Design Results for CSTB

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size80Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size0

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 3 (Pair 1)
Forward (177,21)GGTCCCAGCTTGAAGAGAAAGAmplicon SizecDNA: 189 bpgenomic: 516
Reverse (365,23)TCTGGTAGTTAGATAAGGTCAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol in 3' area
Forward Dimers-2.77 kcal/mol
Reverse Loops1.773 kcal/mol in 3' area
Reverse Dimers-0.055 kcal/mol
Forward-Reverse Dimers-1.642 kcal/mol
Amplicon Folding-2.474 kcal/mol outside primersite
Amplicon SequenceGGTCCCAGCTTGAAGAGAAAGAAAACAAGAAGTTCCCTGTGTTTAAGGCCGTGTCATTCA
AGAGCCAGGTGGTCGCGGGGACAAACTACTTCATCAAGGTGCACGTCGGCGACGAGGACT
TCGTACACCTGCGAGTGTTCCAATCTCTCCCTCATGAAAACAAGCCCTTGACCTTATCTA
ACTACCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000100 (CSTB)189177 - 365
Exon 2 To Exon 3 (Pair 2)
Forward (174,21)TGAGGTCCCAGCTTGAAGAGAAmplicon SizecDNA: 194 bpgenomic: 521
Reverse (367,22)GGTCTGGTAGTTAGATAAGGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol in 3' area
Forward Dimers-2.77 kcal/mol
Reverse Loops1.798 kcal/mol
Reverse Dimers-0.055 kcal/mol
Forward-Reverse Dimers-1.642 kcal/mol
Amplicon Folding-2.474 kcal/mol outside primersite
Amplicon SequenceTGAGGTCCCAGCTTGAAGAGAAAGAAAACAAGAAGTTCCCTGTGTTTAAGGCCGTGTCAT
TCAAGAGCCAGGTGGTCGCGGGGACAAACTACTTCATCAAGGTGCACGTCGGCGACGAGG
ACTTCGTACACCTGCGAGTGTTCCAATCTCTCCCTCATGAAAACAAGCCCTTGACCTTAT
CTAACTACCAGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000100 (CSTB)194174 - 367
Exon 2 To Exon 3 (Pair 3)
Forward (201,23)ACAAGAAGTTCCCTGTGTTTAAGAmplicon SizecDNA: 200 bpgenomic: 527
Reverse (400,22)GAAATAGGTCAGCTCATCATGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.183 kcal/mol
Forward Dimers-0.426 kcal/mol
Reverse Loops1.263 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding-2.474 kcal/mol outside primersite
Amplicon SequenceACAAGAAGTTCCCTGTGTTTAAGGCCGTGTCATTCAAGAGCCAGGTGGTCGCGGGGACAA
ACTACTTCATCAAGGTGCACGTCGGCGACGAGGACTTCGTACACCTGCGAGTGTTCCAAT
CTCTCCCTCATGAAAACAAGCCCTTGACCTTATCTAACTACCAGACCAACAAAGCCAAGC
ATGATGAGCTGACCTATTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000100 (CSTB)200201 - 400
Exon 2 To Exon 3 (Pair 4)
Forward (178,22)GTCCCAGCTTGAAGAGAAAGAAAmplicon SizecDNA: 190 bpgenomic: 517
Reverse (367,22)GGTCTGGTAGTTAGATAAGGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol
Forward Dimers-2.77 kcal/mol
Reverse Loops1.798 kcal/mol
Reverse Dimers-0.055 kcal/mol
Forward-Reverse Dimers-1.642 kcal/mol
Amplicon Folding-2.474 kcal/mol outside primersite
Amplicon SequenceGTCCCAGCTTGAAGAGAAAGAAAACAAGAAGTTCCCTGTGTTTAAGGCCGTGTCATTCAA
GAGCCAGGTGGTCGCGGGGACAAACTACTTCATCAAGGTGCACGTCGGCGACGAGGACTT
CGTACACCTGCGAGTGTTCCAATCTCTCCCTCATGAAAACAAGCCCTTGACCTTATCTAA
CTACCAGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000100 (CSTB)190178 - 367
Exon 2 To Exon 3 (Pair 5)
Forward (177,21)GGTCCCAGCTTGAAGAGAAAGAmplicon SizecDNA: 190 bpgenomic: 517
Reverse (366,23)GTCTGGTAGTTAGATAAGGTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol in 3' area
Forward Dimers-2.77 kcal/mol
