Design Results for DENND5B

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 6 To Exon 7 (Pair 1)
Forward (945,22)TCGCCCACTATCCTCAGAATATAmplicon SizecDNA: 211 bpgenomic: 15,765
Reverse (1155,23)GTGCAGATTTGCTTACTTGTAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-0.583 kcal/mol
Reverse Loops0.496 kcal/mol
Reverse Dimers-1.23 kcal/mol
Forward-Reverse Dimers-1.105 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceTCGCCCACTATCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGAACATGT
TGTGCATGCCTAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCCAGTTTC
ACTCATTTATAATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCACTTTTT
ATGAAGAAGTTACAAGTAAGCAAATCTGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)211365 - 575
Exon 6 To Exon 7 (Pair 2)
Forward (940,21)AGTTCTCGCCCACTATCCTCAAmplicon SizecDNA: 216 bpgenomic: 15,770
Reverse (1155,23)GTGCAGATTTGCTTACTTGTAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.215 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops0.496 kcal/mol
Reverse Dimers-1.23 kcal/mol
Forward-Reverse Dimers-1.042 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceAGTTCTCGCCCACTATCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGAA
CATGTTGTGCATGCCTAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCCA
GTTTCACTCATTTATAATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCAC
TTTTTATGAAGAAGTTACAAGTAAGCAAATCTGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)216360 - 575
Exon 6 To Exon 7 (Pair 3)
Forward (940,21)AGTTCTCGCCCACTATCCTCAAmplicon SizecDNA: 222 bpgenomic: 15,776
Reverse (1161,23)ATTGCTGTGCAGATTTGCTTACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.215 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops0.496 kcal/mol
Reverse Dimers-2.921 kcal/mol
Forward-Reverse Dimers-1.042 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceAGTTCTCGCCCACTATCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGAA
CATGTTGTGCATGCCTAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCCA
GTTTCACTCATTTATAATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCAC
TTTTTATGAAGAAGTTACAAGTAAGCAAATCTGCACAGCAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)222360 - 581
Exon 6 To Exon 7 (Pair 4)
Forward (939,21)AAGTTCTCGCCCACTATCCTCAmplicon SizecDNA: 223 bpgenomic: 15,777
Reverse (1161,23)ATTGCTGTGCAGATTTGCTTACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.674 kcal/mol
Forward Dimers-1.265 kcal/mol
Reverse Loops0.496 kcal/mol
Reverse Dimers-2.921 kcal/mol
Forward-Reverse Dimers-1.042 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceAAGTTCTCGCCCACTATCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGA
ACATGTTGTGCATGCCTAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCC
AGTTTCACTCATTTATAATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCA
CTTTTTATGAAGAAGTTACAAGTAAGCAAATCTGCACAGCAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)223359 - 581
Exon 6 To Exon 7 (Pair 5)
Forward (945,22)TCGCCCACTATCCTCAGAATATAmplicon SizecDNA: 206 bpgenomic: 15,760
Reverse (1150,24)GATTTGCTTACTTGTAACTTCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-0.583 kcal/mol
Reverse Loops1.491 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.105 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceTCGCCCACTATCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGAACATGT
TGTGCATGCCTAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCCAGTTTC
ACTCATTTATAATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCACTTTTT
ATGAAGAAGTTACAAGTAAGCAAATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)206365 - 570
Exon 6 To Exon 7 (Pair 6)
Forward (955,23)TCCTCAGAATATAGAATGGAACCAmplicon SizecDNA: 209 bpgenomic: 15,763
Reverse (1163,22)GCATTGCTGTGCAGATTTGCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.686 kcal/mol
Forward Dimers-0.416 kcal/mol
Reverse Loops0.496 kcal/mol in 3' area
Reverse Dimers-2.921 kcal/mol
Forward-Reverse Dimers-1.211 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceTCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGAACATGTTGTGCATGCC
TAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCCAGTTTCACTCATTTAT
AATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCACTTTTTATGAAGAAGT
TACAAGTAAGCAAATCTGCACAGCAATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)209375 - 583
Exon 6 To Exon 7 (Pair 7)
Forward (947,22)GCCCACTATCCTCAGAATATAGAmplicon SizecDNA: 204 bpgenomic: 15,758
Reverse (1150,24)GATTTGCTTACTTGTAACTTCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol
Forward Dimers-0.583 kcal/mol
Reverse Loops1.491 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.105 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceGCCCACTATCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGAACATGTTG
TGCATGCCTAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCCAGTTTCAC
TCATTTATAATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCACTTTTTAT
GAAGAAGTTACAAGTAAGCAAATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)204367 - 570
Exon 6 To Exon 7 (Pair 8)
Forward (940,21)AGTTCTCGCCCACTATCCTCAAmplicon SizecDNA: 211 bpgenomic: 15,765
Reverse (1150,24)GATTTGCTTACTTGTAACTTCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.215 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops1.491 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.45 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceAGTTCTCGCCCACTATCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGAA
CATGTTGTGCATGCCTAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCCA
GTTTCACTCATTTATAATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCAC
TTTTTATGAAGAAGTTACAAGTAAGCAAATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)211360 - 570
Exon 6 To Exon 7 (Pair 9)
Forward (946,22)CGCCCACTATCCTCAGAATATAAmplicon SizecDNA: 210 bpgenomic: 15,764
Reverse (1155,23)GTGCAGATTTGCTTACTTGTAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol
Forward Dimers-0.583 kcal/mol
Reverse Loops0.496 kcal/mol
Reverse Dimers-1.23 kcal/mol
Forward-Reverse Dimers-1.105 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceCGCCCACTATCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGAACATGTT
GTGCATGCCTAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCCAGTTTCA
CTCATTTATAATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCACTTTTTA
TGAAGAAGTTACAAGTAAGCAAATCTGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)210366 - 575
Exon 6 To Exon 7 (Pair 10)
Forward (946,22)CGCCCACTATCCTCAGAATATAAmplicon SizecDNA: 205 bpgenomic: 15,759
Reverse (1150,24)GATTTGCTTACTTGTAACTTCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol
Forward Dimers-0.583 kcal/mol
