Design Results for CTCF

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 3 (Pair 1)
Forward (379,21)GGCTTGAGAGCTGGGTTCTATAmplicon SizecDNA: 97 bpgenomic: 39,656
Reverse (475,21)CCACAATGGCTTCGACTGCATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.558 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.216 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.935 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCA
GGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)97379 - 475
Exon 2 To Exon 3 (Pair 2)
Forward (378,20)GGGCTTGAGAGCTGGGTTCTAmplicon SizecDNA: 97 bpgenomic: 39,656
Reverse (474,21)CACAATGGCTTCGACTGCATCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.541 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.527 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.935 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGC
AGGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)97378 - 474
Exon 2 To Exon 3 (Pair 3)
Forward (380,22)GCTTGAGAGCTGGGTTCTATTTAmplicon SizecDNA: 93 bpgenomic: 39,652
Reverse (472,21)CAATGGCTTCGACTGCATCACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.849 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.527 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.935 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAG
GGGAAATGGAAGGTGATGCAGTCGAAGCCATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)93380 - 472
Exon 2 To Exon 3 (Pair 4)
Forward (416,20)GACTTTGCAGCCACGGAGAGAmplicon SizecDNA: 76 bpgenomic: 39,635
Reverse (491,22)AAAGTTTCGGACTCCTCCACAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.035 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.381 kcal/mol
Reverse Dimers-1.421 kcal/mol
Forward-Reverse Dimers-2.321 kcal/mol
Amplicon Folding0.027 kcal/mol inside primersite
Amplicon SequenceGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGG
AGGAGTCCGAAACTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)76416 - 491
Exon 2 To Exon 3 (Pair 5)
Forward (411,21)AAACTGACTTTGCAGCCACGGAmplicon SizecDNA: 214 bpgenomic: 39,773
Reverse (624,22)CATCTGTACACTGCTGTTGACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.299 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.217 kcal/mol
Reverse Dimers-1.884 kcal/mol
Forward-Reverse Dimers-2.358 kcal/mol
Amplicon Folding-1.407 kcal/mol outside primersite
Amplicon SequenceAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTCGAAGCCAT
TGTGGAGGAGTCCGAAACTTTTATTAAAGGAAAGGAGAGAAAGACTTACCAGAGACGCCG
GGAAGGGGGCCAGGAAGAAGATGCCTGCCACTTACCCCAGAACCAGACGGATGGGGGTGA
GGTGGTCCAGGATGTCAACAGCAGTGTACAGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)214411 - 624
Exon 2 To Exon 3 (Pair 6)
Forward (333,22)TGAAGCCAAAGAACAAGATGCGAmplicon SizecDNA: 184 bpgenomic: 39,743
Reverse (516,24)AGTCTTTCTCTCCTTTCCTTTAATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol in 3' area
Forward Dimers0.022 kcal/mol
Reverse Loops1.659 kcal/mol
Reverse Dimers0.845 kcal/mol
Forward-Reverse Dimers-1.761 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceTGAAGCCAAAGAACAAGATGCGCTAGTGGACAGATTGCTGACCAGGGGCTTGAGAGCTGG
GTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGG
TGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAAGGAAAGGAGAGAAA
GACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)184333 - 516
Exon 2 To Exon 3 (Pair 7)
Forward (401,22)TTCCCTCCTCAAACTGACTTTGAmplicon SizecDNA: 229 bpgenomic: 39,788
Reverse (629,22)ATCACCATCTGTACACTGCTGTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.288 kcal/mol in 3' area
Forward Dimers0.336 kcal/mol in 3' area
Reverse Loops0.722 kcal/mol in 3' area
Reverse Dimers-1.296 kcal/mol
Forward-Reverse Dimers-0.493 kcal/mol
Amplicon Folding-1.407 kcal/mol outside primersite
Amplicon SequenceTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAG
TCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAAGGAAAGGAGAGAAAGACTTACC
AGAGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGCCACTTACCCCAGAACCAGACGG
ATGGGGGTGAGGTGGTCCAGGATGTCAACAGCAGTGTACAGATGGTGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)229401 - 629
Exon 2 To Exon 3 (Pair 8)
Forward (378,20)GGGCTTGAGAGCTGGGTTCTAmplicon SizecDNA: 140 bpgenomic: 39,699
Reverse (517,24)AAGTCTTTCTCTCCTTTCCTTTAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.541 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.118 kcal/mol
Reverse Dimers0.104 kcal/mol
Forward-Reverse Dimers-1.859 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGC
AGGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAA
AGGAAAGGAGAGAAAGACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)140378 - 517
Exon 2 To Exon 3 (Pair 9)
Forward (380,22)GCTTGAGAGCTGGGTTCTATTTAmplicon SizecDNA: 86 bpgenomic: 39,645
Reverse (465,22)TTCGACTGCATCACCTTCCATTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.849 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.85 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.677 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAG
GGGAAATGGAAGGTGATGCAGTCGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)86380 - 465
Exon 2 To Exon 3 (Pair 10)
Forward (379,21)GGCTTGAGAGCTGGGTTCTATAmplicon SizecDNA: 91 bpgenomic: 39,650
Reverse (469,21)TGGCTTCGACTGCATCACCTTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.558 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.696 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.935 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCA
GGGGAAATGGAAGGTGATGCAGTCGAAGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)91379 - 469
Exon 2 To Exon 3 (Pair 11)
Forward (380,22)GCTTGAGAGCTGGGTTCTATTTAmplicon SizecDNA: 184 bpgenomic: 39,743
Reverse (563,21)AAGTGGCAGGCATCTTCTTCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.849 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.333 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-1.398 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAG
GGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAAG
GAAAGGAGAGAAAGACTTACCAGAGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGCC
ACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)184380 - 563
Exon 2 To Exon 3 (Pair 12)
Forward (378,20)GGGCTTGAGAGCTGGGTTCTAmplicon SizecDNA: 111 bpgenomic: 39,670
Reverse (488,21)GTTTCGGACTCCTCCACAATGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.541 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.028 kcal/mol
Reverse Dimers-0.375 kcal/mol
Forward-Reverse Dimers-1.198 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGC
AGGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)111378 - 488
Exon 2 To Exon 3 (Pair 13)
Forward (411,21)AAACTGACTTTGCAGCCACGGAmplicon SizecDNA: 80 bpgenomic: 39,639
Reverse (490,22)AAGTTTCGGACTCCTCCACAATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.299 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.381 kcal/mol
Reverse Dimers-1.421 kcal/mol
Forward-Reverse Dimers-2.191 kcal/mol
Amplicon Folding0.027 kcal/mol inside primersite
Amplicon SequenceAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTCGAAGCCAT
TGTGGAGGAGTCCGAAACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)80411 - 490
Exon 2 To Exon 3 (Pair 14)
Forward (333,22)TGAAGCCAAAGAACAAGATGCGAmplicon SizecDNA: 185 bpgenomic: 39,744
