Design Results for DCAF4

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size1000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 1 To Exon 2 (Pair 1)
Forward (146,20)TGCACGCTTCGCTCCAACTCAmplicon SizecDNA: 118 bpgenomic: 11,545
Reverse (263,22)TTCTCCCATGTCGTCTTCTACTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.124 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGC
TGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)118146 - 263
NM_015604 (DCAF4)118146 - 263
NM_001163508 (DCAF4)118146 - 263
NM_001163509 (DCAF4)118146 - 263
Exon 1 To Exon 2 (Pair 2)
Forward (130,20)GGTCTTTCCGGGTCCTTGCAAmplicon SizecDNA: 132 bpgenomic: 11,559
Reverse (261,21)CTCCCATGTCGTCTTCTACTCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.691 kcal/mol
Forward Dimers-2.596 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.391 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceGGTCTTTCCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAA
TCCGGAAGGGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAG
ACGACATGGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163509 (DCAF4)132130 - 261
NM_001163508 (DCAF4)132130 - 261
NM_015604 (DCAF4)132130 - 261
NM_181341 (DCAF4)132130 - 261
Exon 1 To Exon 2 (Pair 3)
Forward (148,20)CACGCTTCGCTCCAACTCCTAmplicon SizecDNA: 130 bpgenomic: 11,557
Reverse (277,20)CTGCTGGTGGCTTCTTCTCCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.828 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGCTG
AACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGAAGAAG
CCACCAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)130148 - 277
NM_001163509 (DCAF4)130148 - 277
NM_015604 (DCAF4)130148 - 277
NM_001163508 (DCAF4)130148 - 277
Exon 1 To Exon 2 (Pair 4)
Forward (131,20)GTCTTTCCGGGTCCTTGCACAmplicon SizecDNA: 136 bpgenomic: 11,563
Reverse (266,22)TTCTTCTCCCATGTCGTCTTCTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops2.567 kcal/mol in 3' area
Forward Dimers-2.596 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.391 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceGTCTTTCCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAAT
CCGGAAGGGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGA
CGACATGGGAGAAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163508 (DCAF4)136131 - 266
NM_001163509 (DCAF4)136131 - 266
NM_015604 (DCAF4)136131 - 266
NM_181341 (DCAF4)136131 - 266
Exon 1 To Exon 2 (Pair 5)
Forward (142,20)TCCTTGCACGCTTCGCTCCAAmplicon SizecDNA: 117 bpgenomic: 11,544
Reverse (258,21)CCATGTCGTCTTCTACTCTGCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGAC
ACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)117142 - 258
NM_015604 (DCAF4)117142 - 258
NM_001163509 (DCAF4)117142 - 258
NM_001163508 (DCAF4)117142 - 258
Exon 1 To Exon 2 (Pair 6)
Forward (129,20)TGGTCTTTCCGGGTCCTTGCAmplicon SizecDNA: 142 bpgenomic: 11,569
Reverse (270,21)TGGCTTCTTCTCCCATGTCGTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.245 kcal/mol
Forward Dimers-2.596 kcal/mol
Reverse Loops1.827 kcal/mol
Reverse Dimers-0.205 kcal/mol
Forward-Reverse Dimers-1.391 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceTGGTCTTTCCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGA
ATCCGGAAGGGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAA
GACGACATGGGAGAAGAAGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163509 (DCAF4)142129 - 270
NM_015604 (DCAF4)142129 - 270
NM_001163508 (DCAF4)142129 - 270
NM_181341 (DCAF4)142129 - 270
Exon 1 To Exon 2 (Pair 7)
Forward (148,20)CACGCTTCGCTCCAACTCCTAmplicon SizecDNA: 111 bpgenomic: 11,538
Reverse (258,21)CCATGTCGTCTTCTACTCTGCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGCTG
AACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)111148 - 258
NM_001163508 (DCAF4)111148 - 258
NM_001163509 (DCAF4)111148 - 258
NM_015604 (DCAF4)111148 - 258
Exon 1 To Exon 2 (Pair 8)
Forward (142,20)TCCTTGCACGCTTCGCTCCAAmplicon SizecDNA: 120 bpgenomic: 11,547
Reverse (261,21)CTCCCATGTCGTCTTCTACTCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGAC
ACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)120142 - 261
NM_015604 (DCAF4)120142 - 261
NM_001163509 (DCAF4)120142 - 261
NM_001163508 (DCAF4)120142 - 261
Exon 1 To Exon 2 (Pair 9)
Forward (131,20)GTCTTTCCGGGTCCTTGCACAmplicon SizecDNA: 131 bpgenomic: 11,558
Reverse (261,21)CTCCCATGTCGTCTTCTACTCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops2.567 kcal/mol in 3' area
Forward Dimers-2.596 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.391 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceGTCTTTCCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAAT
CCGGAAGGGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGA
CGACATGGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)131131 - 261
NM_001163509 (DCAF4)131131 - 261
NM_015604 (DCAF4)131131 - 261
NM_001163508 (DCAF4)131131 - 261
Exon 1 To Exon 2 (Pair 10)
Forward (142,20)TCCTTGCACGCTTCGCTCCAAmplicon SizecDNA: 135 bpgenomic: 11,562
Reverse (276,20)TGCTGGTGGCTTCTTCTCCCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.986 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGAC
ACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAG
AAGAAGCCACCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)135142 - 276
NM_001163508 (DCAF4)135142 - 276
NM_015604 (DCAF4)135142 - 276
NM_001163509 (DCAF4)135142 - 276
Exon 1 To Exon 2 (Pair 11)
Forward (148,20)CACGCTTCGCTCCAACTCCTAmplicon SizecDNA: 110 bpgenomic: 11,537
Reverse (257,21)CATGTCGTCTTCTACTCTGCCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers0.136 kcal/mol in 3' area
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGCTG
AACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015604 (DCAF4)110148 - 257
NM_001163509 (DCAF4)110148 - 257
NM_001163508 (DCAF4)110148 - 257
NM_181341 (DCAF4)110148 - 257
Exon 1 To Exon 2 (Pair 12)
Forward (148,20)CACGCTTCGCTCCAACTCCTAmplicon SizecDNA: 114 bpgenomic: 11,541
Reverse (261,21)CTCCCATGTCGTCTTCTACTCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGCTG
AACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163508 (DCAF4)114148 - 261
NM_001163509 (DCAF4)114148 - 261
NM_015604 (DCAF4)114148 - 261
NM_181341 (DCAF4)114148 - 261
Exon 1 To Exon 2 (Pair 13)
Forward (131,20)GTCTTTCCGGGTCCTTGCACAmplicon SizecDNA: 138 bpgenomic: 11,565
Reverse (268,21)GCTTCTTCTCCCATGTCGTCTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops2.567 kcal/mol in 3' area
Forward Dimers-2.596 kcal/mol
Reverse Loops2.175 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.391 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceGTCTTTCCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAAT
CCGGAAGGGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGA
CGACATGGGAGAAGAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)138131 - 268
