Forward Dimers-0.581 kcal/mol
Reverse Loops0.602 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceCGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGAC
ACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATACA
GATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGAA
CTACTTAAAGCTCTGGATTACTGCCACAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)211383 - 593
Exon 3 To Exon 6 (Pair 43)
Forward (408,24)TTCGTGGTGGAACAAATATCATTAAmplicon SizecDNA: 235 bpgenomic: 18,185
Reverse (642,23)TGATCTATCATGACATTGTGAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.413 kcal/mol in 3' area
Reverse Dimers-1.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.784 kcal/mol outside primersite
Amplicon SequenceTTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGA
CACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCC
TGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCC
ACAGCAAGGGAATCATGCACAGGGATGTGAAACCTCACAATGTCATGATAGATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)235408 - 642
Exon 3 To Exon 5 (Pair 5)
Forward (408,24)TTCGTGGTGGAACAAATATCATTAAmplicon SizecDNA: 128 bpgenomic: 12,321
Reverse (535,21)GTCTGTCAGGATCTGGTAGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.532 kcal/mol in 3' area
Reverse Dimers-0.318 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGA
CACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCC
TGACAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)128408 - 535
Exon 3 To Exon 6 (Pair 42)
Forward (409,24)TCGTGGTGGAACAAATATCATTAAAmplicon SizecDNA: 236 bpgenomic: 18,186
Reverse (644,23)GGTGATCTATCATGACATTGTGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.413 kcal/mol in 3' area
Reverse Dimers-1.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.784 kcal/mol outside primersite
Amplicon SequenceTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGAC
ACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCT
GACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCA
CAGCAAGGGAATCATGCACAGGGATGTGAAACCTCACAATGTCATGATAGATCACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)236409 - 644
Exon 3 To Exon 6 (Pair 41)
Forward (382,22)ACGAGAGGTTAAGATTCTGGAGAmplicon SizecDNA: 228 bpgenomic: 18,178
Reverse (609,21)CTGTGCATGATTCCCTTGCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.298 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.425 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGA
CACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATAC
AGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGA
ACTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)228382 - 609
Exon 3 To Exon 6 (Pair 40)
Forward (383,22)CGAGAGGTTAAGATTCTGGAGAAmplicon SizecDNA: 224 bpgenomic: 18,174
Reverse (606,21)TGCATGATTCCCTTGCTGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.729 kcal/mol
Forward Dimers-0.581 kcal/mol
Reverse Loops1.425 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceCGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGAC
ACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATACA
GATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGAA
CTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)224383 - 606
Exon 3 To Exon 6 (Pair 39)
Forward (409,24)TCGTGGTGGAACAAATATCATTAAAmplicon SizecDNA: 187 bpgenomic: 18,137
Reverse (595,21)CTTGCTGTGGCAGTAATCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops0.531 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGAC
ACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCT
GACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCA
CAGCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)187409 - 595
Exon 3 To Exon 5 (Pair 4)
Forward (382,22)ACGAGAGGTTAAGATTCTGGAGAmplicon SizecDNA: 153 bpgenomic: 12,346
Reverse (534,22)TCTGTCAGGATCTGGTAGAGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.298 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.532 kcal/mol in 3' area
Reverse Dimers-0.288 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGA
CACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATAC
AGATTTTAAGCAACTCTACCAGATCCTGACAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)153382 - 534
Exon 3 To Exon 6 (Pair 38)
Forward (380,23)AAACGAGAGGTTAAGATTCTGGAAmplicon SizecDNA: 235 bpgenomic: 18,185
Reverse (614,21)CATCCCTGTGCATGATTCCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.375 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.844 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceAAACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATT
GACACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAAT
ACAGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTAT
GAACTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCACAGGGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)235380 - 614
Exon 3 To Exon 6 (Pair 37)
Forward (383,22)CGAGAGGTTAAGATTCTGGAGAAmplicon SizecDNA: 228 bpgenomic: 18,178
Reverse (610,21)CCTGTGCATGATTCCCTTGCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.729 kcal/mol
Forward Dimers-0.581 kcal/mol
Reverse Loops1.425 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceCGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGAC
ACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATACA
GATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGAA
CTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCACAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)228383 - 610
Exon 3 To Exon 6 (Pair 36)
Forward (380,23)AAACGAGAGGTTAAGATTCTGGAAmplicon SizecDNA: 217 bpgenomic: 18,167
Reverse (596,21)CCTTGCTGTGGCAGTAATCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.375 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.531 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceAAACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATT
GACACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAAT
ACAGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTAT
GAACTACTTAAAGCTCTGGATTACTGCCACAGCAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)217380 - 596
Exon 3 To Exon 6 (Pair 35)
Forward (409,24)TCGTGGTGGAACAAATATCATTAAAmplicon SizecDNA: 239 bpgenomic: 18,189
Reverse (647,23)GTTGGTGATCTATCATGACATTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.784 kcal/mol outside primersite
Amplicon SequenceTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGAC
ACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCT
GACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCA
CAGCAAGGGAATCATGCACAGGGATGTGAAACCTCACAATGTCATGATAGATCACCAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)239409 - 647
Exon 3 To Exon 6 (Pair 34)
Forward (382,22)ACGAGAGGTTAAGATTCTGGAGAmplicon SizecDNA: 212 bpgenomic: 18,162
Reverse (593,21)TGCTGTGGCAGTAATCCAGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.298 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.602 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGA
CACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATAC
AGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGA
ACTACTTAAAGCTCTGGATTACTGCCACAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)212382 - 593
Exon 3 To Exon 6 (Pair 33)
Forward (408,24)TTCGTGGTGGAACAAATATCATTAAmplicon SizecDNA: 240 bpgenomic: 18,190
Reverse (647,23)GTTGGTGATCTATCATGACATTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.784 kcal/mol outside primersite
Amplicon SequenceTTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGA
CACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCC
TGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCC
ACAGCAAGGGAATCATGCACAGGGATGTGAAACCTCACAATGTCATGATAGATCACCAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)240408 - 647
Exon 3 To Exon 6 (Pair 32)
Forward (409,24)TCGTGGTGGAACAAATATCATTAAAmplicon SizecDNA: 204 bpgenomic: 18,154
Reverse (612,21)TCCCTGTGCATGATTCCCTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops2.253 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGAC
ACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCT
GACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCA
CAGCAAGGGAATCATGCACAGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)204409 - 612
Exon 3 To Exon 6 (Pair 31)
Forward (409,24)TCGTGGTGGAACAAATATCATTAAAmplicon SizecDNA: 206 bpgenomic: 18,156
Reverse (614,21)CATCCCTGTGCATGATTCCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.844 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGAC
ACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCT
GACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCA
CAGCAAGGGAATCATGCACAGGGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)206409 - 614
Exon 3 To Exon 6 (Pair 30)
Forward (409,24)TCGTGGTGGAACAAATATCATTAAAmplicon SizecDNA: 234 bpgenomic: 18,184
Reverse (642,23)TGATCTATCATGACATTGTGAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.413 kcal/mol in 3' area
Reverse Dimers-1.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.784 kcal/mol outside primersite
Amplicon SequenceTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGAC
ACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCT
GACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCA
CAGCAAGGGAATCATGCACAGGGATGTGAAACCTCACAATGTCATGATAGATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)234409 - 642