Reverse (517,24)AAGTCTTTCTCTCCTTTCCTTTAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol in 3' area
Forward Dimers0.022 kcal/mol
Reverse Loops1.118 kcal/mol
Reverse Dimers0.104 kcal/mol
Forward-Reverse Dimers-1.761 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceTGAAGCCAAAGAACAAGATGCGCTAGTGGACAGATTGCTGACCAGGGGCTTGAGAGCTGG
GTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGG
TGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAAGGAAAGGAGAGAAA
GACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)185333 - 517
Exon 2 To Exon 3 (Pair 15)
Forward (379,21)GGCTTGAGAGCTGGGTTCTATAmplicon SizecDNA: 112 bpgenomic: 39,671
Reverse (490,22)AAGTTTCGGACTCCTCCACAATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.558 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.381 kcal/mol
Reverse Dimers-1.421 kcal/mol
Forward-Reverse Dimers-1.198 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCA
GGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)112379 - 490
Exon 2 To Exon 3 (Pair 16)
Forward (380,22)GCTTGAGAGCTGGGTTCTATTTAmplicon SizecDNA: 138 bpgenomic: 39,697
Reverse (517,24)AAGTCTTTCTCTCCTTTCCTTTAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.849 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.118 kcal/mol
Reverse Dimers0.104 kcal/mol
Forward-Reverse Dimers-1.859 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAG
GGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAAG
GAAAGGAGAGAAAGACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)138380 - 517
Exon 2 To Exon 3 (Pair 17)
Forward (414,20)CTGACTTTGCAGCCACGGAGAmplicon SizecDNA: 211 bpgenomic: 39,770
Reverse (624,22)CATCTGTACACTGCTGTTGACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.841 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.217 kcal/mol
Reverse Dimers-1.884 kcal/mol
Forward-Reverse Dimers-2.358 kcal/mol
Amplicon Folding-1.407 kcal/mol outside primersite
Amplicon SequenceCTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGT
GGAGGAGTCCGAAACTTTTATTAAAGGAAAGGAGAGAAAGACTTACCAGAGACGCCGGGA
AGGGGGCCAGGAAGAAGATGCCTGCCACTTACCCCAGAACCAGACGGATGGGGGTGAGGT
GGTCCAGGATGTCAACAGCAGTGTACAGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)211414 - 624
Exon 2 To Exon 3 (Pair 18)
Forward (378,20)GGGCTTGAGAGCTGGGTTCTAmplicon SizecDNA: 139 bpgenomic: 39,698
Reverse (516,24)AGTCTTTCTCTCCTTTCCTTTAATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.541 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.659 kcal/mol
Reverse Dimers0.845 kcal/mol
Forward-Reverse Dimers-1.859 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGC
AGGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAA
AGGAAAGGAGAGAAAGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)139378 - 516
Exon 2 To Exon 3 (Pair 19)
Forward (379,21)GGCTTGAGAGCTGGGTTCTATAmplicon SizecDNA: 98 bpgenomic: 39,657
Reverse (476,21)TCCACAATGGCTTCGACTGCANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.558 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.911 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.935 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCA
GGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)98379 - 476
Exon 2 To Exon 3 (Pair 20)
Forward (380,22)GCTTGAGAGCTGGGTTCTATTTAmplicon SizecDNA: 183 bpgenomic: 39,742
Reverse (562,21)AGTGGCAGGCATCTTCTTCCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.849 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.333 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-1.398 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAG
GGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAAG
GAAAGGAGAGAAAGACTTACCAGAGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGCC
ACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)183380 - 562
Exon 2 To Exon 3 (Pair 21)
Forward (401,22)TTCCCTCCTCAAACTGACTTTGAmplicon SizecDNA: 74 bpgenomic: 39,633
Reverse (474,21)CACAATGGCTTCGACTGCATCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.288 kcal/mol in 3' area
Forward Dimers0.336 kcal/mol in 3' area
Reverse Loops1.527 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-0.326 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAG
TCGAAGCCATTGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)74401 - 474
Exon 2 To Exon 3 (Pair 22)
Forward (410,21)CAAACTGACTTTGCAGCCACGAmplicon SizecDNA: 108 bpgenomic: 39,667
Reverse (517,24)AAGTCTTTCTCTCCTTTCCTTTAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.299 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.118 kcal/mol
Reverse Dimers0.104 kcal/mol
Forward-Reverse Dimers-1.88 kcal/mol
Amplicon Folding0.027 kcal/mol inside primersite
Amplicon SequenceCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTCGAAGCCA
TTGTGGAGGAGTCCGAAACTTTTATTAAAGGAAAGGAGAGAAAGACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)108410 - 517
Exon 2 To Exon 3 (Pair 23)
Forward (410,21)CAAACTGACTTTGCAGCCACGAmplicon SizecDNA: 82 bpgenomic: 39,641
Reverse (491,22)AAAGTTTCGGACTCCTCCACAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.299 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.381 kcal/mol
Reverse Dimers-1.421 kcal/mol
Forward-Reverse Dimers-2.573 kcal/mol
Amplicon Folding0.027 kcal/mol inside primersite
Amplicon SequenceCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTCGAAGCCA
TTGTGGAGGAGTCCGAAACTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)82410 - 491
Exon 2 To Exon 3 (Pair 24)
Forward (401,22)TTCCCTCCTCAAACTGACTTTGAmplicon SizecDNA: 88 bpgenomic: 39,647
Reverse (488,21)GTTTCGGACTCCTCCACAATGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.288 kcal/mol in 3' area
Forward Dimers0.336 kcal/mol in 3' area
Reverse Loops1.028 kcal/mol
Reverse Dimers-0.375 kcal/mol
Forward-Reverse Dimers-0.923 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAG
TCGAAGCCATTGTGGAGGAGTCCGAAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)88401 - 488
Exon 2 To Exon 3 (Pair 25)
Forward (410,21)CAAACTGACTTTGCAGCCACGAmplicon SizecDNA: 107 bpgenomic: 39,666
Reverse (516,24)AGTCTTTCTCTCCTTTCCTTTAATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.299 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.659 kcal/mol
Reverse Dimers0.845 kcal/mol
Forward-Reverse Dimers-1.339 kcal/mol
Amplicon Folding0.027 kcal/mol inside primersite
Amplicon SequenceCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTCGAAGCCA
TTGTGGAGGAGTCCGAAACTTTTATTAAAGGAAAGGAGAGAAAGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)107410 - 516
Exon 2 To Exon 3 (Pair 26)
Forward (380,22)GCTTGAGAGCTGGGTTCTATTTAmplicon SizecDNA: 90 bpgenomic: 39,649
Reverse (469,21)TGGCTTCGACTGCATCACCTTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.849 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.696 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.935 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAG
GGGAAATGGAAGGTGATGCAGTCGAAGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)90380 - 469
Exon 2 To Exon 3 (Pair 27)
Forward (378,20)GGGCTTGAGAGCTGGGTTCTAmplicon SizecDNA: 113 bpgenomic: 39,672
Reverse (490,22)AAGTTTCGGACTCCTCCACAATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.541 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.381 kcal/mol