Reverse Loops1.491 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.105 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceCGCCCACTATCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGAACATGTT
GTGCATGCCTAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCCAGTTTCA
CTCATTTATAATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCACTTTTTA
TGAAGAAGTTACAAGTAAGCAAATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)205366 - 570
Exon 6 To Exon 7 (Pair 11)
Forward (955,23)TCCTCAGAATATAGAATGGAACCAmplicon SizecDNA: 196 bpgenomic: 15,750
Reverse (1150,24)GATTTGCTTACTTGTAACTTCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.686 kcal/mol
Forward Dimers-0.416 kcal/mol
Reverse Loops1.491 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.105 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceTCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGAACATGTTGTGCATGCC
TAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCCAGTTTCACTCATTTAT
AATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCACTTTTTATGAAGAAGT
TACAAGTAAGCAAATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)196375 - 570
Exon 6 To Exon 7 (Pair 12)
Forward (940,21)AGTTCTCGCCCACTATCCTCAAmplicon SizecDNA: 224 bpgenomic: 15,778
Reverse (1163,22)GCATTGCTGTGCAGATTTGCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.215 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops0.496 kcal/mol in 3' area
Reverse Dimers-2.921 kcal/mol
Forward-Reverse Dimers-1.042 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceAGTTCTCGCCCACTATCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGAA
CATGTTGTGCATGCCTAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCCA
GTTTCACTCATTTATAATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCAC
TTTTTATGAAGAAGTTACAAGTAAGCAAATCTGCACAGCAATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)224360 - 583
Exon 6 To Exon 7 (Pair 13)
Forward (945,22)TCGCCCACTATCCTCAGAATATAmplicon SizecDNA: 219 bpgenomic: 15,773
Reverse (1163,22)GCATTGCTGTGCAGATTTGCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-0.583 kcal/mol
Reverse Loops0.496 kcal/mol in 3' area
Reverse Dimers-2.921 kcal/mol
Forward-Reverse Dimers-1.065 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceTCGCCCACTATCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGAACATGT
TGTGCATGCCTAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCCAGTTTC
ACTCATTTATAATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCACTTTTT
ATGAAGAAGTTACAAGTAAGCAAATCTGCACAGCAATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)219365 - 583
Exon 6 To Exon 7 (Pair 14)
Forward (955,23)TCCTCAGAATATAGAATGGAACCAmplicon SizecDNA: 207 bpgenomic: 15,761
Reverse (1161,23)ATTGCTGTGCAGATTTGCTTACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.686 kcal/mol
Forward Dimers-0.416 kcal/mol
Reverse Loops0.496 kcal/mol
Reverse Dimers-2.921 kcal/mol
Forward-Reverse Dimers-1.065 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceTCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGAACATGTTGTGCATGCC
TAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCCAGTTTCACTCATTTAT
AATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCACTTTTTATGAAGAAGT
TACAAGTAAGCAAATCTGCACAGCAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)207375 - 581
Exon 6 To Exon 7 (Pair 15)
Forward (947,22)GCCCACTATCCTCAGAATATAGAmplicon SizecDNA: 215 bpgenomic: 15,769
Reverse (1161,23)ATTGCTGTGCAGATTTGCTTACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol
Forward Dimers-0.583 kcal/mol
Reverse Loops0.496 kcal/mol
Reverse Dimers-2.921 kcal/mol
Forward-Reverse Dimers-1.065 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceGCCCACTATCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGAACATGTTG
TGCATGCCTAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCCAGTTTCAC
TCATTTATAATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCACTTTTTAT
GAAGAAGTTACAAGTAAGCAAATCTGCACAGCAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)215367 - 581
Exon 6 To Exon 7 (Pair 16)
Forward (947,22)GCCCACTATCCTCAGAATATAGAmplicon SizecDNA: 217 bpgenomic: 15,771
Reverse (1163,22)GCATTGCTGTGCAGATTTGCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol
Forward Dimers-0.583 kcal/mol
Reverse Loops0.496 kcal/mol in 3' area
Reverse Dimers-2.921 kcal/mol
Forward-Reverse Dimers-1.065 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceGCCCACTATCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGAACATGTTG
TGCATGCCTAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCCAGTTTCAC
TCATTTATAATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCACTTTTTAT
GAAGAAGTTACAAGTAAGCAAATCTGCACAGCAATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)217367 - 583
Exon 6 To Exon 7 (Pair 17)
Forward (939,21)AAGTTCTCGCCCACTATCCTCAmplicon SizecDNA: 217 bpgenomic: 15,771
Reverse (1155,23)GTGCAGATTTGCTTACTTGTAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.674 kcal/mol
Forward Dimers-1.265 kcal/mol
Reverse Loops0.496 kcal/mol
Reverse Dimers-1.23 kcal/mol
Forward-Reverse Dimers-1.543 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceAAGTTCTCGCCCACTATCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGA
ACATGTTGTGCATGCCTAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCC
AGTTTCACTCATTTATAATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCA
CTTTTTATGAAGAAGTTACAAGTAAGCAAATCTGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)217359 - 575
Exon 6 To Exon 7 (Pair 18)
Forward (946,22)CGCCCACTATCCTCAGAATATAAmplicon SizecDNA: 218 bpgenomic: 15,772
Reverse (1163,22)GCATTGCTGTGCAGATTTGCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol
Forward Dimers-0.583 kcal/mol
Reverse Loops0.496 kcal/mol in 3' area
Reverse Dimers-2.921 kcal/mol
Forward-Reverse Dimers-1.065 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceCGCCCACTATCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGAACATGTT
GTGCATGCCTAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCCAGTTTCA
CTCATTTATAATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCACTTTTTA
TGAAGAAGTTACAAGTAAGCAAATCTGCACAGCAATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)218366 - 583
Exon 6 To Exon 7 (Pair 19)
Forward (946,22)CGCCCACTATCCTCAGAATATAAmplicon SizecDNA: 216 bpgenomic: 15,770
Reverse (1161,23)ATTGCTGTGCAGATTTGCTTACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol
Forward Dimers-0.583 kcal/mol
Reverse Loops0.496 kcal/mol
Reverse Dimers-2.921 kcal/mol
Forward-Reverse Dimers-1.065 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceCGCCCACTATCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGAACATGTT
GTGCATGCCTAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCCAGTTTCA
CTCATTTATAATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCACTTTTTA
TGAAGAAGTTACAAGTAAGCAAATCTGCACAGCAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)216366 - 581
Exon 6 To Exon 7 (Pair 20)
Forward (940,21)AGTTCTCGCCCACTATCCTCAAmplicon SizecDNA: 221 bpgenomic: 15,775
Reverse (1160,23)TTGCTGTGCAGATTTGCTTACTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.215 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops0.496 kcal/mol
Reverse Dimers-2.921 kcal/mol
Forward-Reverse Dimers-1.042 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceAGTTCTCGCCCACTATCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGAA
CATGTTGTGCATGCCTAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCCA
GTTTCACTCATTTATAATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCAC
TTTTTATGAAGAAGTTACAAGTAAGCAAATCTGCACAGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)221360 - 580
Exon 6 To Exon 7 (Pair 21)
Forward (947,22)GCCCACTATCCTCAGAATATAGAmplicon SizecDNA: 209 bpgenomic: 15,763
Reverse (1155,23)GTGCAGATTTGCTTACTTGTAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol
Forward Dimers-0.583 kcal/mol
Reverse Loops0.496 kcal/mol
Reverse Dimers-1.23 kcal/mol
Forward-Reverse Dimers-1.105 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceGCCCACTATCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGAACATGTTG
TGCATGCCTAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCCAGTTTCAC
TCATTTATAATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCACTTTTTAT
GAAGAAGTTACAAGTAAGCAAATCTGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)209367 - 575
Exon 6 To Exon 7 (Pair 22)
Forward (940,21)AGTTCTCGCCCACTATCCTCAAmplicon SizecDNA: 219 bpgenomic: 15,773
Reverse (1158,22)GCTGTGCAGATTTGCTTACTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.215 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops0.496 kcal/mol
Reverse Dimers-2.921 kcal/mol
Forward-Reverse Dimers-1.042 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceAGTTCTCGCCCACTATCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGAA
CATGTTGTGCATGCCTAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCCA
GTTTCACTCATTTATAATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCAC
TTTTTATGAAGAAGTTACAAGTAAGCAAATCTGCACAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)219360 - 578
Exon 6 To Exon 7 (Pair 23)
Forward (951,24)ACTATCCTCAGAATATAGAATGGAAmplicon SizecDNA: 205 bpgenomic: 15,759
Reverse (1155,23)GTGCAGATTTGCTTACTTGTAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.686 kcal/mol in 3' area
Forward Dimers-0.819 kcal/mol
Reverse Loops0.496 kcal/mol
Reverse Dimers-1.23 kcal/mol
Forward-Reverse Dimers-1.105 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceACTATCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGAACATGTTGTGCA
TGCCTAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCCAGTTTCACTCAT
TTATAATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCACTTTTTATGAAG
AAGTTACAAGTAAGCAAATCTGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)205371 - 575
Exon 6 To Exon 7 (Pair 24)
Forward (939,21)AAGTTCTCGCCCACTATCCTCAmplicon SizecDNA: 212 bpgenomic: 15,766
Reverse (1150,24)GATTTGCTTACTTGTAACTTCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.674 kcal/mol
Forward Dimers-1.265 kcal/mol
Reverse Loops1.491 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.991 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceAAGTTCTCGCCCACTATCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGA
ACATGTTGTGCATGCCTAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCC
AGTTTCACTCATTTATAATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCA
CTTTTTATGAAGAAGTTACAAGTAAGCAAATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)212359 - 570
Exon 6 To Exon 7 (Pair 25)
Forward (940,21)AGTTCTCGCCCACTATCCTCAAmplicon SizecDNA: 218 bpgenomic: 15,772
Reverse (1157,23)CTGTGCAGATTTGCTTACTTGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.215 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops0.496 kcal/mol
Reverse Dimers-2.173 kcal/mol
Forward-Reverse Dimers-1.042 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceAGTTCTCGCCCACTATCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGAA
CATGTTGTGCATGCCTAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCCA
GTTTCACTCATTTATAATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCAC
TTTTTATGAAGAAGTTACAAGTAAGCAAATCTGCACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)218360 - 577
Exon 6 To Exon 7 (Pair 26)
Forward (945,22)TCGCCCACTATCCTCAGAATATAmplicon SizecDNA: 217 bpgenomic: 15,771
Reverse (1161,23)ATTGCTGTGCAGATTTGCTTACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-0.583 kcal/mol
Reverse Loops0.496 kcal/mol
Reverse Dimers-2.921 kcal/mol
Forward-Reverse Dimers-1.065 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceTCGCCCACTATCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGAACATGT
TGTGCATGCCTAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCCAGTTTC
ACTCATTTATAATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCACTTTTT
ATGAAGAAGTTACAAGTAAGCAAATCTGCACAGCAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)217365 - 581
Exon 6 To Exon 7 (Pair 27)
Forward (951,24)ACTATCCTCAGAATATAGAATGGAAmplicon SizecDNA: 211 bpgenomic: 15,765
Reverse (1161,23)ATTGCTGTGCAGATTTGCTTACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.686 kcal/mol in 3' area
Forward Dimers-0.819 kcal/mol
Reverse Loops0.496 kcal/mol
Reverse Dimers-2.921 kcal/mol
Forward-Reverse Dimers-1.065 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceACTATCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGAACATGTTGTGCA
TGCCTAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCCAGTTTCACTCAT
TTATAATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCACTTTTTATGAAG
AAGTTACAAGTAAGCAAATCTGCACAGCAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)211371 - 581
Exon 6 To Exon 7 (Pair 28)
Forward (955,23)TCCTCAGAATATAGAATGGAACCAmplicon SizecDNA: 201 bpgenomic: 15,755
Reverse (1155,23)GTGCAGATTTGCTTACTTGTAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.686 kcal/mol
Forward Dimers-0.416 kcal/mol
Reverse Loops0.496 kcal/mol
Reverse Dimers-1.23 kcal/mol
Forward-Reverse Dimers-1.105 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceTCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGAACATGTTGTGCATGCC
TAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCCAGTTTCACTCATTTAT
AATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCACTTTTTATGAAGAAGT
TACAAGTAAGCAAATCTGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)201375 - 575
Exon 6 To Exon 7 (Pair 29)
Forward (951,24)ACTATCCTCAGAATATAGAATGGAAmplicon SizecDNA: 200 bpgenomic: 15,754
Reverse (1150,24)GATTTGCTTACTTGTAACTTCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.686 kcal/mol in 3' area
Forward Dimers-0.819 kcal/mol