Reverse Loops1.773 kcal/mol in 3' area
Reverse Dimers-0.055 kcal/mol
Forward-Reverse Dimers-1.642 kcal/mol
Amplicon Folding-2.474 kcal/mol outside primersite
Amplicon SequenceGGTCCCAGCTTGAAGAGAAAGAAAACAAGAAGTTCCCTGTGTTTAAGGCCGTGTCATTCA
AGAGCCAGGTGGTCGCGGGGACAAACTACTTCATCAAGGTGCACGTCGGCGACGAGGACT
TCGTACACCTGCGAGTGTTCCAATCTCTCCCTCATGAAAACAAGCCCTTGACCTTATCTA
ACTACCAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000100 (CSTB)190177 - 366
Exon 2 To Exon 3 (Pair 6)
Forward (174,21)TGAGGTCCCAGCTTGAAGAGAAmplicon SizecDNA: 192 bpgenomic: 519
Reverse (365,23)TCTGGTAGTTAGATAAGGTCAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol in 3' area
Forward Dimers-2.77 kcal/mol
Reverse Loops1.773 kcal/mol in 3' area
Reverse Dimers-0.055 kcal/mol
Forward-Reverse Dimers-1.642 kcal/mol
Amplicon Folding-2.474 kcal/mol outside primersite
Amplicon SequenceTGAGGTCCCAGCTTGAAGAGAAAGAAAACAAGAAGTTCCCTGTGTTTAAGGCCGTGTCAT
TCAAGAGCCAGGTGGTCGCGGGGACAAACTACTTCATCAAGGTGCACGTCGGCGACGAGG
ACTTCGTACACCTGCGAGTGTTCCAATCTCTCCCTCATGAAAACAAGCCCTTGACCTTAT
CTAACTACCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000100 (CSTB)192174 - 365
Exon 2 To Exon 3 (Pair 7)
Forward (174,21)TGAGGTCCCAGCTTGAAGAGAAmplicon SizecDNA: 193 bpgenomic: 520
Reverse (366,23)GTCTGGTAGTTAGATAAGGTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol in 3' area
Forward Dimers-2.77 kcal/mol
Reverse Loops1.773 kcal/mol in 3' area
Reverse Dimers-0.055 kcal/mol
Forward-Reverse Dimers-1.642 kcal/mol
Amplicon Folding-2.474 kcal/mol outside primersite
Amplicon SequenceTGAGGTCCCAGCTTGAAGAGAAAGAAAACAAGAAGTTCCCTGTGTTTAAGGCCGTGTCAT
TCAAGAGCCAGGTGGTCGCGGGGACAAACTACTTCATCAAGGTGCACGTCGGCGACGAGG
ACTTCGTACACCTGCGAGTGTTCCAATCTCTCCCTCATGAAAACAAGCCCTTGACCTTAT
CTAACTACCAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000100 (CSTB)193174 - 366
Exon 2 To Exon 3 (Pair 8)
Forward (201,23)ACAAGAAGTTCCCTGTGTTTAAGAmplicon SizecDNA: 203 bpgenomic: 530
Reverse (403,23)TCAGAAATAGGTCAGCTCATCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.183 kcal/mol
Forward Dimers-0.426 kcal/mol
Reverse Loops1.263 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding-2.474 kcal/mol outside primersite
Amplicon SequenceACAAGAAGTTCCCTGTGTTTAAGGCCGTGTCATTCAAGAGCCAGGTGGTCGCGGGGACAA
ACTACTTCATCAAGGTGCACGTCGGCGACGAGGACTTCGTACACCTGCGAGTGTTCCAAT
CTCTCCCTCATGAAAACAAGCCCTTGACCTTATCTAACTACCAGACCAACAAAGCCAAGC
ATGATGAGCTGACCTATTTCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000100 (CSTB)203201 - 403
Exon 2 To Exon 3 (Pair 9)
Forward (175,21)GAGGTCCCAGCTTGAAGAGAAAmplicon SizecDNA: 193 bpgenomic: 520
Reverse (367,22)GGTCTGGTAGTTAGATAAGGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol in 3' area
Forward Dimers-2.77 kcal/mol
Reverse Loops1.798 kcal/mol
Reverse Dimers-0.055 kcal/mol
Forward-Reverse Dimers-1.642 kcal/mol
Amplicon Folding-2.474 kcal/mol outside primersite
Amplicon SequenceGAGGTCCCAGCTTGAAGAGAAAGAAAACAAGAAGTTCCCTGTGTTTAAGGCCGTGTCATT
CAAGAGCCAGGTGGTCGCGGGGACAAACTACTTCATCAAGGTGCACGTCGGCGACGAGGA
CTTCGTACACCTGCGAGTGTTCCAATCTCTCCCTCATGAAAACAAGCCCTTGACCTTATC
TAACTACCAGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000100 (CSTB)193175 - 367
Exon 2 To Exon 3 (Pair 10)
Forward (177,21)GGTCCCAGCTTGAAGAGAAAGAmplicon SizecDNA: 191 bpgenomic: 518
Reverse (367,22)GGTCTGGTAGTTAGATAAGGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol in 3' area
Forward Dimers-2.77 kcal/mol
Reverse Loops1.798 kcal/mol
Reverse Dimers-0.055 kcal/mol
Forward-Reverse Dimers-1.642 kcal/mol
Amplicon Folding-2.474 kcal/mol outside primersite
Amplicon SequenceGGTCCCAGCTTGAAGAGAAAGAAAACAAGAAGTTCCCTGTGTTTAAGGCCGTGTCATTCA
AGAGCCAGGTGGTCGCGGGGACAAACTACTTCATCAAGGTGCACGTCGGCGACGAGGACT
TCGTACACCTGCGAGTGTTCCAATCTCTCCCTCATGAAAACAAGCCCTTGACCTTATCTA
ACTACCAGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000100 (CSTB)191177 - 367
Exon 2 To Exon 3 (Pair 11)
Forward (201,23)ACAAGAAGTTCCCTGTGTTTAAGAmplicon SizecDNA: 204 bpgenomic: 531
Reverse (404,23)ATCAGAAATAGGTCAGCTCATCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.183 kcal/mol
Forward Dimers-0.426 kcal/mol
Reverse Loops1.263 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding-2.474 kcal/mol outside primersite
Amplicon SequenceACAAGAAGTTCCCTGTGTTTAAGGCCGTGTCATTCAAGAGCCAGGTGGTCGCGGGGACAA
ACTACTTCATCAAGGTGCACGTCGGCGACGAGGACTTCGTACACCTGCGAGTGTTCCAAT
CTCTCCCTCATGAAAACAAGCCCTTGACCTTATCTAACTACCAGACCAACAAAGCCAAGC
ATGATGAGCTGACCTATTTCTGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000100 (CSTB)204201 - 404
Exon 2 To Exon 3 (Pair 12)
Forward (201,23)ACAAGAAGTTCCCTGTGTTTAAGAmplicon SizecDNA: 165 bpgenomic: 492
Reverse (365,23)TCTGGTAGTTAGATAAGGTCAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.183 kcal/mol
Forward Dimers-0.426 kcal/mol
Reverse Loops1.773 kcal/mol in 3' area
Reverse Dimers-0.055 kcal/mol
Forward-Reverse Dimers-1.289 kcal/mol
Amplicon Folding-2.474 kcal/mol outside primersite
Amplicon SequenceACAAGAAGTTCCCTGTGTTTAAGGCCGTGTCATTCAAGAGCCAGGTGGTCGCGGGGACAA
ACTACTTCATCAAGGTGCACGTCGGCGACGAGGACTTCGTACACCTGCGAGTGTTCCAAT
CTCTCCCTCATGAAAACAAGCCCTTGACCTTATCTAACTACCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000100 (CSTB)165201 - 365
Exon 2 To Exon 3 (Pair 13)
Forward (201,23)ACAAGAAGTTCCCTGTGTTTAAGAmplicon SizecDNA: 199 bpgenomic: 526
Reverse (399,23)AAATAGGTCAGCTCATCATGCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.183 kcal/mol
Forward Dimers-0.426 kcal/mol
Reverse Loops0.567 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding-2.474 kcal/mol outside primersite
Amplicon SequenceACAAGAAGTTCCCTGTGTTTAAGGCCGTGTCATTCAAGAGCCAGGTGGTCGCGGGGACAA
ACTACTTCATCAAGGTGCACGTCGGCGACGAGGACTTCGTACACCTGCGAGTGTTCCAAT
CTCTCCCTCATGAAAACAAGCCCTTGACCTTATCTAACTACCAGACCAACAAAGCCAAGC
ATGATGAGCTGACCTATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000100 (CSTB)199201 - 399
Exon 2 To Exon 3 (Pair 14)
Forward (178,22)GTCCCAGCTTGAAGAGAAAGAAAmplicon SizecDNA: 189 bpgenomic: 516
Reverse (366,23)GTCTGGTAGTTAGATAAGGTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol
Forward Dimers-2.77 kcal/mol
Reverse Loops1.773 kcal/mol in 3' area
Reverse Dimers-0.055 kcal/mol
Forward-Reverse Dimers-1.642 kcal/mol
Amplicon Folding-2.474 kcal/mol outside primersite