Reverse Dimers-1.421 kcal/mol
Forward-Reverse Dimers-1.198 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGC
AGGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)113378 - 490
Exon 2 To Exon 3 (Pair 28)
Forward (380,22)GCTTGAGAGCTGGGTTCTATTTAmplicon SizecDNA: 250 bpgenomic: 39,809
Reverse (629,22)ATCACCATCTGTACACTGCTGTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.849 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.722 kcal/mol in 3' area
Reverse Dimers-1.296 kcal/mol
Forward-Reverse Dimers-1.931 kcal/mol
Amplicon Folding-1.407 kcal/mol outside primersite
Amplicon SequenceGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAG
GGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAAG
GAAAGGAGAGAAAGACTTACCAGAGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGCC
ACTTACCCCAGAACCAGACGGATGGGGGTGAGGTGGTCCAGGATGTCAACAGCAGTGTAC
AGATGGTGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)250380 - 629
Exon 2 To Exon 3 (Pair 29)
Forward (360,20)GGACAGATTGCTGACCAGGGAmplicon SizecDNA: 113 bpgenomic: 39,672
Reverse (472,21)CAATGGCTTCGACTGCATCACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.161 kcal/mol
Forward Dimers-1.627 kcal/mol
Reverse Loops1.527 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.654 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGACAGATTGCTGACCAGGGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACT
TTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTCGAAGCCATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)113360 - 472
Exon 2 To Exon 3 (Pair 30)
Forward (378,20)GGGCTTGAGAGCTGGGTTCTAmplicon SizecDNA: 185 bpgenomic: 39,744
Reverse (562,21)AGTGGCAGGCATCTTCTTCCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.541 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.333 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-1.689 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGC
AGGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAA
AGGAAAGGAGAGAAAGACTTACCAGAGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTG
CCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)185378 - 562
Exon 2 To Exon 3 (Pair 31)
Forward (403,21)CCCTCCTCAAACTGACTTTGCAmplicon SizecDNA: 227 bpgenomic: 39,786
Reverse (629,22)ATCACCATCTGTACACTGCTGTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.077 kcal/mol in 3' area
Forward Dimers0.125 kcal/mol in 3' area
Reverse Loops0.722 kcal/mol in 3' area
Reverse Dimers-1.296 kcal/mol
Forward-Reverse Dimers-0.493 kcal/mol
Amplicon Folding-1.407 kcal/mol outside primersite
Amplicon SequenceCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTC
GAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAAGGAAAGGAGAGAAAGACTTACCAG
AGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGCCACTTACCCCAGAACCAGACGGAT
GGGGGTGAGGTGGTCCAGGATGTCAACAGCAGTGTACAGATGGTGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)227403 - 629
Exon 2 To Exon 3 (Pair 32)
Forward (403,21)CCCTCCTCAAACTGACTTTGCAmplicon SizecDNA: 229 bpgenomic: 39,788
Reverse (631,22)TCATCACCATCTGTACACTGCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.077 kcal/mol in 3' area
Forward Dimers0.125 kcal/mol in 3' area
Reverse Loops1.065 kcal/mol
Reverse Dimers-1.296 kcal/mol
Forward-Reverse Dimers-0.493 kcal/mol
Amplicon Folding-1.407 kcal/mol outside primersite
Amplicon SequenceCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTC
GAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAAGGAAAGGAGAGAAAGACTTACCAG
AGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGCCACTTACCCCAGAACCAGACGGAT
GGGGGTGAGGTGGTCCAGGATGTCAACAGCAGTGTACAGATGGTGATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)229403 - 631
Exon 2 To Exon 3 (Pair 33)
Forward (333,22)TGAAGCCAAAGAACAAGATGCGAmplicon SizecDNA: 159 bpgenomic: 39,718
Reverse (491,22)AAAGTTTCGGACTCCTCCACAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol in 3' area
Forward Dimers0.022 kcal/mol
Reverse Loops0.381 kcal/mol
Reverse Dimers-1.421 kcal/mol
Forward-Reverse Dimers-1.176 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceTGAAGCCAAAGAACAAGATGCGCTAGTGGACAGATTGCTGACCAGGGGCTTGAGAGCTGG
GTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGG
TGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)159333 - 491
Exon 2 To Exon 3 (Pair 34)
Forward (379,21)GGCTTGAGAGCTGGGTTCTATAmplicon SizecDNA: 86 bpgenomic: 39,645
Reverse (464,22)TCGACTGCATCACCTTCCATTTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.558 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.85 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.677 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCA
GGGGAAATGGAAGGTGATGCAGTCGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)86379 - 464
Exon 2 To Exon 3 (Pair 35)
Forward (412,21)AACTGACTTTGCAGCCACGGAAmplicon SizecDNA: 106 bpgenomic: 39,665
Reverse (517,24)AAGTCTTTCTCTCCTTTCCTTTAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.299 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.118 kcal/mol
Reverse Dimers0.104 kcal/mol
Forward-Reverse Dimers-1.88 kcal/mol
Amplicon Folding0.027 kcal/mol inside primersite
Amplicon SequenceAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTCGAAGCCATT
GTGGAGGAGTCCGAAACTTTTATTAAAGGAAAGGAGAGAAAGACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)106412 - 517
Exon 2 To Exon 3 (Pair 36)
Forward (379,21)GGCTTGAGAGCTGGGTTCTATAmplicon SizecDNA: 259 bpgenomic: 39,818
Reverse (637,22)GTTCCATCATCACCATCTGTACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.558 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.065 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.931 kcal/mol
Amplicon Folding-1.407 kcal/mol outside primersite
Amplicon SequenceGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCA
GGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAA
GGAAAGGAGAGAAAGACTTACCAGAGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGC
CACTTACCCCAGAACCAGACGGATGGGGGTGAGGTGGTCCAGGATGTCAACAGCAGTGTA
CAGATGGTGATGATGGAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)259379 - 637
Exon 2 To Exon 3 (Pair 37)
Forward (410,21)CAAACTGACTTTGCAGCCACGAmplicon SizecDNA: 81 bpgenomic: 39,640
Reverse (490,22)AAGTTTCGGACTCCTCCACAATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.299 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.381 kcal/mol
Reverse Dimers-1.421 kcal/mol
Forward-Reverse Dimers-2.573 kcal/mol
Amplicon Folding0.027 kcal/mol inside primersite
Amplicon SequenceCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTCGAAGCCA
TTGTGGAGGAGTCCGAAACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)81410 - 490
Exon 2 To Exon 3 (Pair 38)
Forward (414,20)CTGACTTTGCAGCCACGGAGAmplicon SizecDNA: 103 bpgenomic: 39,662
Reverse (516,24)AGTCTTTCTCTCCTTTCCTTTAATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.841 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.659 kcal/mol
Reverse Dimers0.845 kcal/mol
Forward-Reverse Dimers-1.339 kcal/mol
Amplicon Folding0.027 kcal/mol inside primersite
Amplicon SequenceCTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGT
GGAGGAGTCCGAAACTTTTATTAAAGGAAAGGAGAGAAAGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)103414 - 516
Exon 2 To Exon 3 (Pair 39)
Forward (401,22)TTCCCTCCTCAAACTGACTTTGAmplicon SizecDNA: 162 bpgenomic: 39,721