Exon 3 To Exon 6 (Pair 29)
Forward (380,23)AAACGAGAGGTTAAGATTCTGGAAmplicon SizecDNA: 219 bpgenomic: 18,169
Reverse (598,21)TCCCTTGCTGTGGCAGTAATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.375 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.531 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceAAACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATT
GACACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAAT
ACAGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTAT
GAACTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)219380 - 598
Exon 3 To Exon 6 (Pair 28)
Forward (380,23)AAACGAGAGGTTAAGATTCTGGAAmplicon SizecDNA: 233 bpgenomic: 18,183
Reverse (612,21)TCCCTGTGCATGATTCCCTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.375 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops2.253 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceAAACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATT
GACACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAAT
ACAGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTAT
GAACTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCACAGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)233380 - 612
Exon 3 To Exon 5 (Pair 3)
Forward (380,23)AAACGAGAGGTTAAGATTCTGGAAmplicon SizecDNA: 155 bpgenomic: 12,348
Reverse (534,22)TCTGTCAGGATCTGGTAGAGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.375 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.532 kcal/mol in 3' area
Reverse Dimers-0.288 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceAAACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATT
GACACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAAT
ACAGATTTTAAGCAACTCTACCAGATCCTGACAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)155380 - 534
Exon 3 To Exon 6 (Pair 27)
Forward (383,22)CGAGAGGTTAAGATTCTGGAGAAmplicon SizecDNA: 216 bpgenomic: 18,166
Reverse (598,21)TCCCTTGCTGTGGCAGTAATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.729 kcal/mol
Forward Dimers-0.581 kcal/mol
Reverse Loops0.531 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceCGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGAC
ACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATACA
GATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGAA
CTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)216383 - 598
Exon 3 To Exon 5 (Pair 2)
Forward (382,22)ACGAGAGGTTAAGATTCTGGAGAmplicon SizecDNA: 154 bpgenomic: 12,347
Reverse (535,21)GTCTGTCAGGATCTGGTAGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.298 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.532 kcal/mol in 3' area
Reverse Dimers-0.318 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGA
CACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATAC
AGATTTTAAGCAACTCTACCAGATCCTGACAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)154382 - 535
Exon 3 To Exon 6 (Pair 26)
Forward (408,24)TTCGTGGTGGAACAAATATCATTAAmplicon SizecDNA: 200 bpgenomic: 18,150
Reverse (607,21)GTGCATGATTCCCTTGCTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.425 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGA
CACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCC
TGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCC
ACAGCAAGGGAATCATGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)200408 - 607
Exon 3 To Exon 6 (Pair 25)
Forward (382,22)ACGAGAGGTTAAGATTCTGGAGAmplicon SizecDNA: 214 bpgenomic: 18,164
Reverse (595,21)CTTGCTGTGGCAGTAATCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.298 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.531 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGA
CACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATAC
AGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGA
ACTACTTAAAGCTCTGGATTACTGCCACAGCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)214382 - 595
Exon 3 To Exon 6 (Pair 24)
Forward (408,24)TTCGTGGTGGAACAAATATCATTAAmplicon SizecDNA: 193 bpgenomic: 18,143
Reverse (600,22)ATTCCCTTGCTGTGGCAGTAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops0.531 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGA
CACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCC
TGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCC
ACAGCAAGGGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)193408 - 600
Exon 3 To Exon 6 (Pair 23)
Forward (408,24)TTCGTGGTGGAACAAATATCATTAAmplicon SizecDNA: 238 bpgenomic: 18,188
Reverse (645,23)TGGTGATCTATCATGACATTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.784 kcal/mol outside primersite
Amplicon SequenceTTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGA
CACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCC
TGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCC
ACAGCAAGGGAATCATGCACAGGGATGTGAAACCTCACAATGTCATGATAGATCACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)238408 - 645
Exon 3 To Exon 6 (Pair 22)
Forward (408,24)TTCGTGGTGGAACAAATATCATTAAmplicon SizecDNA: 207 bpgenomic: 18,157
Reverse (614,21)CATCCCTGTGCATGATTCCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.844 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGA
CACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCC
TGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCC
ACAGCAAGGGAATCATGCACAGGGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)207408 - 614
Exon 3 To Exon 6 (Pair 21)
Forward (409,24)TCGTGGTGGAACAAATATCATTAAAmplicon SizecDNA: 198 bpgenomic: 18,148
Reverse (606,21)TGCATGATTCCCTTGCTGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.425 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGAC
ACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCT
GACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCA
CAGCAAGGGAATCATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)198409 - 606
Exon 3 To Exon 5 (Pair 1)
Forward (380,23)AAACGAGAGGTTAAGATTCTGGAAmplicon SizecDNA: 156 bpgenomic: 12,349
Reverse (535,21)GTCTGTCAGGATCTGGTAGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.375 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.532 kcal/mol in 3' area
Reverse Dimers-0.318 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceAAACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATT
GACACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAAT
ACAGATTTTAAGCAACTCTACCAGATCCTGACAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)156380 - 535
Exon 3 To Exon 6 (Pair 20)
Forward (408,24)TTCGTGGTGGAACAAATATCATTAAmplicon SizecDNA: 197 bpgenomic: 18,147
Reverse (604,21)CATGATTCCCTTGCTGTGGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops0.531 kcal/mol in 3' area
Reverse Dimers-1.208 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGA
CACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCC
TGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCC
ACAGCAAGGGAATCATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)197408 - 604
Exon 3 To Exon 6 (Pair 19)
Forward (382,22)ACGAGAGGTTAAGATTCTGGAGAmplicon SizecDNA: 219 bpgenomic: 18,169
Reverse (600,22)ATTCCCTTGCTGTGGCAGTAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.298 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.531 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGA
CACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATAC
AGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGA
ACTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)219382 - 600
Exon 3 To Exon 6 (Pair 17)
Forward (408,24)TTCGTGGTGGAACAAATATCATTAAmplicon SizecDNA: 188 bpgenomic: 18,138
Reverse (595,21)CTTGCTGTGGCAGTAATCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops0.531 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGA
CACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCC
TGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCC
ACAGCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)188408 - 595
Exon 3 To Exon 6 (Pair 18)
Forward (409,24)TCGTGGTGGAACAAATATCATTAAAmplicon SizecDNA: 196 bpgenomic: 18,146
Reverse (604,21)CATGATTCCCTTGCTGTGGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops0.531 kcal/mol in 3' area
Reverse Dimers-1.208 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGAC
ACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCT
GACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCA
CAGCAAGGGAATCATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)196409 - 604
Exon 3 To Exon 6 (Pair 16)
Forward (383,22)CGAGAGGTTAAGATTCTGGAGAAmplicon SizecDNA: 213 bpgenomic: 18,163
Reverse (595,21)CTTGCTGTGGCAGTAATCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.729 kcal/mol
Forward Dimers-0.581 kcal/mol
Reverse Loops0.531 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceCGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGAC
ACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATACA
GATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGAA
CTACTTAAAGCTCTGGATTACTGCCACAGCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)213383 - 595
Exon 3 To Exon 6 (Pair 15)
Forward (383,22)CGAGAGGTTAAGATTCTGGAGAAmplicon SizecDNA: 230 bpgenomic: 18,180
Reverse (612,21)TCCCTGTGCATGATTCCCTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.729 kcal/mol
Forward Dimers-0.581 kcal/mol