Reverse Loops1.491 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.105 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceACTATCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGAACATGTTGTGCA
TGCCTAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCCAGTTTCACTCAT
TTATAATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCACTTTTTATGAAG
AAGTTACAAGTAAGCAAATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)200371 - 570
Exon 6 To Exon 7 (Pair 30)
Forward (939,21)AAGTTCTCGCCCACTATCCTCAmplicon SizecDNA: 225 bpgenomic: 15,779
Reverse (1163,22)GCATTGCTGTGCAGATTTGCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.674 kcal/mol
Forward Dimers-1.265 kcal/mol
Reverse Loops0.496 kcal/mol in 3' area
Reverse Dimers-2.921 kcal/mol
Forward-Reverse Dimers-1.042 kcal/mol
Amplicon Folding-0.382 kcal/mol outside primersite
Amplicon SequenceAAGTTCTCGCCCACTATCCTCAGAATATAGAATGGAACCCTTTTGATCAAGATGCGGTGA
ACATGTTGTGCATGCCTAAAGGGCTATCTTTCAGGACACAAACGGACAATAAAGACCCCC
AGTTTCACTCATTTATAATTACCAGGGAAGATGGTTCTCGCACCTATGGTTTTGTTCTCA
CTTTTTATGAAGAAGTTACAAGTAAGCAAATCTGCACAGCAATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)225359 - 583
Exon 7 To Exon 8 (Pair 1)
Forward (1644,23)AGATGCAAATCCTTCTCTACTCAAmplicon SizecDNA: 214 bpgenomic: 19,421
Reverse (1857,24)TCTTGAGGAAGTTCTAGTTTAGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.097 kcal/mol
Forward Dimers-1.814 kcal/mol
Reverse Loops1.218 kcal/mol in 3' area
Reverse Dimers-0.452 kcal/mol
Forward-Reverse Dimers-2.405 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceAGATGCAAATCCTTCTCTACTCACAAGATTATCAACGCCTGATGACTGTGGCAGAAGGCA
TCACCACACTTTTGTTCCCATTTCAATGGCAACATGTTTATGTGCCCATTCTACCTGCTT
CTCTGCTACATTTTCTTGATGCTCCTGTCCCTTATCTGATGGGCCTTCAGTCAAAAGAAG
GAACTGACCGTTCTAAACTAGAACTTCCTCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2141064 - 1277
Exon 7 To Exon 8 (Pair 2)
Forward (1639,24)TTTAGAGATGCAAATCCTTCTCTAAmplicon SizecDNA: 220 bpgenomic: 19,427
Reverse (1858,23)CTCTTGAGGAAGTTCTAGTTTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.097 kcal/mol
Forward Dimers-1.814 kcal/mol
Reverse Loops1.356 kcal/mol
Reverse Dimers-0.452 kcal/mol
Forward-Reverse Dimers-2.405 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceTTTAGAGATGCAAATCCTTCTCTACTCACAAGATTATCAACGCCTGATGACTGTGGCAGA
AGGCATCACCACACTTTTGTTCCCATTTCAATGGCAACATGTTTATGTGCCCATTCTACC
TGCTTCTCTGCTACATTTTCTTGATGCTCCTGTCCCTTATCTGATGGGCCTTCAGTCAAA
AGAAGGAACTGACCGTTCTAAACTAGAACTTCCTCAAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2201059 - 1278
Exon 7 To Exon 9 (Pair 1)
Forward (1639,24)TTTAGAGATGCAAATCCTTCTCTAAmplicon SizecDNA: 288 bpgenomic: 27,212
Reverse (1926,22)GGGAACTGTGGAAATTCTTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.097 kcal/mol
Forward Dimers-1.814 kcal/mol
Reverse Loops1.318 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-1.086 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceTTTAGAGATGCAAATCCTTCTCTACTCACAAGATTATCAACGCCTGATGACTGTGGCAGA
AGGCATCACCACACTTTTGTTCCCATTTCAATGGCAACATGTTTATGTGCCCATTCTACC
TGCTTCTCTGCTACATTTTCTTGATGCTCCTGTCCCTTATCTGATGGGCCTTCAGTCAAA
AGAAGGAACTGACCGTTCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGA
CATTGACAACCATTTTATTGAGTTGCCTGAAGAATTTCCACAGTTCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2881059 - 1346
Exon 7 To Exon 8 (Pair 3)
Forward (1641,23)TAGAGATGCAAATCCTTCTCTACAmplicon SizecDNA: 217 bpgenomic: 19,424
Reverse (1857,24)TCTTGAGGAAGTTCTAGTTTAGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.097 kcal/mol
Forward Dimers-1.814 kcal/mol
Reverse Loops1.218 kcal/mol in 3' area
Reverse Dimers-0.452 kcal/mol
Forward-Reverse Dimers-2.405 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceTAGAGATGCAAATCCTTCTCTACTCACAAGATTATCAACGCCTGATGACTGTGGCAGAAG
GCATCACCACACTTTTGTTCCCATTTCAATGGCAACATGTTTATGTGCCCATTCTACCTG
CTTCTCTGCTACATTTTCTTGATGCTCCTGTCCCTTATCTGATGGGCCTTCAGTCAAAAG
AAGGAACTGACCGTTCTAAACTAGAACTTCCTCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2171061 - 1277
Exon 7 To Exon 8 (Pair 4)
Forward (1642,23)AGAGATGCAAATCCTTCTCTACTAmplicon SizecDNA: 217 bpgenomic: 19,424
Reverse (1858,23)CTCTTGAGGAAGTTCTAGTTTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.097 kcal/mol
Forward Dimers-1.814 kcal/mol
Reverse Loops1.356 kcal/mol
Reverse Dimers-0.452 kcal/mol
Forward-Reverse Dimers-2.405 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceAGAGATGCAAATCCTTCTCTACTCACAAGATTATCAACGCCTGATGACTGTGGCAGAAGG
CATCACCACACTTTTGTTCCCATTTCAATGGCAACATGTTTATGTGCCCATTCTACCTGC
TTCTCTGCTACATTTTCTTGATGCTCCTGTCCCTTATCTGATGGGCCTTCAGTCAAAAGA
AGGAACTGACCGTTCTAAACTAGAACTTCCTCAAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2171062 - 1278
Exon 7 To Exon 8 (Pair 5)
Forward (1647,23)TGCAAATCCTTCTCTACTCACAAAmplicon SizecDNA: 212 bpgenomic: 19,419
Reverse (1858,23)CTCTTGAGGAAGTTCTAGTTTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.79 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.356 kcal/mol
Reverse Dimers-0.452 kcal/mol
Forward-Reverse Dimers-2.405 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceTGCAAATCCTTCTCTACTCACAAGATTATCAACGCCTGATGACTGTGGCAGAAGGCATCA
CCACACTTTTGTTCCCATTTCAATGGCAACATGTTTATGTGCCCATTCTACCTGCTTCTC
TGCTACATTTTCTTGATGCTCCTGTCCCTTATCTGATGGGCCTTCAGTCAAAAGAAGGAA
CTGACCGTTCTAAACTAGAACTTCCTCAAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2121067 - 1278
Exon 7 To Exon 8 (Pair 6)
Forward (1641,23)TAGAGATGCAAATCCTTCTCTACAmplicon SizecDNA: 218 bpgenomic: 19,425
Reverse (1858,23)CTCTTGAGGAAGTTCTAGTTTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.097 kcal/mol
Forward Dimers-1.814 kcal/mol
Reverse Loops1.356 kcal/mol
Reverse Dimers-0.452 kcal/mol
Forward-Reverse Dimers-2.405 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceTAGAGATGCAAATCCTTCTCTACTCACAAGATTATCAACGCCTGATGACTGTGGCAGAAG
GCATCACCACACTTTTGTTCCCATTTCAATGGCAACATGTTTATGTGCCCATTCTACCTG
CTTCTCTGCTACATTTTCTTGATGCTCCTGTCCCTTATCTGATGGGCCTTCAGTCAAAAG
AAGGAACTGACCGTTCTAAACTAGAACTTCCTCAAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2181061 - 1278
Exon 7 To Exon 9 (Pair 2)
Forward (1644,23)AGATGCAAATCCTTCTCTACTCAAmplicon SizecDNA: 283 bpgenomic: 27,207
Reverse (1926,22)GGGAACTGTGGAAATTCTTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.097 kcal/mol
Forward Dimers-1.814 kcal/mol
Reverse Loops1.318 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-1.04 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceAGATGCAAATCCTTCTCTACTCACAAGATTATCAACGCCTGATGACTGTGGCAGAAGGCA
TCACCACACTTTTGTTCCCATTTCAATGGCAACATGTTTATGTGCCCATTCTACCTGCTT
CTCTGCTACATTTTCTTGATGCTCCTGTCCCTTATCTGATGGGCCTTCAGTCAAAAGAAG
GAACTGACCGTTCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTG
ACAACCATTTTATTGAGTTGCCTGAAGAATTTCCACAGTTCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2831064 - 1346