NM_015604 (DCAF4)138131 - 268
NM_001163509 (DCAF4)138131 - 268
NM_001163508 (DCAF4)138131 - 268
Exon 1 To Exon 2 (Pair 14)
Forward (146,20)TGCACGCTTCGCTCCAACTCAmplicon SizecDNA: 114 bpgenomic: 11,541
Reverse (259,21)CCCATGTCGTCTTCTACTCTGNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.124 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGC
TGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163508 (DCAF4)114146 - 259
NM_015604 (DCAF4)114146 - 259
NM_001163509 (DCAF4)114146 - 259
NM_181341 (DCAF4)114146 - 259
Exon 1 To Exon 2 (Pair 15)
Forward (144,20)CTTGCACGCTTCGCTCCAACAmplicon SizecDNA: 118 bpgenomic: 11,545
Reverse (261,21)CTCCCATGTCGTCTTCTACTCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACAC
GCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163508 (DCAF4)118144 - 261
NM_015604 (DCAF4)118144 - 261
NM_001163509 (DCAF4)118144 - 261
NM_181341 (DCAF4)118144 - 261
Exon 1 To Exon 2 (Pair 16)
Forward (96,21)AACGCATCCACCTAACTGGCTAmplicon SizecDNA: 164 bpgenomic: 11,591
Reverse (259,21)CCCATGTCGTCTTCTACTCTGNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.878 kcal/mol in 3' area
Forward Dimers-0.458 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.967 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceAACGCATCCACCTAACTGGCTGACGCTACACCTTGGTCTTTCCGGGTCCTTGCACGCTTC
GCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGCTGAACAGGAA
CAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)16496 - 259
NM_001163509 (DCAF4)16496 - 259
NM_015604 (DCAF4)16496 - 259
NM_001163508 (DCAF4)16496 - 259
Exon 1 To Exon 2 (Pair 17)
Forward (95,21)AAACGCATCCACCTAACTGGCAmplicon SizecDNA: 164 bpgenomic: 11,591
Reverse (258,21)CCATGTCGTCTTCTACTCTGCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.878 kcal/mol in 3' area
Forward Dimers-0.458 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.967 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceAAACGCATCCACCTAACTGGCTGACGCTACACCTTGGTCTTTCCGGGTCCTTGCACGCTT
CGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGCTGAACAGGA
ACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)16495 - 258
NM_001163508 (DCAF4)16495 - 258
NM_015604 (DCAF4)16495 - 258
NM_001163509 (DCAF4)16495 - 258
Exon 1 To Exon 2 (Pair 18)
Forward (130,20)GGTCTTTCCGGGTCCTTGCAAmplicon SizecDNA: 139 bpgenomic: 11,566
Reverse (268,21)GCTTCTTCTCCCATGTCGTCTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.691 kcal/mol
Forward Dimers-2.596 kcal/mol
Reverse Loops2.175 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.391 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceGGTCTTTCCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAA
TCCGGAAGGGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAG
ACGACATGGGAGAAGAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)139130 - 268
NM_001163508 (DCAF4)139130 - 268
NM_015604 (DCAF4)139130 - 268
NM_001163509 (DCAF4)139130 - 268
Exon 1 To Exon 2 (Pair 19)
Forward (142,20)TCCTTGCACGCTTCGCTCCAAmplicon SizecDNA: 122 bpgenomic: 11,549
Reverse (263,22)TTCTCCCATGTCGTCTTCTACTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGAC
ACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAG
AA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)122142 - 263
NM_001163508 (DCAF4)122142 - 263
NM_001163509 (DCAF4)122142 - 263
NM_015604 (DCAF4)122142 - 263
Exon 1 To Exon 2 (Pair 20)
Forward (139,19)GGGTCCTTGCACGCTTCGCAmplicon SizecDNA: 141 bpgenomic: 11,568
Reverse (279,21)TTCTGCTGGTGGCTTCTTCTCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol in 3' area
Forward Dimers-1.266 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.986 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGG
GACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGG
GAGAAGAAGCCACCAGCAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163508 (DCAF4)141139 - 279
NM_001163509 (DCAF4)141139 - 279
NM_015604 (DCAF4)141139 - 279
NM_181341 (DCAF4)141139 - 279
Exon 1 To Exon 2 (Pair 21)
Forward (96,21)AACGCATCCACCTAACTGGCTAmplicon SizecDNA: 162 bpgenomic: 11,589
Reverse (257,21)CATGTCGTCTTCTACTCTGCCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.878 kcal/mol in 3' area
Forward Dimers-0.458 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers0.136 kcal/mol in 3' area
Forward-Reverse Dimers-1.967 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceAACGCATCCACCTAACTGGCTGACGCTACACCTTGGTCTTTCCGGGTCCTTGCACGCTTC
GCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGCTGAACAGGAA
CAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)16296 - 257
NM_015604 (DCAF4)16296 - 257
NM_001163509 (DCAF4)16296 - 257
NM_001163508 (DCAF4)16296 - 257
Exon 1 To Exon 2 (Pair 22)
Forward (139,19)GGGTCCTTGCACGCTTCGCAmplicon SizecDNA: 138 bpgenomic: 11,565
Reverse (276,20)TGCTGGTGGCTTCTTCTCCCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol in 3' area
Forward Dimers-1.266 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.986 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGG
GACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGG
GAGAAGAAGCCACCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)138139 - 276
NM_015604 (DCAF4)138139 - 276
NM_001163509 (DCAF4)138139 - 276
NM_001163508 (DCAF4)138139 - 276
Exon 1 To Exon 2 (Pair 23)
Forward (138,19)CGGGTCCTTGCACGCTTCGAmplicon SizecDNA: 126 bpgenomic: 11,553
Reverse (263,22)TTCTCCCATGTCGTCTTCTACTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.141 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAG
GGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATG
GGAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163509 (DCAF4)126138 - 263
NM_015604 (DCAF4)126138 - 263
NM_001163508 (DCAF4)126138 - 263
NM_181341 (DCAF4)126138 - 263
Exon 1 To Exon 2 (Pair 24)
Forward (143,20)CCTTGCACGCTTCGCTCCAAAmplicon SizecDNA: 123 bpgenomic: 11,550
Reverse (265,22)TCTTCTCCCATGTCGTCTTCTANr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACA
CGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGA
AGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)123143 - 265
NM_001163508 (DCAF4)123143 - 265
NM_001163509 (DCAF4)123143 - 265
NM_015604 (DCAF4)123143 - 265
Exon 1 To Exon 2 (Pair 25)
Forward (95,21)AAACGCATCCACCTAACTGGCAmplicon SizecDNA: 167 bpgenomic: 11,594
Reverse (261,21)CTCCCATGTCGTCTTCTACTCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.878 kcal/mol in 3' area
Forward Dimers-0.458 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.967 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceAAACGCATCCACCTAACTGGCTGACGCTACACCTTGGTCTTTCCGGGTCCTTGCACGCTT
CGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGCTGAACAGGA
ACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163508 (DCAF4)16795 - 261
NM_015604 (DCAF4)16795 - 261
NM_001163509 (DCAF4)16795 - 261
NM_181341 (DCAF4)16795 - 261