Reverse Loops2.253 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceCGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGAC
ACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATACA
GATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGAA
CTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCACAGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)230383 - 612
Exon 3 To Exon 6 (Pair 14)
Forward (383,22)CGAGAGGTTAAGATTCTGGAGAAmplicon SizecDNA: 227 bpgenomic: 18,177
Reverse (609,21)CTGTGCATGATTCCCTTGCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.729 kcal/mol
Forward Dimers-0.581 kcal/mol
Reverse Loops1.425 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceCGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGAC
ACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATACA
GATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGAA
CTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)227383 - 609
Exon 3 To Exon 6 (Pair 13)
Forward (383,22)CGAGAGGTTAAGATTCTGGAGAAmplicon SizecDNA: 218 bpgenomic: 18,168
Reverse (600,22)ATTCCCTTGCTGTGGCAGTAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.729 kcal/mol
Forward Dimers-0.581 kcal/mol
Reverse Loops0.531 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceCGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGAC
ACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATACA
GATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGAA
CTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)218383 - 600
Exon 3 To Exon 6 (Pair 12)
Forward (383,22)CGAGAGGTTAAGATTCTGGAGAAmplicon SizecDNA: 232 bpgenomic: 18,182
Reverse (614,21)CATCCCTGTGCATGATTCCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.729 kcal/mol
Forward Dimers-0.581 kcal/mol
Reverse Loops1.844 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceCGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGAC
ACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATACA
GATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGAA
CTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCACAGGGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)232383 - 614
Exon 3 To Exon 6 (Pair 11)
Forward (380,23)AAACGAGAGGTTAAGATTCTGGAAmplicon SizecDNA: 228 bpgenomic: 18,178
Reverse (607,21)GTGCATGATTCCCTTGCTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.375 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.425 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceAAACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATT
GACACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAAT
ACAGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTAT
GAACTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)228380 - 607
Exon 3 To Exon 6 (Pair 10)
Forward (408,24)TTCGTGGTGGAACAAATATCATTAAmplicon SizecDNA: 236 bpgenomic: 18,186
Reverse (643,23)GTGATCTATCATGACATTGTGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.413 kcal/mol in 3' area
Reverse Dimers-1.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.784 kcal/mol outside primersite
Amplicon SequenceTTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGA
CACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCC
TGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCC
ACAGCAAGGGAATCATGCACAGGGATGTGAAACCTCACAATGTCATGATAGATCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)236408 - 643
Exon 3 To Exon 6 (Pair 9)
Forward (408,24)TTCGTGGTGGAACAAATATCATTAAmplicon SizecDNA: 202 bpgenomic: 18,152
Reverse (609,21)CTGTGCATGATTCCCTTGCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.425 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGA
CACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCC
TGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCC
ACAGCAAGGGAATCATGCACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)202408 - 609
Exon 3 To Exon 6 (Pair 8)
Forward (408,24)TTCGTGGTGGAACAAATATCATTAAmplicon SizecDNA: 233 bpgenomic: 18,183
Reverse (640,24)ATCTATCATGACATTGTGAGGTTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.413 kcal/mol
Reverse Dimers-1.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.784 kcal/mol outside primersite
Amplicon SequenceTTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGA
CACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCC
TGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCC
ACAGCAAGGGAATCATGCACAGGGATGTGAAACCTCACAATGTCATGATAGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)233408 - 640
Exon 3 To Exon 6 (Pair 7)
Forward (380,23)AAACGAGAGGTTAAGATTCTGGAAmplicon SizecDNA: 230 bpgenomic: 18,180