Exon 7 To Exon 8 (Pair 7)
Forward (1646,23)ATGCAAATCCTTCTCTACTCACAAmplicon SizecDNA: 212 bpgenomic: 19,419
Reverse (1857,24)TCTTGAGGAAGTTCTAGTTTAGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.67 kcal/mol
Forward Dimers-1.814 kcal/mol
Reverse Loops1.218 kcal/mol in 3' area
Reverse Dimers-0.452 kcal/mol
Forward-Reverse Dimers-2.405 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceATGCAAATCCTTCTCTACTCACAAGATTATCAACGCCTGATGACTGTGGCAGAAGGCATC
ACCACACTTTTGTTCCCATTTCAATGGCAACATGTTTATGTGCCCATTCTACCTGCTTCT
CTGCTACATTTTCTTGATGCTCCTGTCCCTTATCTGATGGGCCTTCAGTCAAAAGAAGGA
ACTGACCGTTCTAAACTAGAACTTCCTCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2121066 - 1277
Exon 7 To Exon 8 (Pair 8)
Forward (1646,23)ATGCAAATCCTTCTCTACTCACAAmplicon SizecDNA: 213 bpgenomic: 19,420
Reverse (1858,23)CTCTTGAGGAAGTTCTAGTTTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.67 kcal/mol
Forward Dimers-1.814 kcal/mol
Reverse Loops1.356 kcal/mol
Reverse Dimers-0.452 kcal/mol
Forward-Reverse Dimers-2.405 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceATGCAAATCCTTCTCTACTCACAAGATTATCAACGCCTGATGACTGTGGCAGAAGGCATC
ACCACACTTTTGTTCCCATTTCAATGGCAACATGTTTATGTGCCCATTCTACCTGCTTCT
CTGCTACATTTTCTTGATGCTCCTGTCCCTTATCTGATGGGCCTTCAGTCAAAAGAAGGA
ACTGACCGTTCTAAACTAGAACTTCCTCAAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2131066 - 1278
Exon 7 To Exon 8 (Pair 9)
Forward (1644,23)AGATGCAAATCCTTCTCTACTCAAmplicon SizecDNA: 215 bpgenomic: 19,422
Reverse (1858,23)CTCTTGAGGAAGTTCTAGTTTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.097 kcal/mol
Forward Dimers-1.814 kcal/mol
Reverse Loops1.356 kcal/mol
Reverse Dimers-0.452 kcal/mol
Forward-Reverse Dimers-2.405 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceAGATGCAAATCCTTCTCTACTCACAAGATTATCAACGCCTGATGACTGTGGCAGAAGGCA
TCACCACACTTTTGTTCCCATTTCAATGGCAACATGTTTATGTGCCCATTCTACCTGCTT
CTCTGCTACATTTTCTTGATGCTCCTGTCCCTTATCTGATGGGCCTTCAGTCAAAAGAAG
GAACTGACCGTTCTAAACTAGAACTTCCTCAAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2151064 - 1278
Exon 7 To Exon 8 (Pair 10)
Forward (1639,24)TTTAGAGATGCAAATCCTTCTCTAAmplicon SizecDNA: 219 bpgenomic: 19,426
Reverse (1857,24)TCTTGAGGAAGTTCTAGTTTAGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.097 kcal/mol
Forward Dimers-1.814 kcal/mol
Reverse Loops1.218 kcal/mol in 3' area
Reverse Dimers-0.452 kcal/mol
Forward-Reverse Dimers-2.405 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceTTTAGAGATGCAAATCCTTCTCTACTCACAAGATTATCAACGCCTGATGACTGTGGCAGA
AGGCATCACCACACTTTTGTTCCCATTTCAATGGCAACATGTTTATGTGCCCATTCTACC
TGCTTCTCTGCTACATTTTCTTGATGCTCCTGTCCCTTATCTGATGGGCCTTCAGTCAAA
AGAAGGAACTGACCGTTCTAAACTAGAACTTCCTCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2191059 - 1277
Exon 7 To Exon 8 (Pair 11)
Forward (1647,23)TGCAAATCCTTCTCTACTCACAAAmplicon SizecDNA: 211 bpgenomic: 19,418
Reverse (1857,24)TCTTGAGGAAGTTCTAGTTTAGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.79 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.218 kcal/mol in 3' area
Reverse Dimers-0.452 kcal/mol
Forward-Reverse Dimers-2.405 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceTGCAAATCCTTCTCTACTCACAAGATTATCAACGCCTGATGACTGTGGCAGAAGGCATCA
CCACACTTTTGTTCCCATTTCAATGGCAACATGTTTATGTGCCCATTCTACCTGCTTCTC
TGCTACATTTTCTTGATGCTCCTGTCCCTTATCTGATGGGCCTTCAGTCAAAAGAAGGAA
CTGACCGTTCTAAACTAGAACTTCCTCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2111067 - 1277
Exon 7 To Exon 9 (Pair 3)
Forward (1642,23)AGAGATGCAAATCCTTCTCTACTAmplicon SizecDNA: 285 bpgenomic: 27,209
Reverse (1926,22)GGGAACTGTGGAAATTCTTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.097 kcal/mol
Forward Dimers-1.814 kcal/mol
Reverse Loops1.318 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-1.086 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceAGAGATGCAAATCCTTCTCTACTCACAAGATTATCAACGCCTGATGACTGTGGCAGAAGG
CATCACCACACTTTTGTTCCCATTTCAATGGCAACATGTTTATGTGCCCATTCTACCTGC
TTCTCTGCTACATTTTCTTGATGCTCCTGTCCCTTATCTGATGGGCCTTCAGTCAAAAGA
AGGAACTGACCGTTCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACAT
TGACAACCATTTTATTGAGTTGCCTGAAGAATTTCCACAGTTCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2851062 - 1346
Exon 7 To Exon 8 (Pair 12)
Forward (1642,23)AGAGATGCAAATCCTTCTCTACTAmplicon SizecDNA: 216 bpgenomic: 19,423
Reverse (1857,24)TCTTGAGGAAGTTCTAGTTTAGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.097 kcal/mol
Forward Dimers-1.814 kcal/mol
Reverse Loops1.218 kcal/mol in 3' area
Reverse Dimers-0.452 kcal/mol
Forward-Reverse Dimers-2.405 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceAGAGATGCAAATCCTTCTCTACTCACAAGATTATCAACGCCTGATGACTGTGGCAGAAGG
CATCACCACACTTTTGTTCCCATTTCAATGGCAACATGTTTATGTGCCCATTCTACCTGC
TTCTCTGCTACATTTTCTTGATGCTCCTGTCCCTTATCTGATGGGCCTTCAGTCAAAAGA
AGGAACTGACCGTTCTAAACTAGAACTTCCTCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2161062 - 1277
Exon 7 To Exon 9 (Pair 4)
Forward (1641,23)TAGAGATGCAAATCCTTCTCTACAmplicon SizecDNA: 286 bpgenomic: 27,210
Reverse (1926,22)GGGAACTGTGGAAATTCTTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.097 kcal/mol
Forward Dimers-1.814 kcal/mol
Reverse Loops1.318 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-1.086 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceTAGAGATGCAAATCCTTCTCTACTCACAAGATTATCAACGCCTGATGACTGTGGCAGAAG
GCATCACCACACTTTTGTTCCCATTTCAATGGCAACATGTTTATGTGCCCATTCTACCTG
CTTCTCTGCTACATTTTCTTGATGCTCCTGTCCCTTATCTGATGGGCCTTCAGTCAAAAG
AAGGAACTGACCGTTCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACA
TTGACAACCATTTTATTGAGTTGCCTGAAGAATTTCCACAGTTCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2861061 - 1346
Exon 8 To Exon 9 (Pair 1)
Forward (1834,24)TTCTAAACTAGAACTTCCTCAAGAAmplicon SizecDNA: 88 bpgenomic: 7,805
Reverse (1921,22)CTGTGGAAATTCTTCAGGCAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.601 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.354 kcal/mol
Amplicon Folding0.521 kcal/mol inside primersite
Amplicon SequenceTTCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTT
TATTGAGTTGCCTGAAGAATTTCCACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)881254 - 1341
Exon 8 To Exon 9 (Pair 2)
Forward (1836,23)CTAAACTAGAACTTCCTCAAGAGAmplicon SizecDNA: 218 bpgenomic: 7,935
Reverse (2053,23)GACCAAGTCTTTCAGAACCATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.698 kcal/mol
Reverse Dimers-0.652 kcal/mol
Forward-Reverse Dimers-2.24 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTTTA
TTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACTCT
CTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAGTA
CCAGCAAACTGAAGAATATGGTTCTGAAAGACTTGGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2181256 - 1473