Exon 1 To Exon 2 (Pair 26)
Forward (144,20)CTTGCACGCTTCGCTCCAACAmplicon SizecDNA: 116 bpgenomic: 11,543
Reverse (259,21)CCCATGTCGTCTTCTACTCTGNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACAC
GCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)116144 - 259
NM_001163508 (DCAF4)116144 - 259
NM_015604 (DCAF4)116144 - 259
NM_001163509 (DCAF4)116144 - 259
Exon 1 To Exon 2 (Pair 27)
Forward (129,20)TGGTCTTTCCGGGTCCTTGCAmplicon SizecDNA: 130 bpgenomic: 11,557
Reverse (258,21)CCATGTCGTCTTCTACTCTGCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.245 kcal/mol
Forward Dimers-2.596 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-0.27 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceTGGTCTTTCCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGA
ATCCGGAAGGGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAA
GACGACATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)130129 - 258
NM_001163509 (DCAF4)130129 - 258
NM_015604 (DCAF4)130129 - 258
NM_001163508 (DCAF4)130129 - 258
Exon 1 To Exon 2 (Pair 28)
Forward (146,20)TGCACGCTTCGCTCCAACTCAmplicon SizecDNA: 132 bpgenomic: 11,559
Reverse (277,20)CTGCTGGTGGCTTCTTCTCCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.124 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.986 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGC
TGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGAAGA
AGCCACCAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)132146 - 277
NM_001163508 (DCAF4)132146 - 277
NM_001163509 (DCAF4)132146 - 277
NM_015604 (DCAF4)132146 - 277
Exon 1 To Exon 2 (Pair 29)
Forward (138,19)CGGGTCCTTGCACGCTTCGAmplicon SizecDNA: 128 bpgenomic: 11,555
Reverse (265,22)TCTTCTCCCATGTCGTCTTCTANr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.141 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAG
GGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATG
GGAGAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)128138 - 265
NM_001163508 (DCAF4)128138 - 265
NM_015604 (DCAF4)128138 - 265
NM_001163509 (DCAF4)128138 - 265
Exon 1 To Exon 2 (Pair 30)
Forward (135,20)TTCCGGGTCCTTGCACGCTTAmplicon SizecDNA: 146 bpgenomic: 11,573
Reverse (280,21)GTTCTGCTGGTGGCTTCTTCTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.93 kcal/mol in 3' area
Forward Dimers-2.596 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.986 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceTTCCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGG
AAGGGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGAC
ATGGGAGAAGAAGCCACCAGCAGAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163508 (DCAF4)146135 - 280
NM_001163509 (DCAF4)146135 - 280
NM_015604 (DCAF4)146135 - 280
NM_181341 (DCAF4)146135 - 280
Exon 1 To Exon 2 (Pair 31)
Forward (137,19)CCGGGTCCTTGCACGCTTCAmplicon SizecDNA: 143 bpgenomic: 11,570
Reverse (279,21)TTCTGCTGGTGGCTTCTTCTCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.93 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.986 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAA
GGGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACAT
GGGAGAAGAAGCCACCAGCAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163508 (DCAF4)143137 - 279
NM_015604 (DCAF4)143137 - 279
NM_001163509 (DCAF4)143137 - 279
NM_181341 (DCAF4)143137 - 279
Exon 1 To Exon 2 (Pair 32)
Forward (142,20)TCCTTGCACGCTTCGCTCCAAmplicon SizecDNA: 139 bpgenomic: 11,566
Reverse (280,21)GTTCTGCTGGTGGCTTCTTCTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.986 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGAC
ACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAG
AAGAAGCCACCAGCAGAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163509 (DCAF4)139142 - 280
NM_015604 (DCAF4)139142 - 280
NM_001163508 (DCAF4)139142 - 280
NM_181341 (DCAF4)139142 - 280
Exon 1 To Exon 2 (Pair 33)
Forward (139,19)GGGTCCTTGCACGCTTCGCAmplicon SizecDNA: 125 bpgenomic: 11,552
Reverse (263,22)TTCTCCCATGTCGTCTTCTACTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol in 3' area
Forward Dimers-1.266 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGG
GACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGG
GAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)125139 - 263
NM_001163509 (DCAF4)125139 - 263
NM_015604 (DCAF4)125139 - 263
NM_001163508 (DCAF4)125139 - 263
Exon 1 To Exon 2 (Pair 34)
Forward (130,20)GGTCTTTCCGGGTCCTTGCAAmplicon SizecDNA: 136 bpgenomic: 11,563
Reverse (265,22)TCTTCTCCCATGTCGTCTTCTANr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.691 kcal/mol
Forward Dimers-2.596 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.391 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceGGTCTTTCCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAA
TCCGGAAGGGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAG
ACGACATGGGAGAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)136130 - 265
NM_001163508 (DCAF4)136130 - 265
NM_001163509 (DCAF4)136130 - 265
NM_015604 (DCAF4)136130 - 265
Exon 1 To Exon 2 (Pair 35)
Forward (137,19)CCGGGTCCTTGCACGCTTCAmplicon SizecDNA: 140 bpgenomic: 11,567
Reverse (276,20)TGCTGGTGGCTTCTTCTCCCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.93 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.986 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAA
GGGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACAT
GGGAGAAGAAGCCACCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)140137 - 276
NM_001163509 (DCAF4)140137 - 276
NM_015604 (DCAF4)140137 - 276
NM_001163508 (DCAF4)140137 - 276
Exon 1 To Exon 2 (Pair 36)
Forward (144,20)CTTGCACGCTTCGCTCCAACAmplicon SizecDNA: 133 bpgenomic: 11,560
Reverse (276,20)TGCTGGTGGCTTCTTCTCCCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.986 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACAC
GCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGAA
GAAGCCACCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)133144 - 276
NM_001163508 (DCAF4)133144 - 276
NM_015604 (DCAF4)133144 - 276
NM_001163509 (DCAF4)133144 - 276
Exon 1 To Exon 2 (Pair 37)
Forward (138,19)CGGGTCCTTGCACGCTTCGAmplicon SizecDNA: 129 bpgenomic: 11,556
Reverse (266,22)TTCTTCTCCCATGTCGTCTTCTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.141 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAG
GGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATG
GGAGAAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)129138 - 266
NM_001163508 (DCAF4)129138 - 266
NM_001163509 (DCAF4)129138 - 266
NM_015604 (DCAF4)129138 - 266
Exon 1 To Exon 2 (Pair 38)
Forward (143,20)CCTTGCACGCTTCGCTCCAAAmplicon SizecDNA: 119 bpgenomic: 11,546
Reverse (261,21)CTCCCATGTCGTCTTCTACTCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACA
CGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163508 (DCAF4)119143 - 261