Reverse (562,21)AGTGGCAGGCATCTTCTTCCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.288 kcal/mol in 3' area
Forward Dimers0.336 kcal/mol in 3' area
Reverse Loops1.333 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-1.611 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAG
TCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAAGGAAAGGAGAGAAAGACTTACC
AGAGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGCCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)162401 - 562
Exon 2 To Exon 3 (Pair 40)
Forward (380,22)GCTTGAGAGCTGGGTTCTATTTAmplicon SizecDNA: 85 bpgenomic: 39,644
Reverse (464,22)TCGACTGCATCACCTTCCATTTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.849 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.85 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.677 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAG
GGGAAATGGAAGGTGATGCAGTCGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)85380 - 464
Exon 2 To Exon 3 (Pair 41)
Forward (411,21)AAACTGACTTTGCAGCCACGGAmplicon SizecDNA: 107 bpgenomic: 39,666
Reverse (517,24)AAGTCTTTCTCTCCTTTCCTTTAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.299 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.118 kcal/mol
Reverse Dimers0.104 kcal/mol
Forward-Reverse Dimers-1.88 kcal/mol
Amplicon Folding0.027 kcal/mol inside primersite
Amplicon SequenceAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTCGAAGCCAT
TGTGGAGGAGTCCGAAACTTTTATTAAAGGAAAGGAGAGAAAGACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)107411 - 517
Exon 2 To Exon 3 (Pair 42)
Forward (378,20)GGGCTTGAGAGCTGGGTTCTAmplicon SizecDNA: 98 bpgenomic: 39,657
Reverse (475,21)CCACAATGGCTTCGACTGCATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.541 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.216 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.935 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGC
AGGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)98378 - 475
Exon 2 To Exon 3 (Pair 43)
Forward (401,22)TTCCCTCCTCAAACTGACTTTGAmplicon SizecDNA: 231 bpgenomic: 39,790
Reverse (631,22)TCATCACCATCTGTACACTGCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.288 kcal/mol in 3' area
Forward Dimers0.336 kcal/mol in 3' area
Reverse Loops1.065 kcal/mol
Reverse Dimers-1.296 kcal/mol
Forward-Reverse Dimers-0.493 kcal/mol
Amplicon Folding-1.407 kcal/mol outside primersite
Amplicon SequenceTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAG
TCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAAGGAAAGGAGAGAAAGACTTACC
AGAGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGCCACTTACCCCAGAACCAGACGG
ATGGGGGTGAGGTGGTCCAGGATGTCAACAGCAGTGTACAGATGGTGATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)231401 - 631
Exon 2 To Exon 3 (Pair 44)
Forward (378,20)GGGCTTGAGAGCTGGGTTCTAmplicon SizecDNA: 95 bpgenomic: 39,654
Reverse (472,21)CAATGGCTTCGACTGCATCACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.541 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.527 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.935 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGC
AGGGGAAATGGAAGGTGATGCAGTCGAAGCCATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)95378 - 472
Exon 2 To Exon 3 (Pair 45)
Forward (379,21)GGCTTGAGAGCTGGGTTCTATAmplicon SizecDNA: 96 bpgenomic: 39,655
Reverse (474,21)CACAATGGCTTCGACTGCATCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.558 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.527 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.935 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCA
GGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)96379 - 474
Exon 2 To Exon 3 (Pair 46)
Forward (401,22)TTCCCTCCTCAAACTGACTTTGAmplicon SizecDNA: 90 bpgenomic: 39,649
Reverse (490,22)AAGTTTCGGACTCCTCCACAATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.288 kcal/mol in 3' area
Forward Dimers0.336 kcal/mol in 3' area
Reverse Loops0.381 kcal/mol
Reverse Dimers-1.421 kcal/mol
Forward-Reverse Dimers-2.573 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAG
TCGAAGCCATTGTGGAGGAGTCCGAAACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)90401 - 490
Exon 2 To Exon 3 (Pair 47)
Forward (360,20)GGACAGATTGCTGACCAGGGAmplicon SizecDNA: 111 bpgenomic: 39,670
Reverse (470,21)ATGGCTTCGACTGCATCACCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.161 kcal/mol
Forward Dimers-1.627 kcal/mol
Reverse Loops1.696 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.654 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGACAGATTGCTGACCAGGGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACT
TTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTCGAAGCCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)111360 - 470
Exon 2 To Exon 3 (Pair 48)
Forward (327,21)CGGACCTGAAGCCAAAGAACAAmplicon SizecDNA: 236 bpgenomic: 39,795
Reverse (562,21)AGTGGCAGGCATCTTCTTCCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.203 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.333 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-2.825 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceCGGACCTGAAGCCAAAGAACAAGATGCGCTAGTGGACAGATTGCTGACCAGGGGCTTGAG
AGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAAT
GGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAAGGAAAGGA
GAGAAAGACTTACCAGAGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGCCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)236327 - 562
Exon 2 To Exon 3 (Pair 49)
Forward (380,22)GCTTGAGAGCTGGGTTCTATTTAmplicon SizecDNA: 111 bpgenomic: 39,670
Reverse (490,22)AAGTTTCGGACTCCTCCACAATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.849 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.381 kcal/mol
Reverse Dimers-1.421 kcal/mol
Forward-Reverse Dimers-1.198 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAG
GGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)111380 - 490
Exon 2 To Exon 3 (Pair 50)
Forward (379,21)GGCTTGAGAGCTGGGTTCTATAmplicon SizecDNA: 246 bpgenomic: 39,805
Reverse (624,22)CATCTGTACACTGCTGTTGACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.558 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.217 kcal/mol
Reverse Dimers-1.884 kcal/mol
Forward-Reverse Dimers-1.79 kcal/mol
Amplicon Folding-1.407 kcal/mol outside primersite
Amplicon SequenceGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCA
GGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAA
GGAAAGGAGAGAAAGACTTACCAGAGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGC
CACTTACCCCAGAACCAGACGGATGGGGGTGAGGTGGTCCAGGATGTCAACAGCAGTGTA
CAGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)246379 - 624
Exon 2 To Exon 3 (Pair 51)
Forward (414,20)CTGACTTTGCAGCCACGGAGAmplicon SizecDNA: 77 bpgenomic: 39,636
Reverse (490,22)AAGTTTCGGACTCCTCCACAATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.841 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.381 kcal/mol
Reverse Dimers-1.421 kcal/mol
Forward-Reverse Dimers-1.876 kcal/mol
Amplicon Folding0.027 kcal/mol inside primersite
Amplicon SequenceCTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGT
GGAGGAGTCCGAAACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)77414 - 490