Amplicon SequenceGTCCCAGCTTGAAGAGAAAGAAAACAAGAAGTTCCCTGTGTTTAAGGCCGTGTCATTCAA
GAGCCAGGTGGTCGCGGGGACAAACTACTTCATCAAGGTGCACGTCGGCGACGAGGACTT
CGTACACCTGCGAGTGTTCCAATCTCTCCCTCATGAAAACAAGCCCTTGACCTTATCTAA
CTACCAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000100 (CSTB)189178 - 366
Exon 2 To Exon 3 (Pair 15)
Forward (175,21)GAGGTCCCAGCTTGAAGAGAAAmplicon SizecDNA: 192 bpgenomic: 519
Reverse (366,23)GTCTGGTAGTTAGATAAGGTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol in 3' area
Forward Dimers-2.77 kcal/mol
Reverse Loops1.773 kcal/mol in 3' area
Reverse Dimers-0.055 kcal/mol
Forward-Reverse Dimers-1.642 kcal/mol
Amplicon Folding-2.474 kcal/mol outside primersite
Amplicon SequenceGAGGTCCCAGCTTGAAGAGAAAGAAAACAAGAAGTTCCCTGTGTTTAAGGCCGTGTCATT
CAAGAGCCAGGTGGTCGCGGGGACAAACTACTTCATCAAGGTGCACGTCGGCGACGAGGA
CTTCGTACACCTGCGAGTGTTCCAATCTCTCCCTCATGAAAACAAGCCCTTGACCTTATC
TAACTACCAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000100 (CSTB)192175 - 366
Exon 2 To Exon 3 (Pair 16)
Forward (178,22)GTCCCAGCTTGAAGAGAAAGAAAmplicon SizecDNA: 188 bpgenomic: 515
Reverse (365,23)TCTGGTAGTTAGATAAGGTCAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol
Forward Dimers-2.77 kcal/mol
Reverse Loops1.773 kcal/mol in 3' area
Reverse Dimers-0.055 kcal/mol
Forward-Reverse Dimers-1.642 kcal/mol
Amplicon Folding-2.474 kcal/mol outside primersite
Amplicon SequenceGTCCCAGCTTGAAGAGAAAGAAAACAAGAAGTTCCCTGTGTTTAAGGCCGTGTCATTCAA
GAGCCAGGTGGTCGCGGGGACAAACTACTTCATCAAGGTGCACGTCGGCGACGAGGACTT
CGTACACCTGCGAGTGTTCCAATCTCTCCCTCATGAAAACAAGCCCTTGACCTTATCTAA
CTACCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000100 (CSTB)188178 - 365
Exon 2 To Exon 3 (Pair 17)
Forward (201,23)ACAAGAAGTTCCCTGTGTTTAAGAmplicon SizecDNA: 209 bpgenomic: 536
Reverse (409,22)TCAGGATCAGAAATAGGTCAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.183 kcal/mol
Forward Dimers-0.426 kcal/mol
Reverse Loops1.719 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.242 kcal/mol
Amplicon Folding-2.474 kcal/mol outside primersite
Amplicon SequenceACAAGAAGTTCCCTGTGTTTAAGGCCGTGTCATTCAAGAGCCAGGTGGTCGCGGGGACAA
ACTACTTCATCAAGGTGCACGTCGGCGACGAGGACTTCGTACACCTGCGAGTGTTCCAAT
CTCTCCCTCATGAAAACAAGCCCTTGACCTTATCTAACTACCAGACCAACAAAGCCAAGC
ATGATGAGCTGACCTATTTCTGATCCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000100 (CSTB)209201 - 409
Exon 2 To Exon 3 (Pair 18)
Forward (175,21)GAGGTCCCAGCTTGAAGAGAAAmplicon SizecDNA: 191 bpgenomic: 518
Reverse (365,23)TCTGGTAGTTAGATAAGGTCAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol in 3' area
Forward Dimers-2.77 kcal/mol
Reverse Loops1.773 kcal/mol in 3' area
Reverse Dimers-0.055 kcal/mol
Forward-Reverse Dimers-1.642 kcal/mol
Amplicon Folding-2.474 kcal/mol outside primersite
Amplicon SequenceGAGGTCCCAGCTTGAAGAGAAAGAAAACAAGAAGTTCCCTGTGTTTAAGGCCGTGTCATT
CAAGAGCCAGGTGGTCGCGGGGACAAACTACTTCATCAAGGTGCACGTCGGCGACGAGGA
CTTCGTACACCTGCGAGTGTTCCAATCTCTCCCTCATGAAAACAAGCCCTTGACCTTATC
TAACTACCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000100 (CSTB)191175 - 365
 

See below for some more details.

Program Output:

Loading ...