NM_001163509 (DCAF4)119143 - 261
NM_015604 (DCAF4)119143 - 261
NM_181341 (DCAF4)119143 - 261
Exon 1 To Exon 2 (Pair 39)
Forward (138,19)CGGGTCCTTGCACGCTTCGAmplicon SizecDNA: 139 bpgenomic: 11,566
Reverse (276,20)TGCTGGTGGCTTCTTCTCCCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.141 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.986 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAG
GGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATG
GGAGAAGAAGCCACCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163508 (DCAF4)139138 - 276
NM_015604 (DCAF4)139138 - 276
NM_001163509 (DCAF4)139138 - 276
NM_181341 (DCAF4)139138 - 276
Exon 1 To Exon 2 (Pair 40)
Forward (143,20)CCTTGCACGCTTCGCTCCAAAmplicon SizecDNA: 121 bpgenomic: 11,548
Reverse (263,22)TTCTCCCATGTCGTCTTCTACTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACA
CGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGA
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)121143 - 263
NM_001163508 (DCAF4)121143 - 263
NM_001163509 (DCAF4)121143 - 263
NM_015604 (DCAF4)121143 - 263
Exon 1 To Exon 2 (Pair 41)
Forward (143,20)CCTTGCACGCTTCGCTCCAAAmplicon SizecDNA: 124 bpgenomic: 11,551
Reverse (266,22)TTCTTCTCCCATGTCGTCTTCTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACA
CGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGA
AGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)124143 - 266
NM_001163508 (DCAF4)124143 - 266
NM_001163509 (DCAF4)124143 - 266
NM_015604 (DCAF4)124143 - 266
Exon 1 To Exon 2 (Pair 42)
Forward (143,20)CCTTGCACGCTTCGCTCCAAAmplicon SizecDNA: 116 bpgenomic: 11,543
Reverse (258,21)CCATGTCGTCTTCTACTCTGCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACA
CGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)116143 - 258
NM_015604 (DCAF4)116143 - 258
NM_001163509 (DCAF4)116143 - 258
NM_001163508 (DCAF4)116143 - 258
Exon 1 To Exon 2 (Pair 43)
Forward (146,20)TGCACGCTTCGCTCCAACTCAmplicon SizecDNA: 112 bpgenomic: 11,539
Reverse (257,21)CATGTCGTCTTCTACTCTGCCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.124 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers0.136 kcal/mol in 3' area
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGC
TGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163509 (DCAF4)112146 - 257
NM_015604 (DCAF4)112146 - 257
NM_001163508 (DCAF4)112146 - 257
NM_181341 (DCAF4)112146 - 257
Exon 1 To Exon 2 (Pair 44)
Forward (139,19)GGGTCCTTGCACGCTTCGCAmplicon SizecDNA: 123 bpgenomic: 11,550
Reverse (261,21)CTCCCATGTCGTCTTCTACTCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol in 3' area
Forward Dimers-1.266 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGG
GACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGG
GAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)123139 - 261
NM_001163509 (DCAF4)123139 - 261
NM_015604 (DCAF4)123139 - 261
NM_001163508 (DCAF4)123139 - 261
Exon 1 To Exon 2 (Pair 45)
Forward (142,20)TCCTTGCACGCTTCGCTCCAAmplicon SizecDNA: 118 bpgenomic: 11,545
Reverse (259,21)CCCATGTCGTCTTCTACTCTGNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGAC
ACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)118142 - 259
NM_001163508 (DCAF4)118142 - 259
NM_015604 (DCAF4)118142 - 259
NM_001163509 (DCAF4)118142 - 259
Exon 1 To Exon 2 (Pair 46)
Forward (138,19)CGGGTCCTTGCACGCTTCGAmplicon SizecDNA: 122 bpgenomic: 11,549
Reverse (259,21)CCCATGTCGTCTTCTACTCTGNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.141 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAG
GGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATG
GG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)122138 - 259
NM_001163508 (DCAF4)122138 - 259
NM_001163509 (DCAF4)122138 - 259
NM_015604 (DCAF4)122138 - 259
Exon 1 To Exon 2 (Pair 47)
Forward (131,20)GTCTTTCCGGGTCCTTGCACAmplicon SizecDNA: 140 bpgenomic: 11,567
Reverse (270,21)TGGCTTCTTCTCCCATGTCGTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops2.567 kcal/mol in 3' area
Forward Dimers-2.596 kcal/mol
Reverse Loops1.827 kcal/mol
Reverse Dimers-0.205 kcal/mol
Forward-Reverse Dimers-1.391 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceGTCTTTCCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAAT
CCGGAAGGGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGA
CGACATGGGAGAAGAAGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)140131 - 270
NM_001163508 (DCAF4)140131 - 270
NM_015604 (DCAF4)140131 - 270
NM_001163509 (DCAF4)140131 - 270
Exon 1 To Exon 2 (Pair 48)
Forward (139,19)GGGTCCTTGCACGCTTCGCAmplicon SizecDNA: 121 bpgenomic: 11,548
Reverse (259,21)CCCATGTCGTCTTCTACTCTGNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol in 3' area
Forward Dimers-1.266 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGG
GACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGG
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)121139 - 259
NM_001163508 (DCAF4)121139 - 259
NM_015604 (DCAF4)121139 - 259
NM_001163509 (DCAF4)121139 - 259
Exon 1 To Exon 2 (Pair 49)
Forward (149,20)ACGCTTCGCTCCAACTCCTGAmplicon SizecDNA: 111 bpgenomic: 11,538
Reverse (259,21)CCCATGTCGTCTTCTACTCTGNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.426 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGCTGA
ACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)111149 - 259
NM_001163509 (DCAF4)111149 - 259
NM_015604 (DCAF4)111149 - 259
NM_001163508 (DCAF4)111149 - 259
Exon 1 To Exon 2 (Pair 50)
Forward (95,21)AAACGCATCCACCTAACTGGCAmplicon SizecDNA: 172 bpgenomic: 11,599
Reverse (266,22)TTCTTCTCCCATGTCGTCTTCTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.878 kcal/mol in 3' area
Forward Dimers-0.458 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.967 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceAAACGCATCCACCTAACTGGCTGACGCTACACCTTGGTCTTTCCGGGTCCTTGCACGCTT
CGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGCTGAACAGGA
ACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGAAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)17295 - 266
NM_015604 (DCAF4)17295 - 266
NM_001163509 (DCAF4)17295 - 266
NM_001163508 (DCAF4)17295 - 266
Exon 1 To Exon 2 (Pair 51)
Forward (149,20)ACGCTTCGCTCCAACTCCTGAmplicon SizecDNA: 132 bpgenomic: 11,559
Reverse (280,21)GTTCTGCTGGTGGCTTCTTCTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.828 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGCTGA
ACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGAAGAAGC
CACCAGCAGAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163508 (DCAF4)132149 - 280
NM_001163509 (DCAF4)132149 - 280
NM_015604 (DCAF4)132149 - 280
NM_181341 (DCAF4)132149 - 280
Exon 1 To Exon 2 (Pair 52)
Forward (135,20)TTCCGGGTCCTTGCACGCTTAmplicon SizecDNA: 142 bpgenomic: 11,569
Reverse (276,20)TGCTGGTGGCTTCTTCTCCCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.93 kcal/mol in 3' area