Reverse (609,21)CTGTGCATGATTCCCTTGCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.375 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.425 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceAAACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATT
GACACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAAT
ACAGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTAT
GAACTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)230380 - 609
Exon 3 To Exon 6 (Pair 6)
Forward (409,24)TCGTGGTGGAACAAATATCATTAAAmplicon SizecDNA: 233 bpgenomic: 18,183
Reverse (641,23)GATCTATCATGACATTGTGAGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.413 kcal/mol in 3' area
Reverse Dimers-1.948 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.784 kcal/mol outside primersite
Amplicon SequenceTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGAC
ACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCT
GACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCA
CAGCAAGGGAATCATGCACAGGGATGTGAAACCTCACAATGTCATGATAGATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)233409 - 641
Exon 3 To Exon 6 (Pair 5)
Forward (380,23)AAACGAGAGGTTAAGATTCTGGAAmplicon SizecDNA: 231 bpgenomic: 18,181
Reverse (610,21)CCTGTGCATGATTCCCTTGCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.375 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.425 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceAAACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATT
GACACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAAT
ACAGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTAT
GAACTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCACAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)231380 - 610
Exon 3 To Exon 6 (Pair 4)
Forward (409,24)TCGTGGTGGAACAAATATCATTAAAmplicon SizecDNA: 192 bpgenomic: 18,142
Reverse (600,22)ATTCCCTTGCTGTGGCAGTAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops0.531 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGAC
ACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCT
GACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCA
CAGCAAGGGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)192409 - 600
Exon 3 To Exon 6 (Pair 3)
Forward (409,24)TCGTGGTGGAACAAATATCATTAAAmplicon SizecDNA: 202 bpgenomic: 18,152
Reverse (610,21)CCTGTGCATGATTCCCTTGCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.425 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGAC
ACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCT
GACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCA
CAGCAAGGGAATCATGCACAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)202409 - 610
Exon 3 To Exon 6 (Pair 2)
Forward (382,22)ACGAGAGGTTAAGATTCTGGAGAmplicon SizecDNA: 226 bpgenomic: 18,176
Reverse (607,21)GTGCATGATTCCCTTGCTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.298 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.425 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.463 kcal/mol outside primersite
Amplicon SequenceACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGA
CACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATAC
AGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGA
ACTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)226382 - 607
Exon 3 To Exon 6 (Pair 1)
Forward (408,24)TTCGTGGTGGAACAAATATCATTAAmplicon SizecDNA: 186 bpgenomic: 18,136
Reverse (593,21)TGCTGTGGCAGTAATCCAGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.697 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops0.602 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.166 kcal/mol outside primersite
Amplicon SequenceTTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGA
CACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCC
TGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCC
ACAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)186408 - 593
Exon 11 To Exon 12 (Pair 71)
Forward (1178,20)CTCACGGCAGCACGATGAAGAmplicon SizecDNA: 82 bpgenomic: 5,782
Reverse (1259,23)TTTGGTTCTTGTTCTGCTTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.663 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops2.49 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.576 kcal/mol outside primersite
Amplicon SequenceCTCACGGCAGCACGATGAAGACTGGAAAGCGACGGGTCTGTTGCGGTTCTCCCACTTTTC
CATAAGCAGAACAAGAACCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)821178 - 1259
Exon 11 To Exon 12 (Pair 72)
Forward (1180,20)CACGGCAGCACGATGAAGACAmplicon SizecDNA: 79 bpgenomic: 5,779
Reverse (1258,23)TTGGTTCTTGTTCTGCTTATGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.663 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.831 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.576 kcal/mol outside primersite