Exon 2 To Exon 3 (Pair 52)
Forward (380,22)GCTTGAGAGCTGGGTTCTATTTAmplicon SizecDNA: 245 bpgenomic: 39,804
Reverse (624,22)CATCTGTACACTGCTGTTGACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.849 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.217 kcal/mol
Reverse Dimers-1.884 kcal/mol
Forward-Reverse Dimers-1.79 kcal/mol
Amplicon Folding-1.407 kcal/mol outside primersite
Amplicon SequenceGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAG
GGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAAG
GAAAGGAGAGAAAGACTTACCAGAGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGCC
ACTTACCCCAGAACCAGACGGATGGGGGTGAGGTGGTCCAGGATGTCAACAGCAGTGTAC
AGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)245380 - 624
Exon 2 To Exon 3 (Pair 53)
Forward (410,21)CAAACTGACTTTGCAGCCACGAmplicon SizecDNA: 215 bpgenomic: 39,774
Reverse (624,22)CATCTGTACACTGCTGTTGACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.299 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.217 kcal/mol
Reverse Dimers-1.884 kcal/mol
Forward-Reverse Dimers-2.358 kcal/mol
Amplicon Folding-1.407 kcal/mol outside primersite
Amplicon SequenceCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTCGAAGCCA
TTGTGGAGGAGTCCGAAACTTTTATTAAAGGAAAGGAGAGAAAGACTTACCAGAGACGCC
GGGAAGGGGGCCAGGAAGAAGATGCCTGCCACTTACCCCAGAACCAGACGGATGGGGGTG
AGGTGGTCCAGGATGTCAACAGCAGTGTACAGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)215410 - 624
Exon 2 To Exon 3 (Pair 54)
Forward (380,22)GCTTGAGAGCTGGGTTCTATTTAmplicon SizecDNA: 97 bpgenomic: 39,656
Reverse (476,21)TCCACAATGGCTTCGACTGCANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.849 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.911 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.935 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAG
GGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)97380 - 476
Exon 2 To Exon 3 (Pair 55)
Forward (380,22)GCTTGAGAGCTGGGTTCTATTTAmplicon SizecDNA: 95 bpgenomic: 39,654
Reverse (474,21)CACAATGGCTTCGACTGCATCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.849 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.527 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.935 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAG
GGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)95380 - 474
Exon 2 To Exon 3 (Pair 56)
Forward (401,22)TTCCCTCCTCAAACTGACTTTGAmplicon SizecDNA: 91 bpgenomic: 39,650
Reverse (491,22)AAAGTTTCGGACTCCTCCACAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.288 kcal/mol in 3' area
Forward Dimers0.336 kcal/mol in 3' area
Reverse Loops0.381 kcal/mol
Reverse Dimers-1.421 kcal/mol
Forward-Reverse Dimers-2.573 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAG
TCGAAGCCATTGTGGAGGAGTCCGAAACTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)91401 - 491
Exon 2 To Exon 3 (Pair 57)
Forward (379,21)GGCTTGAGAGCTGGGTTCTATAmplicon SizecDNA: 251 bpgenomic: 39,810
Reverse (629,22)ATCACCATCTGTACACTGCTGTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.558 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.722 kcal/mol in 3' area
Reverse Dimers-1.296 kcal/mol
Forward-Reverse Dimers-1.931 kcal/mol
Amplicon Folding-1.407 kcal/mol outside primersite
Amplicon SequenceGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCA
GGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAA
GGAAAGGAGAGAAAGACTTACCAGAGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGC
CACTTACCCCAGAACCAGACGGATGGGGGTGAGGTGGTCCAGGATGTCAACAGCAGTGTA
CAGATGGTGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)251379 - 629
Exon 2 To Exon 3 (Pair 58)
Forward (380,22)GCTTGAGAGCTGGGTTCTATTTAmplicon SizecDNA: 252 bpgenomic: 39,811
Reverse (631,22)TCATCACCATCTGTACACTGCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.849 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.065 kcal/mol
Reverse Dimers-1.296 kcal/mol
Forward-Reverse Dimers-1.931 kcal/mol
Amplicon Folding-1.407 kcal/mol outside primersite
Amplicon SequenceGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAG
GGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAAG
GAAAGGAGAGAAAGACTTACCAGAGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGCC
ACTTACCCCAGAACCAGACGGATGGGGGTGAGGTGGTCCAGGATGTCAACAGCAGTGTAC
AGATGGTGATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)252380 - 631
Exon 2 To Exon 3 (Pair 59)
Forward (327,21)CGGACCTGAAGCCAAAGAACAAmplicon SizecDNA: 298 bpgenomic: 39,857
Reverse (624,22)CATCTGTACACTGCTGTTGACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.203 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops0.217 kcal/mol
Reverse Dimers-1.884 kcal/mol
Forward-Reverse Dimers-1.735 kcal/mol
Amplicon Folding-1.407 kcal/mol outside primersite
Amplicon SequenceCGGACCTGAAGCCAAAGAACAAGATGCGCTAGTGGACAGATTGCTGACCAGGGGCTTGAG
AGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAAT
GGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAAGGAAAGGA
GAGAAAGACTTACCAGAGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGCCACTTACC
CCAGAACCAGACGGATGGGGGTGAGGTGGTCCAGGATGTCAACAGCAGTGTACAGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)298327 - 624
Exon 2 To Exon 3 (Pair 60)
Forward (414,20)CTGACTTTGCAGCCACGGAGAmplicon SizecDNA: 104 bpgenomic: 39,663
Reverse (517,24)AAGTCTTTCTCTCCTTTCCTTTAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.841 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.118 kcal/mol
Reverse Dimers0.104 kcal/mol
Forward-Reverse Dimers-1.88 kcal/mol
Amplicon Folding0.027 kcal/mol inside primersite
Amplicon SequenceCTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGT
GGAGGAGTCCGAAACTTTTATTAAAGGAAAGGAGAGAAAGACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)104414 - 517
Exon 2 To Exon 3 (Pair 61)
Forward (323,22)ATTACGGACCTGAAGCCAAAGAAmplicon SizecDNA: 241 bpgenomic: 39,800
Reverse (563,21)AAGTGGCAGGCATCTTCTTCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.719 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.333 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-2.825 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceATTACGGACCTGAAGCCAAAGAACAAGATGCGCTAGTGGACAGATTGCTGACCAGGGGCT
TGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGG
AAATGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAAGGAA
AGGAGAGAAAGACTTACCAGAGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGCCACT
T
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)241323 - 563
Exon 2 To Exon 3 (Pair 62)
Forward (323,22)ATTACGGACCTGAAGCCAAAGAAmplicon SizecDNA: 240 bpgenomic: 39,799
Reverse (562,21)AGTGGCAGGCATCTTCTTCCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.719 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.333 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-2.825 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceATTACGGACCTGAAGCCAAAGAACAAGATGCGCTAGTGGACAGATTGCTGACCAGGGGCT
TGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGG
AAATGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAAGGAA
AGGAGAGAAAGACTTACCAGAGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGCCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)240323 - 562
Exon 2 To Exon 3 (Pair 63)
Forward (401,22)TTCCCTCCTCAAACTGACTTTGAmplicon SizecDNA: 75 bpgenomic: 39,634