Forward Dimers-2.596 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.986 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceTTCCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGG
AAGGGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGAC
ATGGGAGAAGAAGCCACCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)142135 - 276
NM_001163508 (DCAF4)142135 - 276
NM_015604 (DCAF4)142135 - 276
NM_001163509 (DCAF4)142135 - 276
Exon 1 To Exon 2 (Pair 53)
Forward (146,20)TGCACGCTTCGCTCCAACTCAmplicon SizecDNA: 120 bpgenomic: 11,547
Reverse (265,22)TCTTCTCCCATGTCGTCTTCTANr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.124 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGC
TGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)120146 - 265
NM_015604 (DCAF4)120146 - 265
NM_001163509 (DCAF4)120146 - 265
NM_001163508 (DCAF4)120146 - 265
Exon 1 To Exon 2 (Pair 54)
Forward (192,20)CGGAAGGGACACGCTGAACAAmplicon SizecDNA: 75 bpgenomic: 11,502
Reverse (266,22)TTCTTCTCCCATGTCGTCTTCTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol in 3' area
Forward Dimers-0.458 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-2.454 kcal/mol
Amplicon Folding-0.022 kcal/mol outside primersite
Amplicon SequenceCGGAAGGGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGAC
GACATGGGAGAAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)75192 - 266
NM_001163509 (DCAF4)75192 - 266
NM_015604 (DCAF4)75192 - 266
NM_001163508 (DCAF4)75192 - 266
Exon 1 To Exon 2 (Pair 55)
Forward (144,20)CTTGCACGCTTCGCTCCAACAmplicon SizecDNA: 120 bpgenomic: 11,547
Reverse (263,22)TTCTCCCATGTCGTCTTCTACTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACAC
GCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015604 (DCAF4)120144 - 263
NM_001163509 (DCAF4)120144 - 263
NM_001163508 (DCAF4)120144 - 263
NM_181341 (DCAF4)120144 - 263
Exon 1 To Exon 2 (Pair 56)
Forward (137,19)CCGGGTCCTTGCACGCTTCAmplicon SizecDNA: 144 bpgenomic: 11,571
Reverse (280,21)GTTCTGCTGGTGGCTTCTTCTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.93 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.986 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAA
GGGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACAT
GGGAGAAGAAGCCACCAGCAGAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)144137 - 280
NM_001163508 (DCAF4)144137 - 280
NM_015604 (DCAF4)144137 - 280
NM_001163509 (DCAF4)144137 - 280
Exon 1 To Exon 2 (Pair 57)
Forward (130,20)GGTCTTTCCGGGTCCTTGCAAmplicon SizecDNA: 134 bpgenomic: 11,561
Reverse (263,22)TTCTCCCATGTCGTCTTCTACTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.691 kcal/mol
Forward Dimers-2.596 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.391 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceGGTCTTTCCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAA
TCCGGAAGGGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAG
ACGACATGGGAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)134130 - 263
NM_001163508 (DCAF4)134130 - 263
NM_015604 (DCAF4)134130 - 263
NM_001163509 (DCAF4)134130 - 263
Exon 1 To Exon 2 (Pair 58)
Forward (144,20)CTTGCACGCTTCGCTCCAACAmplicon SizecDNA: 122 bpgenomic: 11,549
Reverse (265,22)TCTTCTCCCATGTCGTCTTCTANr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACAC
GCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGAA
GA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)122144 - 265
NM_001163509 (DCAF4)122144 - 265
NM_015604 (DCAF4)122144 - 265
NM_001163508 (DCAF4)122144 - 265
Exon 1 To Exon 2 (Pair 59)
Forward (139,19)GGGTCCTTGCACGCTTCGCAmplicon SizecDNA: 120 bpgenomic: 11,547
Reverse (258,21)CCATGTCGTCTTCTACTCTGCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol in 3' area
Forward Dimers-1.266 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGG
GACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015604 (DCAF4)120139 - 258
NM_001163509 (DCAF4)120139 - 258
NM_001163508 (DCAF4)120139 - 258
NM_181341 (DCAF4)120139 - 258
Exon 1 To Exon 2 (Pair 60)
Forward (139,19)GGGTCCTTGCACGCTTCGCAmplicon SizecDNA: 128 bpgenomic: 11,555
Reverse (266,22)TTCTTCTCCCATGTCGTCTTCTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol in 3' area
Forward Dimers-1.266 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGG
GACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGG
GAGAAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)128139 - 266
NM_015604 (DCAF4)128139 - 266
NM_001163509 (DCAF4)128139 - 266
NM_001163508 (DCAF4)128139 - 266
Exon 1 To Exon 2 (Pair 61)
Forward (149,20)ACGCTTCGCTCCAACTCCTGAmplicon SizecDNA: 109 bpgenomic: 11,536
Reverse (257,21)CATGTCGTCTTCTACTCTGCCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers0.136 kcal/mol in 3' area
Forward-Reverse Dimers-1.426 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGCTGA
ACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)109149 - 257
NM_001163508 (DCAF4)109149 - 257
NM_015604 (DCAF4)109149 - 257
NM_001163509 (DCAF4)109149 - 257
Exon 1 To Exon 2 (Pair 62)
Forward (95,21)AAACGCATCCACCTAACTGGCAmplicon SizecDNA: 171 bpgenomic: 11,598
Reverse (265,22)TCTTCTCCCATGTCGTCTTCTANr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.878 kcal/mol in 3' area
Forward Dimers-0.458 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.967 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceAAACGCATCCACCTAACTGGCTGACGCTACACCTTGGTCTTTCCGGGTCCTTGCACGCTT
CGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGCTGAACAGGA
ACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163508 (DCAF4)17195 - 265
NM_001163509 (DCAF4)17195 - 265
NM_015604 (DCAF4)17195 - 265
NM_181341 (DCAF4)17195 - 265
Exon 1 To Exon 2 (Pair 63)
Forward (146,20)TGCACGCTTCGCTCCAACTCAmplicon SizecDNA: 134 bpgenomic: 11,561
Reverse (279,21)TTCTGCTGGTGGCTTCTTCTCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.124 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.986 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGC
TGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGAAGA
AGCCACCAGCAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)134146 - 279
NM_001163508 (DCAF4)134146 - 279
NM_001163509 (DCAF4)134146 - 279
NM_015604 (DCAF4)134146 - 279
Exon 1 To Exon 2 (Pair 64)
Forward (129,20)TGGTCTTTCCGGGTCCTTGCAmplicon SizecDNA: 140 bpgenomic: 11,567
Reverse (268,21)GCTTCTTCTCCCATGTCGTCTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.245 kcal/mol
Forward Dimers-2.596 kcal/mol
Reverse Loops2.175 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.391 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceTGGTCTTTCCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGA
ATCCGGAAGGGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAA
GACGACATGGGAGAAGAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163508 (DCAF4)140129 - 268