Amplicon SequenceCACGGCAGCACGATGAAGACTGGAAAGCGACGGGTCTGTTGCGGTTCTCCCACTTTTCCA
TAAGCAGAACAAGAACCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)791180 - 1258
Exon 11 To Exon 12 (Pair 70)
Forward (1178,20)CTCACGGCAGCACGATGAAGAmplicon SizecDNA: 157 bpgenomic: 5,857
Reverse (1334,19)CGTGCTCGCCAAACCTGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.663 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.533 kcal/mol
Reverse Dimers-0.564 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.662 kcal/mol outside primersite
Amplicon SequenceCTCACGGCAGCACGATGAAGACTGGAAAGCGACGGGTCTGTTGCGGTTCTCCCACTTTTC
CATAAGCAGAACAAGAACCAAATCAAACGTCTTAACGCGTATAGAGAGATCACGTTCCGT
GAGCAGACACAAAACGGTGGCAGGTTTGGCGAGCACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)1571178 - 1334
Exon 11 To Exon 12 (Pair 68)
Forward (1168,20)TTCCAGTGGTCTCACGGCAGAmplicon SizecDNA: 92 bpgenomic: 5,792
Reverse (1259,23)TTTGGTTCTTGTTCTGCTTATGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.083 kcal/mol
Forward Dimers-2.268 kcal/mol
Reverse Loops2.49 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.254 kcal/mol inside primersite
Amplicon SequenceTTCCAGTGGTCTCACGGCAGCACGATGAAGACTGGAAAGCGACGGGTCTGTTGCGGTTCT
CCCACTTTTCCATAAGCAGAACAAGAACCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)921168 - 1259
Exon 11 To Exon 12 (Pair 69)
Forward (1168,20)TTCCAGTGGTCTCACGGCAGAmplicon SizecDNA: 163 bpgenomic: 5,863
Reverse (1330,19)CTCGCCAAACCTGCCACCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.083 kcal/mol
Forward Dimers-2.268 kcal/mol
Reverse Loops2.198 kcal/mol
Reverse Dimers0.016 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.662 kcal/mol outside primersite
Amplicon SequenceTTCCAGTGGTCTCACGGCAGCACGATGAAGACTGGAAAGCGACGGGTCTGTTGCGGTTCT
CCCACTTTTCCATAAGCAGAACAAGAACCAAATCAAACGTCTTAACGCGTATAGAGAGAT
CACGTTCCGTGAGCAGACACAAAACGGTGGCAGGTTTGGCGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)1631168 - 1330
Exon 11 To Exon 12 (Pair 67)
Forward (1170,19)CCAGTGGTCTCACGGCAGCAmplicon SizecDNA: 223 bpgenomic: 5,923
Reverse (1392,23)TACATTCGGAAGTGAGGTTTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.083 kcal/mol
Forward Dimers-1.658 kcal/mol
Reverse Loops1.949 kcal/mol
Reverse Dimers-0.118 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.372 kcal/mol outside primersite
Amplicon SequenceCCAGTGGTCTCACGGCAGCACGATGAAGACTGGAAAGCGACGGGTCTGTTGCGGTTCTCC
CACTTTTCCATAAGCAGAACAAGAACCAAATCAAACGTCTTAACGCGTATAGAGAGATCA
CGTTCCGTGAGCAGACACAAAACGGTGGCAGGTTTGGCGAGCACGAACTAGACCAAGCGA
AGGGCAGCCCACCACCGTATATCAAACCTCACTTCCGAATGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)2231170 - 1392
Exon 11 To Exon 12 (Pair 65)
Forward (1170,19)CCAGTGGTCTCACGGCAGCAmplicon SizecDNA: 88 bpgenomic: 5,788
Reverse (1257,23)TGGTTCTTGTTCTGCTTATGGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.083 kcal/mol
Forward Dimers-1.658 kcal/mol
Reverse Loops1.831 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.576 kcal/mol outside primersite
Amplicon SequenceCCAGTGGTCTCACGGCAGCACGATGAAGACTGGAAAGCGACGGGTCTGTTGCGGTTCTCC
CACTTTTCCATAAGCAGAACAAGAACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)881170 - 1257
Exon 11 To Exon 12 (Pair 66)
Forward (1168,20)TTCCAGTGGTCTCACGGCAGAmplicon SizecDNA: 162 bpgenomic: 5,862
Reverse (1329,20)TCGCCAAACCTGCCACCGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.083 kcal/mol
Forward Dimers-2.268 kcal/mol
Reverse Loops2.15 kcal/mol in 3' area
Reverse Dimers0.016 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.662 kcal/mol outside primersite
Amplicon SequenceTTCCAGTGGTCTCACGGCAGCACGATGAAGACTGGAAAGCGACGGGTCTGTTGCGGTTCT
CCCACTTTTCCATAAGCAGAACAAGAACCAAATCAAACGTCTTAACGCGTATAGAGAGAT
CACGTTCCGTGAGCAGACACAAAACGGTGGCAGGTTTGGCGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)1621168 - 1329
Exon 11 To Exon 12 (Pair 64)
Forward (1178,20)CTCACGGCAGCACGATGAAGAmplicon SizecDNA: 215 bpgenomic: 5,915
Reverse (1392,23)TACATTCGGAAGTGAGGTTTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.663 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.949 kcal/mol
Reverse Dimers-0.118 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.372 kcal/mol outside primersite
Amplicon SequenceCTCACGGCAGCACGATGAAGACTGGAAAGCGACGGGTCTGTTGCGGTTCTCCCACTTTTC
CATAAGCAGAACAAGAACCAAATCAAACGTCTTAACGCGTATAGAGAGATCACGTTCCGT
GAGCAGACACAAAACGGTGGCAGGTTTGGCGAGCACGAACTAGACCAAGCGAAGGGCAGC
CCACCACCGTATATCAAACCTCACTTCCGAATGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)2151178 - 1392
Exon 11 To Exon 12 (Pair 63)
Forward (1180,20)CACGGCAGCACGATGAAGACAmplicon SizecDNA: 212 bpgenomic: 5,912