Exon 8 To Exon 9 (Pair 3)
Forward (1739,22)GTTTATGTGCCCATTCTACCTGAmplicon SizecDNA: 301 bpgenomic: 8,018
Reverse (2039,23)GAACCATATTCTTCAGTTTGCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.205 kcal/mol
Forward Dimers-0.322 kcal/mol
Reverse Loops1.184 kcal/mol in 3' area
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-0.531 kcal/mol
Amplicon Folding-2.087 kcal/mol outside primersite
Amplicon SequenceGTTTATGTGCCCATTCTACCTGCTTCTCTGCTACATTTTCTTGATGCTCCTGTCCCTTAT
CTGATGGGCCTTCAGTCAAAAGAAGGAACTGACCGTTCTAAACTAGAACTTCCTCAAGAG
GCTAATTTGTGTTTTGTGGACATTGACAACCATTTTATTGAGTTGCCTGAAGAATTTCCA
CAGTTCCCCAATAAAGTGGATTTTATCCAAGAACTCTCTGAGGTTCTTGTTCAATTTGGG
ATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAGTACCAGCAAACTGAAGAATATGGTT
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)3011159 - 1459
Exon 8 To Exon 9 (Pair 4)
Forward (1834,24)TTCTAAACTAGAACTTCCTCAAGAAmplicon SizecDNA: 222 bpgenomic: 7,939
Reverse (2055,23)TTGACCAAGTCTTTCAGAACCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.698 kcal/mol
Reverse Dimers-0.652 kcal/mol
Forward-Reverse Dimers-2.24 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceTTCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTT
TATTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACT
CTCTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAG
TACCAGCAAACTGAAGAATATGGTTCTGAAAGACTTGGTCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2221254 - 1475
Exon 8 To Exon 9 (Pair 5)
Forward (1836,23)CTAAACTAGAACTTCCTCAAGAGAmplicon SizecDNA: 88 bpgenomic: 7,805
Reverse (1923,23)AACTGTGGAAATTCTTCAGGCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.601 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.354 kcal/mol
Amplicon Folding0.521 kcal/mol inside primersite
Amplicon SequenceCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTTTA
TTGAGTTGCCTGAAGAATTTCCACAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)881256 - 1343
Exon 8 To Exon 9 (Pair 6)
Forward (1834,24)TTCTAAACTAGAACTTCCTCAAGAAmplicon SizecDNA: 228 bpgenomic: 7,945
Reverse (2061,23)TTGTCATTGACCAAGTCTTTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.646 kcal/mol
Reverse Dimers-1.287 kcal/mol
Forward-Reverse Dimers-2.24 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceTTCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTT
TATTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACT
CTCTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAG
TACCAGCAAACTGAAGAATATGGTTCTGAAAGACTTGGTCAATGACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2281254 - 1481
Exon 8 To Exon 9 (Pair 7)
Forward (1834,24)TTCTAAACTAGAACTTCCTCAAGAAmplicon SizecDNA: 220 bpgenomic: 7,937
Reverse (2053,23)GACCAAGTCTTTCAGAACCATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.698 kcal/mol
Reverse Dimers-0.652 kcal/mol
Forward-Reverse Dimers-2.24 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceTTCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTT
TATTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACT
CTCTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAG
TACCAGCAAACTGAAGAATATGGTTCTGAAAGACTTGGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2201254 - 1473
Exon 8 To Exon 9 (Pair 8)
Forward (1836,23)CTAAACTAGAACTTCCTCAAGAGAmplicon SizecDNA: 90 bpgenomic: 7,807
Reverse (1925,22)GGAACTGTGGAAATTCTTCAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.601 kcal/mol in 3' area
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.354 kcal/mol
Amplicon Folding0.521 kcal/mol inside primersite
Amplicon SequenceCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTTTA
TTGAGTTGCCTGAAGAATTTCCACAGTTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)901256 - 1345
Exon 8 To Exon 9 (Pair 9)
Forward (1836,23)CTAAACTAGAACTTCCTCAAGAGAmplicon SizecDNA: 200 bpgenomic: 7,917
Reverse (2035,23)CATATTCTTCAGTTTGCTGGTACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.007 kcal/mol in 3' area
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-2.254 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTTTA
TTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACTCT
CTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAGTA
CCAGCAAACTGAAGAATATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2001256 - 1455
Exon 8 To Exon 9 (Pair 10)
Forward (1834,24)TTCTAAACTAGAACTTCCTCAAGAAmplicon SizecDNA: 226 bpgenomic: 7,943
Reverse (2059,23)GTCATTGACCAAGTCTTTCAGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.698 kcal/mol
Reverse Dimers-0.747 kcal/mol
Forward-Reverse Dimers-2.24 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceTTCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTT
TATTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACT
CTCTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAG
TACCAGCAAACTGAAGAATATGGTTCTGAAAGACTTGGTCAATGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2261254 - 1479
Exon 8 To Exon 9 (Pair 11)
Forward (1834,24)TTCTAAACTAGAACTTCCTCAAGAAmplicon SizecDNA: 195 bpgenomic: 7,912
Reverse (2028,22)TTCAGTTTGCTGGTACTCTCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.007 kcal/mol
Reverse Dimers-1.021 kcal/mol
Forward-Reverse Dimers-2.254 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceTTCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTT
TATTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACT
CTCTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAG
TACCAGCAAACTGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)1951254 - 1448
Exon 8 To Exon 9 (Pair 12)
Forward (1739,22)GTTTATGTGCCCATTCTACCTGAmplicon SizecDNA: 224 bpgenomic: 7,941
Reverse (1962,23)ACCTCAGAGAGTTCTTGGATAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.205 kcal/mol
Forward Dimers-0.322 kcal/mol
Reverse Loops0.851 kcal/mol
Reverse Dimers-1.356 kcal/mol
Forward-Reverse Dimers-1.335 kcal/mol
Amplicon Folding-0.864 kcal/mol outside primersite
Amplicon SequenceGTTTATGTGCCCATTCTACCTGCTTCTCTGCTACATTTTCTTGATGCTCCTGTCCCTTAT
CTGATGGGCCTTCAGTCAAAAGAAGGAACTGACCGTTCTAAACTAGAACTTCCTCAAGAG
GCTAATTTGTGTTTTGTGGACATTGACAACCATTTTATTGAGTTGCCTGAAGAATTTCCA
CAGTTCCCCAATAAAGTGGATTTTATCCAAGAACTCTCTGAGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2241159 - 1382
Exon 8 To Exon 9 (Pair 13)
Forward (1836,23)CTAAACTAGAACTTCCTCAAGAGAmplicon SizecDNA: 192 bpgenomic: 7,909
Reverse (2027,22)TCAGTTTGCTGGTACTCTCACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.022 kcal/mol
Reverse Dimers-1.021 kcal/mol
Forward-Reverse Dimers-2.254 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTTTA
TTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACTCT
CTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAGTA
CCAGCAAACTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)1921256 - 1447