NM_015604 (DCAF4)140129 - 268
NM_001163509 (DCAF4)140129 - 268
NM_181341 (DCAF4)140129 - 268
Exon 1 To Exon 2 (Pair 65)
Forward (149,20)ACGCTTCGCTCCAACTCCTGAmplicon SizecDNA: 131 bpgenomic: 11,558
Reverse (279,21)TTCTGCTGGTGGCTTCTTCTCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.828 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGCTGA
ACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGAAGAAGC
CACCAGCAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163508 (DCAF4)131149 - 279
NM_015604 (DCAF4)131149 - 279
NM_001163509 (DCAF4)131149 - 279
NM_181341 (DCAF4)131149 - 279
Exon 1 To Exon 2 (Pair 66)
Forward (146,20)TGCACGCTTCGCTCCAACTCAmplicon SizecDNA: 135 bpgenomic: 11,562
Reverse (280,21)GTTCTGCTGGTGGCTTCTTCTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.124 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.986 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGC
TGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGAAGA
AGCCACCAGCAGAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163508 (DCAF4)135146 - 280
NM_015604 (DCAF4)135146 - 280
NM_001163509 (DCAF4)135146 - 280
NM_181341 (DCAF4)135146 - 280
Exon 1 To Exon 2 (Pair 67)
Forward (129,20)TGGTCTTTCCGGGTCCTTGCAmplicon SizecDNA: 152 bpgenomic: 11,579
Reverse (280,21)GTTCTGCTGGTGGCTTCTTCTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.245 kcal/mol
Forward Dimers-2.596 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.369 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceTGGTCTTTCCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGA
ATCCGGAAGGGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAA
GACGACATGGGAGAAGAAGCCACCAGCAGAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)152129 - 280
NM_001163508 (DCAF4)152129 - 280
NM_001163509 (DCAF4)152129 - 280
NM_015604 (DCAF4)152129 - 280
Exon 1 To Exon 2 (Pair 68)
Forward (129,20)TGGTCTTTCCGGGTCCTTGCAmplicon SizecDNA: 131 bpgenomic: 11,558
Reverse (259,21)CCCATGTCGTCTTCTACTCTGNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.245 kcal/mol
Forward Dimers-2.596 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.086 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceTGGTCTTTCCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGA
ATCCGGAAGGGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAA
GACGACATGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)131129 - 259
NM_001163508 (DCAF4)131129 - 259
NM_001163509 (DCAF4)131129 - 259
NM_015604 (DCAF4)131129 - 259
Exon 1 To Exon 2 (Pair 69)
Forward (142,20)TCCTTGCACGCTTCGCTCCAAmplicon SizecDNA: 125 bpgenomic: 11,552
Reverse (266,22)TTCTTCTCCCATGTCGTCTTCTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGAC
ACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAG
AAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163509 (DCAF4)125142 - 266
NM_015604 (DCAF4)125142 - 266
NM_001163508 (DCAF4)125142 - 266
NM_181341 (DCAF4)125142 - 266
Exon 1 To Exon 2 (Pair 70)
Forward (148,20)CACGCTTCGCTCCAACTCCTAmplicon SizecDNA: 116 bpgenomic: 11,543
Reverse (263,22)TTCTCCCATGTCGTCTTCTACTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGCTG
AACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163508 (DCAF4)116148 - 263
NM_015604 (DCAF4)116148 - 263
NM_001163509 (DCAF4)116148 - 263
NM_181341 (DCAF4)116148 - 263
Exon 1 To Exon 2 (Pair 71)
Forward (130,20)GGTCTTTCCGGGTCCTTGCAAmplicon SizecDNA: 141 bpgenomic: 11,568
Reverse (270,21)TGGCTTCTTCTCCCATGTCGTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.691 kcal/mol
Forward Dimers-2.596 kcal/mol
Reverse Loops1.827 kcal/mol
Reverse Dimers-0.205 kcal/mol
Forward-Reverse Dimers-1.391 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceGGTCTTTCCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAA
TCCGGAAGGGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAG
ACGACATGGGAGAAGAAGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)141130 - 270
NM_015604 (DCAF4)141130 - 270
NM_001163509 (DCAF4)141130 - 270
NM_001163508 (DCAF4)141130 - 270
Exon 1 To Exon 2 (Pair 72)
Forward (135,20)TTCCGGGTCCTTGCACGCTTAmplicon SizecDNA: 143 bpgenomic: 11,570
Reverse (277,20)CTGCTGGTGGCTTCTTCTCCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.93 kcal/mol in 3' area
Forward Dimers-2.596 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.986 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceTTCCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGG
AAGGGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGAC
ATGGGAGAAGAAGCCACCAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)143135 - 277
NM_001163509 (DCAF4)143135 - 277
NM_015604 (DCAF4)143135 - 277
NM_001163508 (DCAF4)143135 - 277
Exon 1 To Exon 2 (Pair 73)
Forward (95,21)AAACGCATCCACCTAACTGGCAmplicon SizecDNA: 163 bpgenomic: 11,590
Reverse (257,21)CATGTCGTCTTCTACTCTGCCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.878 kcal/mol in 3' area
Forward Dimers-0.458 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers0.136 kcal/mol in 3' area
Forward-Reverse Dimers-1.967 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceAAACGCATCCACCTAACTGGCTGACGCTACACCTTGGTCTTTCCGGGTCCTTGCACGCTT
CGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGCTGAACAGGA
ACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)16395 - 257
NM_001163509 (DCAF4)16395 - 257
NM_015604 (DCAF4)16395 - 257
NM_001163508 (DCAF4)16395 - 257
Exon 1 To Exon 2 (Pair 74)
Forward (146,20)TGCACGCTTCGCTCCAACTCAmplicon SizecDNA: 113 bpgenomic: 11,540
Reverse (258,21)CCATGTCGTCTTCTACTCTGCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.124 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGC
TGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163508 (DCAF4)113146 - 258
NM_001163509 (DCAF4)113146 - 258
NM_015604 (DCAF4)113146 - 258
NM_181341 (DCAF4)113146 - 258
Exon 1 To Exon 2 (Pair 75)
Forward (149,20)ACGCTTCGCTCCAACTCCTGAmplicon SizecDNA: 128 bpgenomic: 11,555
Reverse (276,20)TGCTGGTGGCTTCTTCTCCCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.828 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGCTGA
ACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGAAGAAGC
CACCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163508 (DCAF4)128149 - 276
NM_015604 (DCAF4)128149 - 276
NM_001163509 (DCAF4)128149 - 276
NM_181341 (DCAF4)128149 - 276
Exon 1 To Exon 2 (Pair 76)
Forward (192,20)CGGAAGGGACACGCTGAACAAmplicon SizecDNA: 74 bpgenomic: 11,501
Reverse (265,22)TCTTCTCCCATGTCGTCTTCTANr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol in 3' area
Forward Dimers-0.458 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-2.454 kcal/mol
Amplicon Folding-0.022 kcal/mol outside primersite
Amplicon SequenceCGGAAGGGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGAC
GACATGGGAGAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163508 (DCAF4)74192 - 265
NM_015604 (DCAF4)74192 - 265
NM_001163509 (DCAF4)74192 - 265
NM_181341 (DCAF4)74192 - 265
Exon 1 To Exon 2 (Pair 77)
Forward (148,20)CACGCTTCGCTCCAACTCCTAmplicon SizecDNA: 112 bpgenomic: 11,539
Reverse (259,21)CCCATGTCGTCTTCTACTCTGNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGCTG
AACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)112148 - 259
NM_001163508 (DCAF4)112148 - 259
NM_015604 (DCAF4)112148 - 259
NM_001163509 (DCAF4)112148 - 259
Exon 1 To Exon 2 (Pair 78)
Forward (96,21)AACGCATCCACCTAACTGGCTAmplicon SizecDNA: 163 bpgenomic: 11,590
Reverse (258,21)CCATGTCGTCTTCTACTCTGCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.878 kcal/mol in 3' area
Forward Dimers-0.458 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.967 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceAACGCATCCACCTAACTGGCTGACGCTACACCTTGGTCTTTCCGGGTCCTTGCACGCTTC
GCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGCTGAACAGGAA
CAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)16396 - 258
NM_001163508 (DCAF4)16396 - 258
NM_015604 (DCAF4)16396 - 258
NM_001163509 (DCAF4)16396 - 258
Exon 1 To Exon 2 (Pair 79)
Forward (139,19)GGGTCCTTGCACGCTTCGCAmplicon SizecDNA: 127 bpgenomic: 11,554
Reverse (265,22)TCTTCTCCCATGTCGTCTTCTANr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol in 3' area
Forward Dimers-1.266 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGG
GACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGG
GAGAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)127139 - 265
NM_015604 (DCAF4)127139 - 265
NM_001163509 (DCAF4)127139 - 265
NM_001163508 (DCAF4)127139 - 265
Exon 1 To Exon 2 (Pair 80)
Forward (131,20)GTCTTTCCGGGTCCTTGCACAmplicon SizecDNA: 129 bpgenomic: 11,556
Reverse (259,21)CCCATGTCGTCTTCTACTCTGNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops2.567 kcal/mol in 3' area
Forward Dimers-2.596 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.086 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceGTCTTTCCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAAT
CCGGAAGGGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGA
CGACATGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)129131 - 259
NM_001163509 (DCAF4)129131 - 259
NM_015604 (DCAF4)129131 - 259
NM_001163508 (DCAF4)129131 - 259
Exon 1 To Exon 2 (Pair 81)
Forward (144,20)CTTGCACGCTTCGCTCCAACAmplicon SizecDNA: 137 bpgenomic: 11,564
Reverse (280,21)GTTCTGCTGGTGGCTTCTTCTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.986 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACAC
GCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGAA
GAAGCCACCAGCAGAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163508 (DCAF4)137144 - 280
NM_015604 (DCAF4)137144 - 280
NM_001163509 (DCAF4)137144 - 280
NM_181341 (DCAF4)137144 - 280
Exon 1 To Exon 2 (Pair 82)
Forward (138,19)CGGGTCCTTGCACGCTTCGAmplicon SizecDNA: 143 bpgenomic: 11,570
Reverse (280,21)GTTCTGCTGGTGGCTTCTTCTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.141 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.986 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAG
GGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATG
GGAGAAGAAGCCACCAGCAGAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015604 (DCAF4)143138 - 280
NM_001163509 (DCAF4)143138 - 280
NM_001163508 (DCAF4)143138 - 280
NM_181341 (DCAF4)143138 - 280
Exon 1 To Exon 2 (Pair 83)
Forward (192,20)CGGAAGGGACACGCTGAACAAmplicon SizecDNA: 72 bpgenomic: 11,499
Reverse (263,22)TTCTCCCATGTCGTCTTCTACTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol in 3' area
Forward Dimers-0.458 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-2.454 kcal/mol
Amplicon Folding-0.022 kcal/mol outside primersite
Amplicon SequenceCGGAAGGGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGAC
GACATGGGAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)72192 - 263
NM_015604 (DCAF4)72192 - 263
NM_001163509 (DCAF4)72192 - 263
NM_001163508 (DCAF4)72192 - 263
Exon 1 To Exon 2 (Pair 84)
Forward (144,20)CTTGCACGCTTCGCTCCAACAmplicon SizecDNA: 136 bpgenomic: 11,563
Reverse (279,21)TTCTGCTGGTGGCTTCTTCTCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.986 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACAC
GCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGAA
GAAGCCACCAGCAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015604 (DCAF4)136144 - 279
NM_001163509 (DCAF4)136144 - 279
NM_001163508 (DCAF4)136144 - 279
NM_181341 (DCAF4)136144 - 279
Exon 1 To Exon 2 (Pair 85)
Forward (130,20)GGTCTTTCCGGGTCCTTGCAAmplicon SizecDNA: 130 bpgenomic: 11,557
Reverse (259,21)CCCATGTCGTCTTCTACTCTGNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.691 kcal/mol
Forward Dimers-2.596 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.086 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceGGTCTTTCCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAA
TCCGGAAGGGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAG
ACGACATGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)130130 - 259
NM_001163508 (DCAF4)130130 - 259
NM_015604 (DCAF4)130130 - 259
NM_001163509 (DCAF4)130130 - 259
Exon 1 To Exon 2 (Pair 86)
Forward (148,20)CACGCTTCGCTCCAACTCCTAmplicon SizecDNA: 133 bpgenomic: 11,560
Reverse (280,21)GTTCTGCTGGTGGCTTCTTCTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.828 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGCTG
AACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGAAGAAG
CCACCAGCAGAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163508 (DCAF4)133148 - 280
NM_001163509 (DCAF4)133148 - 280
NM_015604 (DCAF4)133148 - 280
NM_181341 (DCAF4)133148 - 280
Exon 1 To Exon 2 (Pair 87)
Forward (138,19)CGGGTCCTTGCACGCTTCGAmplicon SizecDNA: 142 bpgenomic: 11,569
Reverse (279,21)TTCTGCTGGTGGCTTCTTCTCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.141 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.986 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAG
GGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATG
GGAGAAGAAGCCACCAGCAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)142138 - 279
NM_001163508 (DCAF4)142138 - 279
NM_015604 (DCAF4)142138 - 279
NM_001163509 (DCAF4)142138 - 279
Exon 1 To Exon 2 (Pair 88)
Forward (95,21)AAACGCATCCACCTAACTGGCAmplicon SizecDNA: 169 bpgenomic: 11,596
Reverse (263,22)TTCTCCCATGTCGTCTTCTACTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.878 kcal/mol in 3' area
Forward Dimers-0.458 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.967 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceAAACGCATCCACCTAACTGGCTGACGCTACACCTTGGTCTTTCCGGGTCCTTGCACGCTT
CGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGCTGAACAGGA
ACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)16995 - 263