Reverse (475,21)CCACAATGGCTTCGACTGCATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.288 kcal/mol in 3' area
Forward Dimers0.336 kcal/mol in 3' area
Reverse Loops1.216 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-0.326 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAG
TCGAAGCCATTGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)75401 - 475
Exon 2 To Exon 3 (Pair 64)
Forward (378,20)GGGCTTGAGAGCTGGGTTCTAmplicon SizecDNA: 93 bpgenomic: 39,652
Reverse (470,21)ATGGCTTCGACTGCATCACCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.541 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.696 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.935 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGC
AGGGGAAATGGAAGGTGATGCAGTCGAAGCCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)93378 - 470
Exon 2 To Exon 3 (Pair 65)
Forward (379,21)GGCTTGAGAGCTGGGTTCTATAmplicon SizecDNA: 110 bpgenomic: 39,669
Reverse (488,21)GTTTCGGACTCCTCCACAATGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.558 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.028 kcal/mol
Reverse Dimers-0.375 kcal/mol
Forward-Reverse Dimers-1.198 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCA
GGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)110379 - 488
Exon 2 To Exon 3 (Pair 66)
Forward (380,22)GCTTGAGAGCTGGGTTCTATTTAmplicon SizecDNA: 92 bpgenomic: 39,651
Reverse (471,21)AATGGCTTCGACTGCATCACCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.849 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.527 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.935 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAG
GGGAAATGGAAGGTGATGCAGTCGAAGCCATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)92380 - 471
Exon 2 To Exon 3 (Pair 67)
Forward (378,20)GGGCTTGAGAGCTGGGTTCTAmplicon SizecDNA: 247 bpgenomic: 39,806
Reverse (624,22)CATCTGTACACTGCTGTTGACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.541 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.217 kcal/mol
Reverse Dimers-1.884 kcal/mol
Forward-Reverse Dimers-1.79 kcal/mol
Amplicon Folding-1.407 kcal/mol outside primersite
Amplicon SequenceGGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGC
AGGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAA
AGGAAAGGAGAGAAAGACTTACCAGAGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTG
CCACTTACCCCAGAACCAGACGGATGGGGGTGAGGTGGTCCAGGATGTCAACAGCAGTGT
ACAGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)247378 - 624
Exon 2 To Exon 3 (Pair 68)
Forward (379,21)GGCTTGAGAGCTGGGTTCTATAmplicon SizecDNA: 92 bpgenomic: 39,651
Reverse (470,21)ATGGCTTCGACTGCATCACCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.558 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.696 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.935 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCA
GGGGAAATGGAAGGTGATGCAGTCGAAGCCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)92379 - 470
Exon 2 To Exon 3 (Pair 69)
Forward (403,21)CCCTCCTCAAACTGACTTTGCAmplicon SizecDNA: 88 bpgenomic: 39,647
Reverse (490,22)AAGTTTCGGACTCCTCCACAATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.077 kcal/mol in 3' area
Forward Dimers0.125 kcal/mol in 3' area
Reverse Loops0.381 kcal/mol
Reverse Dimers-1.421 kcal/mol
Forward-Reverse Dimers-2.573 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTC
GAAGCCATTGTGGAGGAGTCCGAAACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)88403 - 490
Exon 2 To Exon 3 (Pair 70)
Forward (403,21)CCCTCCTCAAACTGACTTTGCAmplicon SizecDNA: 89 bpgenomic: 39,648
Reverse (491,22)AAAGTTTCGGACTCCTCCACAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.077 kcal/mol in 3' area
Forward Dimers0.125 kcal/mol in 3' area
Reverse Loops0.381 kcal/mol
Reverse Dimers-1.421 kcal/mol
Forward-Reverse Dimers-2.573 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTC
GAAGCCATTGTGGAGGAGTCCGAAACTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)89403 - 491
Exon 2 To Exon 3 (Pair 71)
Forward (324,22)TTACGGACCTGAAGCCAAAGAAAmplicon SizecDNA: 240 bpgenomic: 39,799
Reverse (563,21)AAGTGGCAGGCATCTTCTTCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.719 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.333 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-2.825 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceTTACGGACCTGAAGCCAAAGAACAAGATGCGCTAGTGGACAGATTGCTGACCAGGGGCTT
GAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGA
AATGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAAGGAAA
GGAGAGAAAGACTTACCAGAGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGCCACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)240324 - 563
Exon 2 To Exon 3 (Pair 72)
Forward (412,21)AACTGACTTTGCAGCCACGGAAmplicon SizecDNA: 105 bpgenomic: 39,664
Reverse (516,24)AGTCTTTCTCTCCTTTCCTTTAATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.299 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.659 kcal/mol
Reverse Dimers0.845 kcal/mol
Forward-Reverse Dimers-1.339 kcal/mol
Amplicon Folding0.027 kcal/mol inside primersite
Amplicon SequenceAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTCGAAGCCATT
GTGGAGGAGTCCGAAACTTTTATTAAAGGAAAGGAGAGAAAGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)105412 - 516
Exon 2 To Exon 3 (Pair 73)
Forward (379,21)GGCTTGAGAGCTGGGTTCTATAmplicon SizecDNA: 87 bpgenomic: 39,646
Reverse (465,22)TTCGACTGCATCACCTTCCATTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.558 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.85 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.677 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCA
GGGGAAATGGAAGGTGATGCAGTCGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)87379 - 465
Exon 2 To Exon 3 (Pair 74)
Forward (326,21)ACGGACCTGAAGCCAAAGAACAmplicon SizecDNA: 238 bpgenomic: 39,797
Reverse (563,21)AAGTGGCAGGCATCTTCTTCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.719 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.333 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-2.825 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceACGGACCTGAAGCCAAAGAACAAGATGCGCTAGTGGACAGATTGCTGACCAGGGGCTTGA
GAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAA
TGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAAGGAAAGG
AGAGAAAGACTTACCAGAGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGCCACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)238326 - 563
Exon 2 To Exon 3 (Pair 75)
Forward (333,22)TGAAGCCAAAGAACAAGATGCGAmplicon SizecDNA: 156 bpgenomic: 39,715
Reverse (488,21)GTTTCGGACTCCTCCACAATGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol in 3' area
Forward Dimers0.022 kcal/mol
Reverse Loops1.028 kcal/mol
Reverse Dimers-0.375 kcal/mol
Forward-Reverse Dimers-1.176 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceTGAAGCCAAAGAACAAGATGCGCTAGTGGACAGATTGCTGACCAGGGGCTTGAGAGCTGG
GTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGG
TGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)156333 - 488
Exon 2 To Exon 3 (Pair 76)
Forward (416,20)GACTTTGCAGCCACGGAGAGAmplicon SizecDNA: 209 bpgenomic: 39,768
Reverse (624,22)CATCTGTACACTGCTGTTGACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.035 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.217 kcal/mol