Exon 8 To Exon 9 (Pair 14)
Forward (1834,24)TTCTAAACTAGAACTTCCTCAAGAAmplicon SizecDNA: 191 bpgenomic: 7,908
Reverse (2024,21)GTTTGCTGGTACTCTCACTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops2.195 kcal/mol in 3' area
Reverse Dimers-0.176 kcal/mol
Forward-Reverse Dimers-1.402 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceTTCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTT
TATTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACT
CTCTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAG
TACCAGCAAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)1911254 - 1444
Exon 8 To Exon 9 (Pair 15)
Forward (1834,24)TTCTAAACTAGAACTTCCTCAAGAAmplicon SizecDNA: 223 bpgenomic: 7,940
Reverse (2056,23)ATTGACCAAGTCTTTCAGAACCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.698 kcal/mol
Reverse Dimers-0.652 kcal/mol
Forward-Reverse Dimers-2.24 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceTTCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTT
TATTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACT
CTCTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAG
TACCAGCAAACTGAAGAATATGGTTCTGAAAGACTTGGTCAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2231254 - 1476
Exon 8 To Exon 9 (Pair 16)
Forward (1836,23)CTAAACTAGAACTTCCTCAAGAGAmplicon SizecDNA: 203 bpgenomic: 7,920
Reverse (2038,23)AACCATATTCTTCAGTTTGCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.022 kcal/mol in 3' area
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-2.254 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTTTA
TTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACTCT
CTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAGTA
CCAGCAAACTGAAGAATATGGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2031256 - 1458
Exon 8 To Exon 9 (Pair 17)
Forward (1834,24)TTCTAAACTAGAACTTCCTCAAGAAmplicon SizecDNA: 221 bpgenomic: 7,938
Reverse (2054,23)TGACCAAGTCTTTCAGAACCATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.698 kcal/mol
Reverse Dimers-0.652 kcal/mol
Forward-Reverse Dimers-2.24 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceTTCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTT
TATTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACT
CTCTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAG
TACCAGCAAACTGAAGAATATGGTTCTGAAAGACTTGGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2211254 - 1474
Exon 8 To Exon 9 (Pair 18)
Forward (1834,24)TTCTAAACTAGAACTTCCTCAAGAAmplicon SizecDNA: 227 bpgenomic: 7,944
Reverse (2060,23)TGTCATTGACCAAGTCTTTCAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.646 kcal/mol
Reverse Dimers-1.287 kcal/mol
Forward-Reverse Dimers-2.24 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceTTCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTT
TATTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACT
CTCTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAG
TACCAGCAAACTGAAGAATATGGTTCTGAAAGACTTGGTCAATGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2271254 - 1480
Exon 8 To Exon 9 (Pair 19)
Forward (1836,23)CTAAACTAGAACTTCCTCAAGAGAmplicon SizecDNA: 224 bpgenomic: 7,941
Reverse (2059,23)GTCATTGACCAAGTCTTTCAGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.698 kcal/mol
Reverse Dimers-0.747 kcal/mol
Forward-Reverse Dimers-2.24 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTTTA
TTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACTCT
CTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAGTA
CCAGCAAACTGAAGAATATGGTTCTGAAAGACTTGGTCAATGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2241256 - 1479
Exon 8 To Exon 9 (Pair 20)
Forward (1834,24)TTCTAAACTAGAACTTCCTCAAGAAmplicon SizecDNA: 90 bpgenomic: 7,807
Reverse (1923,23)AACTGTGGAAATTCTTCAGGCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.601 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.354 kcal/mol
Amplicon Folding0.521 kcal/mol inside primersite
Amplicon SequenceTTCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTT
TATTGAGTTGCCTGAAGAATTTCCACAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)901254 - 1343
Exon 8 To Exon 9 (Pair 21)
Forward (1834,24)TTCTAAACTAGAACTTCCTCAAGAAmplicon SizecDNA: 218 bpgenomic: 7,935
Reverse (2051,23)CCAAGTCTTTCAGAACCATATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.438 kcal/mol in 3' area
Reverse Dimers-0.652 kcal/mol
Forward-Reverse Dimers-2.24 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceTTCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTT
TATTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACT
CTCTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAG
TACCAGCAAACTGAAGAATATGGTTCTGAAAGACTTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2181254 - 1471
Exon 8 To Exon 9 (Pair 22)
Forward (1836,23)CTAAACTAGAACTTCCTCAAGAGAmplicon SizecDNA: 193 bpgenomic: 7,910
Reverse (2028,22)TTCAGTTTGCTGGTACTCTCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.007 kcal/mol
Reverse Dimers-1.021 kcal/mol
Forward-Reverse Dimers-2.254 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTTTA
TTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACTCT
CTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAGTA
CCAGCAAACTGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)1931256 - 1448
Exon 8 To Exon 9 (Pair 23)
Forward (1737,23)ATGTTTATGTGCCCATTCTACCTAmplicon SizecDNA: 190 bpgenomic: 7,907
Reverse (1926,22)GGGAACTGTGGAAATTCTTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.205 kcal/mol
Forward Dimers-0.322 kcal/mol
Reverse Loops1.318 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.196 kcal/mol
Amplicon Folding-0.717 kcal/mol outside primersite
Amplicon SequenceATGTTTATGTGCCCATTCTACCTGCTTCTCTGCTACATTTTCTTGATGCTCCTGTCCCTT
ATCTGATGGGCCTTCAGTCAAAAGAAGGAACTGACCGTTCTAAACTAGAACTTCCTCAAG
AGGCTAATTTGTGTTTTGTGGACATTGACAACCATTTTATTGAGTTGCCTGAAGAATTTC
CACAGTTCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)1901157 - 1346
Exon 8 To Exon 9 (Pair 24)
Forward (1836,23)CTAAACTAGAACTTCCTCAAGAGAmplicon SizecDNA: 226 bpgenomic: 7,943
Reverse (2061,23)TTGTCATTGACCAAGTCTTTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.646 kcal/mol
Reverse Dimers-1.287 kcal/mol
Forward-Reverse Dimers-2.24 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTTTA
TTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACTCT
CTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAGTA
CCAGCAAACTGAAGAATATGGTTCTGAAAGACTTGGTCAATGACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2261256 - 1481
Exon 8 To Exon 9 (Pair 25)
Forward (1834,24)TTCTAAACTAGAACTTCCTCAAGAAmplicon SizecDNA: 202 bpgenomic: 7,919
Reverse (2035,23)CATATTCTTCAGTTTGCTGGTACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.007 kcal/mol in 3' area