NM_015604 (DCAF4)16995 - 263
NM_001163509 (DCAF4)16995 - 263
NM_001163508 (DCAF4)16995 - 263
Exon 1 To Exon 2 (Pair 89)
Forward (95,21)AAACGCATCCACCTAACTGGCAmplicon SizecDNA: 165 bpgenomic: 11,592
Reverse (259,21)CCCATGTCGTCTTCTACTCTGNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.878 kcal/mol in 3' area
Forward Dimers-0.458 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.967 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceAAACGCATCCACCTAACTGGCTGACGCTACACCTTGGTCTTTCCGGGTCCTTGCACGCTT
CGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGCTGAACAGGA
ACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)16595 - 259
NM_015604 (DCAF4)16595 - 259
NM_001163509 (DCAF4)16595 - 259
NM_001163508 (DCAF4)16595 - 259
Exon 1 To Exon 2 (Pair 90)
Forward (138,19)CGGGTCCTTGCACGCTTCGAmplicon SizecDNA: 121 bpgenomic: 11,548
Reverse (258,21)CCATGTCGTCTTCTACTCTGCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.141 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAG
GGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATG
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)121138 - 258
NM_001163508 (DCAF4)121138 - 258
NM_001163509 (DCAF4)121138 - 258
NM_015604 (DCAF4)121138 - 258
Exon 1 To Exon 2 (Pair 91)
Forward (148,20)CACGCTTCGCTCCAACTCCTAmplicon SizecDNA: 129 bpgenomic: 11,556
Reverse (276,20)TGCTGGTGGCTTCTTCTCCCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.828 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGCTG
AACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGAAGAAG
CCACCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163509 (DCAF4)129148 - 276
NM_015604 (DCAF4)129148 - 276
NM_001163508 (DCAF4)129148 - 276
NM_181341 (DCAF4)129148 - 276
Exon 1 To Exon 2 (Pair 92)
Forward (138,19)CGGGTCCTTGCACGCTTCGAmplicon SizecDNA: 133 bpgenomic: 11,560
Reverse (270,21)TGGCTTCTTCTCCCATGTCGTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.141 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops1.827 kcal/mol
Reverse Dimers-0.205 kcal/mol
Forward-Reverse Dimers-1.391 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCGGGTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAG
GGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATG
GGAGAAGAAGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)133138 - 270
NM_001163509 (DCAF4)133138 - 270
NM_015604 (DCAF4)133138 - 270
NM_001163508 (DCAF4)133138 - 270
Exon 1 To Exon 2 (Pair 93)
Forward (142,20)TCCTTGCACGCTTCGCTCCAAmplicon SizecDNA: 124 bpgenomic: 11,551
Reverse (265,22)TCTTCTCCCATGTCGTCTTCTANr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceTCCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGAC
ACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAG
AAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163508 (DCAF4)124142 - 265
NM_015604 (DCAF4)124142 - 265
NM_001163509 (DCAF4)124142 - 265
NM_181341 (DCAF4)124142 - 265
Exon 1 To Exon 2 (Pair 94)
Forward (146,20)TGCACGCTTCGCTCCAACTCAmplicon SizecDNA: 131 bpgenomic: 11,558
Reverse (276,20)TGCTGGTGGCTTCTTCTCCCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.124 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.986 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGC
TGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGAAGA
AGCCACCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001163509 (DCAF4)131146 - 276
NM_015604 (DCAF4)131146 - 276
NM_001163508 (DCAF4)131146 - 276
NM_181341 (DCAF4)131146 - 276
Exon 1 To Exon 2 (Pair 95)
Forward (146,20)TGCACGCTTCGCTCCAACTCAmplicon SizecDNA: 116 bpgenomic: 11,543
Reverse (261,21)CTCCCATGTCGTCTTCTACTCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.124 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGC
TGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)116146 - 261
NM_001163508 (DCAF4)116146 - 261
NM_015604 (DCAF4)116146 - 261
NM_001163509 (DCAF4)116146 - 261
Exon 1 To Exon 2 (Pair 96)
Forward (192,20)CGGAAGGGACACGCTGAACAAmplicon SizecDNA: 79 bpgenomic: 11,506
Reverse (270,21)TGGCTTCTTCTCCCATGTCGTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol in 3' area
Forward Dimers-0.458 kcal/mol
Reverse Loops1.827 kcal/mol
Reverse Dimers-0.205 kcal/mol
Forward-Reverse Dimers-2.454 kcal/mol
Amplicon Folding-0.022 kcal/mol outside primersite
Amplicon SequenceCGGAAGGGACACGCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGAC
GACATGGGAGAAGAAGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015604 (DCAF4)79192 - 270
NM_001163509 (DCAF4)79192 - 270
NM_001163508 (DCAF4)79192 - 270
NM_181341 (DCAF4)79192 - 270
Exon 1 To Exon 2 (Pair 97)
Forward (148,20)CACGCTTCGCTCCAACTCCTAmplicon SizecDNA: 119 bpgenomic: 11,546
Reverse (266,22)TTCTTCTCCCATGTCGTCTTCTNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGCTG
AACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGAAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015604 (DCAF4)119148 - 266
NM_001163509 (DCAF4)119148 - 266
NM_001163508 (DCAF4)119148 - 266
NM_181341 (DCAF4)119148 - 266
Exon 1 To Exon 2 (Pair 98)
Forward (144,20)CTTGCACGCTTCGCTCCAACAmplicon SizecDNA: 134 bpgenomic: 11,561
Reverse (277,20)CTGCTGGTGGCTTCTTCTCCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.986 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCTTGCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACAC
GCTGAACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGAA
GAAGCCACCAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)134144 - 277
NM_001163508 (DCAF4)134144 - 277
NM_015604 (DCAF4)134144 - 277
NM_001163509 (DCAF4)134144 - 277
Exon 1 To Exon 2 (Pair 99)
Forward (148,20)CACGCTTCGCTCCAACTCCTAmplicon SizecDNA: 132 bpgenomic: 11,559
Reverse (279,21)TTCTGCTGGTGGCTTCTTCTCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.828 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceCACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGCTG
AACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGAAGAAG
CCACCAGCAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)132148 - 279
NM_001163509 (DCAF4)132148 - 279
NM_015604 (DCAF4)132148 - 279
NM_001163508 (DCAF4)132148 - 279
Exon 1 To Exon 2 (Pair 100)
Forward (149,20)ACGCTTCGCTCCAACTCCTGAmplicon SizecDNA: 129 bpgenomic: 11,556
Reverse (277,20)CTGCTGGTGGCTTCTTCTCCNr. of Isoforms 4 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-0.828 kcal/mol
Amplicon Folding-2.281 kcal/mol outside primersite
Amplicon SequenceACGCTTCGCTCCAACTCCTGCAGAGCTGAGCCGGAGGGGAATCCGGAAGGGACACGCTGA
ACAGGAACAGAAATGAATAAAAGTCGCTGGCAGAGTAGAAGACGACATGGGAGAAGAAGC
CACCAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_181341 (DCAF4)129149 - 277
NM_001163508 (DCAF4)129149 - 277
NM_001163509 (DCAF4)129149 - 277
NM_015604 (DCAF4)129149 - 277
 

See below for some more details.

Program Output:

Loading ...