Reverse (1391,23)ACATTCGGAAGTGAGGTTTGATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.663 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.949 kcal/mol
Reverse Dimers-0.118 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.372 kcal/mol outside primersite
Amplicon SequenceCACGGCAGCACGATGAAGACTGGAAAGCGACGGGTCTGTTGCGGTTCTCCCACTTTTCCA
TAAGCAGAACAAGAACCAAATCAAACGTCTTAACGCGTATAGAGAGATCACGTTCCGTGA
GCAGACACAAAACGGTGGCAGGTTTGGCGAGCACGAACTAGACCAAGCGAAGGGCAGCCC
ACCACCGTATATCAAACCTCACTTCCGAATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)2121180 - 1391
Exon 11 To Exon 12 (Pair 62)
Forward (1178,20)CTCACGGCAGCACGATGAAGAmplicon SizecDNA: 213 bpgenomic: 5,913
Reverse (1390,23)CATTCGGAAGTGAGGTTTGATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.663 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.949 kcal/mol
Reverse Dimers-0.118 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.372 kcal/mol outside primersite
Amplicon SequenceCTCACGGCAGCACGATGAAGACTGGAAAGCGACGGGTCTGTTGCGGTTCTCCCACTTTTC
CATAAGCAGAACAAGAACCAAATCAAACGTCTTAACGCGTATAGAGAGATCACGTTCCGT
GAGCAGACACAAAACGGTGGCAGGTTTGGCGAGCACGAACTAGACCAAGCGAAGGGCAGC
CCACCACCGTATATCAAACCTCACTTCCGAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)2131178 - 1390
Exon 11 To Exon 12 (Pair 61)
Forward (1168,20)TTCCAGTGGTCTCACGGCAGAmplicon SizecDNA: 167 bpgenomic: 5,867
Reverse (1334,19)CGTGCTCGCCAAACCTGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.083 kcal/mol
Forward Dimers-2.268 kcal/mol
Reverse Loops1.533 kcal/mol
Reverse Dimers-0.564 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.662 kcal/mol outside primersite
Amplicon SequenceTTCCAGTGGTCTCACGGCAGCACGATGAAGACTGGAAAGCGACGGGTCTGTTGCGGTTCT
CCCACTTTTCCATAAGCAGAACAAGAACCAAATCAAACGTCTTAACGCGTATAGAGAGAT
CACGTTCCGTGAGCAGACACAAAACGGTGGCAGGTTTGGCGAGCACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)1671168 - 1334
Exon 11 To Exon 12 (Pair 60)
Forward (1180,20)CACGGCAGCACGATGAAGACAmplicon SizecDNA: 155 bpgenomic: 5,855
Reverse (1334,19)CGTGCTCGCCAAACCTGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.663 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.533 kcal/mol
Reverse Dimers-0.564 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.662 kcal/mol outside primersite
Amplicon SequenceCACGGCAGCACGATGAAGACTGGAAAGCGACGGGTCTGTTGCGGTTCTCCCACTTTTCCA
TAAGCAGAACAAGAACCAAATCAAACGTCTTAACGCGTATAGAGAGATCACGTTCCGTGA
GCAGACACAAAACGGTGGCAGGTTTGGCGAGCACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)1551180 - 1334
Exon 11 To Exon 12 (Pair 59)
Forward (1170,19)CCAGTGGTCTCACGGCAGCAmplicon SizecDNA: 225 bpgenomic: 5,925
Reverse (1394,23)TTTACATTCGGAAGTGAGGTTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.083 kcal/mol
Forward Dimers-1.658 kcal/mol
Reverse Loops1.949 kcal/mol
Reverse Dimers-0.118 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.372 kcal/mol outside primersite
Amplicon SequenceCCAGTGGTCTCACGGCAGCACGATGAAGACTGGAAAGCGACGGGTCTGTTGCGGTTCTCC
CACTTTTCCATAAGCAGAACAAGAACCAAATCAAACGTCTTAACGCGTATAGAGAGATCA
CGTTCCGTGAGCAGACACAAAACGGTGGCAGGTTTGGCGAGCACGAACTAGACCAAGCGA
AGGGCAGCCCACCACCGTATATCAAACCTCACTTCCGAATGTAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)2251170 - 1394
Exon 11 To Exon 12 (Pair 58)
Forward (1170,19)CCAGTGGTCTCACGGCAGCAmplicon SizecDNA: 162 bpgenomic: 5,862
Reverse (1331,19)GCTCGCCAAACCTGCCACCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.083 kcal/mol
Forward Dimers-1.658 kcal/mol
Reverse Loops2.198 kcal/mol
Reverse Dimers0.016 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.662 kcal/mol outside primersite
Amplicon SequenceCCAGTGGTCTCACGGCAGCACGATGAAGACTGGAAAGCGACGGGTCTGTTGCGGTTCTCC
CACTTTTCCATAAGCAGAACAAGAACCAAATCAAACGTCTTAACGCGTATAGAGAGATCA
CGTTCCGTGAGCAGACACAAAACGGTGGCAGGTTTGGCGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)1621170 - 1331
Exon 11 To Exon 12 (Pair 57)
Forward (1178,20)CTCACGGCAGCACGATGAAGAmplicon SizecDNA: 217 bpgenomic: 5,917
Reverse (1394,23)TTTACATTCGGAAGTGAGGTTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.663 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.949 kcal/mol
Reverse Dimers-0.118 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.372 kcal/mol outside primersite
Amplicon SequenceCTCACGGCAGCACGATGAAGACTGGAAAGCGACGGGTCTGTTGCGGTTCTCCCACTTTTC
CATAAGCAGAACAAGAACCAAATCAAACGTCTTAACGCGTATAGAGAGATCACGTTCCGT
GAGCAGACACAAAACGGTGGCAGGTTTGGCGAGCACGAACTAGACCAAGCGAAGGGCAGC
CCACCACCGTATATCAAACCTCACTTCCGAATGTAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001896 (CSNK2A2)2171178 - 1394
 

See below for some more details.

Program Output:

Loading ...