Reverse Dimers-1.884 kcal/mol
Forward-Reverse Dimers-2.358 kcal/mol
Amplicon Folding-1.407 kcal/mol outside primersite
Amplicon SequenceGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGG
AGGAGTCCGAAACTTTTATTAAAGGAAAGGAGAGAAAGACTTACCAGAGACGCCGGGAAG
GGGGCCAGGAAGAAGATGCCTGCCACTTACCCCAGAACCAGACGGATGGGGGTGAGGTGG
TCCAGGATGTCAACAGCAGTGTACAGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)209416 - 624
Exon 2 To Exon 3 (Pair 77)
Forward (403,21)CCCTCCTCAAACTGACTTTGCAmplicon SizecDNA: 160 bpgenomic: 39,719
Reverse (562,21)AGTGGCAGGCATCTTCTTCCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.077 kcal/mol in 3' area
Forward Dimers0.125 kcal/mol in 3' area
Reverse Loops1.333 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-1.611 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTC
GAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAAGGAAAGGAGAGAAAGACTTACCAG
AGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGCCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)160403 - 562
Exon 2 To Exon 3 (Pair 78)
Forward (401,22)TTCCCTCCTCAAACTGACTTTGAmplicon SizecDNA: 72 bpgenomic: 39,631
Reverse (472,21)CAATGGCTTCGACTGCATCACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.288 kcal/mol in 3' area
Forward Dimers0.336 kcal/mol in 3' area
Reverse Loops1.527 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-0.187 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAG
TCGAAGCCATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)72401 - 472
Exon 2 To Exon 3 (Pair 79)
Forward (379,21)GGCTTGAGAGCTGGGTTCTATAmplicon SizecDNA: 185 bpgenomic: 39,744
Reverse (563,21)AAGTGGCAGGCATCTTCTTCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.558 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.333 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-1.689 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCA
GGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAA
GGAAAGGAGAGAAAGACTTACCAGAGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGC
CACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)185379 - 563
Exon 2 To Exon 3 (Pair 80)
Forward (379,21)GGCTTGAGAGCTGGGTTCTATAmplicon SizecDNA: 82 bpgenomic: 39,641
Reverse (460,21)CTGCATCACCTTCCATTTCCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.558 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops2.741 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.677 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCA
GGGGAAATGGAAGGTGATGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)82379 - 460
Exon 2 To Exon 3 (Pair 81)
Forward (403,21)CCCTCCTCAAACTGACTTTGCAmplicon SizecDNA: 86 bpgenomic: 39,645
Reverse (488,21)GTTTCGGACTCCTCCACAATGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.077 kcal/mol in 3' area
Forward Dimers0.125 kcal/mol in 3' area
Reverse Loops1.028 kcal/mol
Reverse Dimers-0.375 kcal/mol
Forward-Reverse Dimers-0.923 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTC
GAAGCCATTGTGGAGGAGTCCGAAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)86403 - 488
Exon 2 To Exon 3 (Pair 82)
Forward (379,21)GGCTTGAGAGCTGGGTTCTATAmplicon SizecDNA: 184 bpgenomic: 39,743
Reverse (562,21)AGTGGCAGGCATCTTCTTCCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.558 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.333 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-1.689 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCA
GGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAA
GGAAAGGAGAGAAAGACTTACCAGAGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGC
CACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)184379 - 562
Exon 2 To Exon 3 (Pair 83)
Forward (327,21)CGGACCTGAAGCCAAAGAACAAmplicon SizecDNA: 237 bpgenomic: 39,796
Reverse (563,21)AAGTGGCAGGCATCTTCTTCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.203 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.333 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-2.825 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceCGGACCTGAAGCCAAAGAACAAGATGCGCTAGTGGACAGATTGCTGACCAGGGGCTTGAG
AGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAAT
GGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAAGGAAAGGA
GAGAAAGACTTACCAGAGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGCCACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)237327 - 563
Exon 2 To Exon 3 (Pair 84)
Forward (401,22)TTCCCTCCTCAAACTGACTTTGAmplicon SizecDNA: 237 bpgenomic: 39,796
Reverse (637,22)GTTCCATCATCACCATCTGTACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.288 kcal/mol in 3' area
Forward Dimers0.336 kcal/mol in 3' area
Reverse Loops1.065 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.545 kcal/mol
Amplicon Folding-1.407 kcal/mol outside primersite
Amplicon SequenceTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAG
TCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAAGGAAAGGAGAGAAAGACTTACC
AGAGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGCCACTTACCCCAGAACCAGACGG
ATGGGGGTGAGGTGGTCCAGGATGTCAACAGCAGTGTACAGATGGTGATGATGGAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)237401 - 637
Exon 2 To Exon 3 (Pair 85)
Forward (326,21)ACGGACCTGAAGCCAAAGAACAmplicon SizecDNA: 237 bpgenomic: 39,796
Reverse (562,21)AGTGGCAGGCATCTTCTTCCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.719 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.333 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-2.825 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceACGGACCTGAAGCCAAAGAACAAGATGCGCTAGTGGACAGATTGCTGACCAGGGGCTTGA
GAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAA
TGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAAGGAAAGG
AGAGAAAGACTTACCAGAGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGCCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)237326 - 562
Exon 2 To Exon 3 (Pair 86)
Forward (412,21)AACTGACTTTGCAGCCACGGAAmplicon SizecDNA: 80 bpgenomic: 39,639
Reverse (491,22)AAAGTTTCGGACTCCTCCACAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.299 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.381 kcal/mol
Reverse Dimers-1.421 kcal/mol
Forward-Reverse Dimers-2.321 kcal/mol
Amplicon Folding0.027 kcal/mol inside primersite
Amplicon SequenceAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTCGAAGCCATT
GTGGAGGAGTCCGAAACTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)80412 - 491
Exon 2 To Exon 3 (Pair 87)
Forward (378,20)GGGCTTGAGAGCTGGGTTCTAmplicon SizecDNA: 94 bpgenomic: 39,653
Reverse (471,21)AATGGCTTCGACTGCATCACCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.541 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.527 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.935 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGC
AGGGGAAATGGAAGGTGATGCAGTCGAAGCCATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)94378 - 471
Exon 2 To Exon 3 (Pair 88)
Forward (378,20)GGGCTTGAGAGCTGGGTTCTAmplicon SizecDNA: 99 bpgenomic: 39,658
Reverse (476,21)TCCACAATGGCTTCGACTGCANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.541 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.911 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.935 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGC
AGGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)99378 - 476
Exon 2 To Exon 3 (Pair 89)
Forward (410,21)CAAACTGACTTTGCAGCCACGAmplicon SizecDNA: 79 bpgenomic: 39,638
Reverse (488,21)GTTTCGGACTCCTCCACAATGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.299 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.028 kcal/mol
Reverse Dimers-0.375 kcal/mol
Forward-Reverse Dimers-0.923 kcal/mol
Amplicon Folding0.027 kcal/mol inside primersite
Amplicon SequenceCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTCGAAGCCA
TTGTGGAGGAGTCCGAAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)79410 - 488
Exon 2 To Exon 3 (Pair 90)
Forward (380,22)GCTTGAGAGCTGGGTTCTATTTAmplicon SizecDNA: 96 bpgenomic: 39,655
Reverse (475,21)CCACAATGGCTTCGACTGCATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.849 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.216 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.935 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAG
GGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)96380 - 475
Exon 2 To Exon 3 (Pair 91)
Forward (324,22)TTACGGACCTGAAGCCAAAGAAAmplicon SizecDNA: 301 bpgenomic: 39,860
Reverse (624,22)CATCTGTACACTGCTGTTGACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.719 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops0.217 kcal/mol
Reverse Dimers-1.884 kcal/mol
Forward-Reverse Dimers-1.735 kcal/mol
Amplicon Folding-1.407 kcal/mol outside primersite
Amplicon SequenceTTACGGACCTGAAGCCAAAGAACAAGATGCGCTAGTGGACAGATTGCTGACCAGGGGCTT
GAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGA
AATGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAAGGAAA
GGAGAGAAAGACTTACCAGAGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGCCACTT
ACCCCAGAACCAGACGGATGGGGGTGAGGTGGTCCAGGATGTCAACAGCAGTGTACAGAT
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)301324 - 624
Exon 2 To Exon 3 (Pair 92)
Forward (333,22)TGAAGCCAAAGAACAAGATGCGAmplicon SizecDNA: 158 bpgenomic: 39,717
Reverse (490,22)AAGTTTCGGACTCCTCCACAATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol in 3' area
Forward Dimers0.022 kcal/mol
Reverse Loops0.381 kcal/mol
Reverse Dimers-1.421 kcal/mol
Forward-Reverse Dimers-1.176 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceTGAAGCCAAAGAACAAGATGCGCTAGTGGACAGATTGCTGACCAGGGGCTTGAGAGCTGG
GTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGG
TGATGCAGTCGAAGCCATTGTGGAGGAGTCCGAAACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)158333 - 490
Exon 2 To Exon 3 (Pair 93)
Forward (414,20)CTGACTTTGCAGCCACGGAGAmplicon SizecDNA: 78 bpgenomic: 39,637
Reverse (491,22)AAAGTTTCGGACTCCTCCACAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.841 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.381 kcal/mol
Reverse Dimers-1.421 kcal/mol
Forward-Reverse Dimers-2.321 kcal/mol
Amplicon Folding0.027 kcal/mol inside primersite
Amplicon SequenceCTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGT
GGAGGAGTCCGAAACTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)78414 - 491
Exon 2 To Exon 3 (Pair 94)
Forward (411,21)AAACTGACTTTGCAGCCACGGAmplicon SizecDNA: 81 bpgenomic: 39,640
Reverse (491,22)AAAGTTTCGGACTCCTCCACAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.299 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.381 kcal/mol
Reverse Dimers-1.421 kcal/mol
Forward-Reverse Dimers-2.321 kcal/mol
Amplicon Folding0.027 kcal/mol inside primersite
Amplicon SequenceAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTCGAAGCCAT
TGTGGAGGAGTCCGAAACTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)81411 - 491
Exon 2 To Exon 3 (Pair 95)
Forward (403,21)CCCTCCTCAAACTGACTTTGCAmplicon SizecDNA: 235 bpgenomic: 39,794
Reverse (637,22)GTTCCATCATCACCATCTGTACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.077 kcal/mol in 3' area
Forward Dimers0.125 kcal/mol in 3' area
Reverse Loops1.065 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.545 kcal/mol
Amplicon Folding-1.407 kcal/mol outside primersite
Amplicon SequenceCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTC
GAAGCCATTGTGGAGGAGTCCGAAACTTTTATTAAAGGAAAGGAGAGAAAGACTTACCAG
AGACGCCGGGAAGGGGGCCAGGAAGAAGATGCCTGCCACTTACCCCAGAACCAGACGGAT
GGGGGTGAGGTGGTCCAGGATGTCAACAGCAGTGTACAGATGGTGATGATGGAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)235403 - 637
Exon 2 To Exon 3 (Pair 96)
Forward (412,21)AACTGACTTTGCAGCCACGGAAmplicon SizecDNA: 77 bpgenomic: 39,636
Reverse (488,21)GTTTCGGACTCCTCCACAATGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.299 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.028 kcal/mol
Reverse Dimers-0.375 kcal/mol
Forward-Reverse Dimers-0.903 kcal/mol
Amplicon Folding0.027 kcal/mol inside primersite
Amplicon SequenceAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTCGAAGCCATT
GTGGAGGAGTCCGAAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)77412 - 488
Exon 2 To Exon 3 (Pair 97)
Forward (401,22)TTCCCTCCTCAAACTGACTTTGAmplicon SizecDNA: 76 bpgenomic: 39,635
Reverse (476,21)TCCACAATGGCTTCGACTGCANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.288 kcal/mol in 3' area
Forward Dimers0.336 kcal/mol in 3' area
Reverse Loops0.911 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-0.326 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAG
TCGAAGCCATTGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)76401 - 476
Exon 2 To Exon 3 (Pair 98)
Forward (379,21)GGCTTGAGAGCTGGGTTCTATAmplicon SizecDNA: 94 bpgenomic: 39,653
Reverse (472,21)CAATGGCTTCGACTGCATCACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.558 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.527 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.935 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACTTTGCAGCCACGGAGAGGCA
GGGGAAATGGAAGGTGATGCAGTCGAAGCCATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)94379 - 472
Exon 2 To Exon 3 (Pair 99)
Forward (360,20)GGACAGATTGCTGACCAGGGAmplicon SizecDNA: 204 bpgenomic: 39,763
Reverse (563,21)AAGTGGCAGGCATCTTCTTCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.161 kcal/mol
Forward Dimers-1.627 kcal/mol
Reverse Loops1.333 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-1.952 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGACAGATTGCTGACCAGGGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACT
TTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTCGAAGCCATTGTGGAGGA
GTCCGAAACTTTTATTAAAGGAAAGGAGAGAAAGACTTACCAGAGACGCCGGGAAGGGGG
CCAGGAAGAAGATGCCTGCCACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)204360 - 563
Exon 2 To Exon 3 (Pair 100)
Forward (360,20)GGACAGATTGCTGACCAGGGAmplicon SizecDNA: 112 bpgenomic: 39,671
Reverse (471,21)AATGGCTTCGACTGCATCACCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.161 kcal/mol
Forward Dimers-1.627 kcal/mol
Reverse Loops1.527 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.654 kcal/mol
Amplicon Folding0.027 kcal/mol outside primersite
Amplicon SequenceGGACAGATTGCTGACCAGGGGCTTGAGAGCTGGGTTCTATTTTCCCTCCTCAAACTGACT
TTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTCGAAGCCATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006565 (CTCF)112360 - 471
 

See below for some more details.

Program Output:

Loading ...