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-2.254 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceTTCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTT
TATTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACT
CTCTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAG
TACCAGCAAACTGAAGAATATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2021254 - 1455
Exon 8 To Exon 9 (Pair 26)
Forward (1740,22)TTTATGTGCCCATTCTACCTGCAmplicon SizecDNA: 187 bpgenomic: 7,904
Reverse (1926,22)GGGAACTGTGGAAATTCTTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.205 kcal/mol
Forward Dimers-0.322 kcal/mol
Reverse Loops1.318 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.196 kcal/mol
Amplicon Folding-0.717 kcal/mol outside primersite
Amplicon SequenceTTTATGTGCCCATTCTACCTGCTTCTCTGCTACATTTTCTTGATGCTCCTGTCCCTTATC
TGATGGGCCTTCAGTCAAAAGAAGGAACTGACCGTTCTAAACTAGAACTTCCTCAAGAGG
CTAATTTGTGTTTTGTGGACATTGACAACCATTTTATTGAGTTGCCTGAAGAATTTCCAC
AGTTCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)1871160 - 1346
Exon 8 To Exon 9 (Pair 27)
Forward (1836,23)CTAAACTAGAACTTCCTCAAGAGAmplicon SizecDNA: 204 bpgenomic: 7,921
Reverse (2039,23)GAACCATATTCTTCAGTTTGCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.184 kcal/mol in 3' area
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-2.254 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTTTA
TTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACTCT
CTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAGTA
CCAGCAAACTGAAGAATATGGTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2041256 - 1459
Exon 8 To Exon 9 (Pair 28)
Forward (1836,23)CTAAACTAGAACTTCCTCAAGAGAmplicon SizecDNA: 219 bpgenomic: 7,936
Reverse (2054,23)TGACCAAGTCTTTCAGAACCATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.698 kcal/mol
Reverse Dimers-0.652 kcal/mol
Forward-Reverse Dimers-2.24 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTTTA
TTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACTCT
CTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAGTA
CCAGCAAACTGAAGAATATGGTTCTGAAAGACTTGGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2191256 - 1474
Exon 8 To Exon 9 (Pair 29)
Forward (1834,24)TTCTAAACTAGAACTTCCTCAAGAAmplicon SizecDNA: 203 bpgenomic: 7,920
Reverse (2036,23)CCATATTCTTCAGTTTGCTGGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.007 kcal/mol in 3' area
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-2.254 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceTTCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTT
TATTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACT
CTCTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAG
TACCAGCAAACTGAAGAATATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2031254 - 1456
Exon 8 To Exon 9 (Pair 30)
Forward (1836,23)CTAAACTAGAACTTCCTCAAGAGAmplicon SizecDNA: 89 bpgenomic: 7,806
Reverse (1924,22)GAACTGTGGAAATTCTTCAGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.601 kcal/mol in 3' area
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.354 kcal/mol
Amplicon Folding0.521 kcal/mol inside primersite
Amplicon SequenceCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTTTA
TTGAGTTGCCTGAAGAATTTCCACAGTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)891256 - 1344
Exon 8 To Exon 9 (Pair 31)
Forward (1834,24)TTCTAAACTAGAACTTCCTCAAGAAmplicon SizecDNA: 91 bpgenomic: 7,808
Reverse (1924,22)GAACTGTGGAAATTCTTCAGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.601 kcal/mol in 3' area
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.354 kcal/mol
Amplicon Folding0.521 kcal/mol inside primersite
Amplicon SequenceTTCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTT
TATTGAGTTGCCTGAAGAATTTCCACAGTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)911254 - 1344
Exon 8 To Exon 9 (Pair 32)
Forward (1834,24)TTCTAAACTAGAACTTCCTCAAGAAmplicon SizecDNA: 206 bpgenomic: 7,923
Reverse (2039,23)GAACCATATTCTTCAGTTTGCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.184 kcal/mol in 3' area
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-2.254 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceTTCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTT
TATTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACT
CTCTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAG
TACCAGCAAACTGAAGAATATGGTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2061254 - 1459
Exon 8 To Exon 9 (Pair 33)
Forward (1737,23)ATGTTTATGTGCCCATTCTACCTAmplicon SizecDNA: 189 bpgenomic: 7,906
Reverse (1925,22)GGAACTGTGGAAATTCTTCAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.205 kcal/mol
Forward Dimers-0.322 kcal/mol
Reverse Loops1.601 kcal/mol in 3' area
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-1.264 kcal/mol
Amplicon Folding-0.717 kcal/mol outside primersite
Amplicon SequenceATGTTTATGTGCCCATTCTACCTGCTTCTCTGCTACATTTTCTTGATGCTCCTGTCCCTT
ATCTGATGGGCCTTCAGTCAAAAGAAGGAACTGACCGTTCTAAACTAGAACTTCCTCAAG
AGGCTAATTTGTGTTTTGTGGACATTGACAACCATTTTATTGAGTTGCCTGAAGAATTTC
CACAGTTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)1891157 - 1345
Exon 8 To Exon 9 (Pair 34)
Forward (1836,23)CTAAACTAGAACTTCCTCAAGAGAmplicon SizecDNA: 201 bpgenomic: 7,918
Reverse (2036,23)CCATATTCTTCAGTTTGCTGGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.007 kcal/mol in 3' area
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-2.254 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTTTA
TTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACTCT
CTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAGTA
CCAGCAAACTGAAGAATATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2011256 - 1456
Exon 8 To Exon 9 (Pair 35)
Forward (1834,24)TTCTAAACTAGAACTTCCTCAAGAAmplicon SizecDNA: 92 bpgenomic: 7,809
Reverse (1925,22)GGAACTGTGGAAATTCTTCAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.601 kcal/mol in 3' area
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.354 kcal/mol
Amplicon Folding0.521 kcal/mol inside primersite
Amplicon SequenceTTCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTT
TATTGAGTTGCCTGAAGAATTTCCACAGTTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)921254 - 1345
Exon 8 To Exon 9 (Pair 36)
Forward (1836,23)CTAAACTAGAACTTCCTCAAGAGAmplicon SizecDNA: 216 bpgenomic: 7,933
Reverse (2051,23)CCAAGTCTTTCAGAACCATATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.438 kcal/mol in 3' area
Reverse Dimers-0.652 kcal/mol
Forward-Reverse Dimers-2.24 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTTTA
TTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACTCT
CTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAGTA
CCAGCAAACTGAAGAATATGGTTCTGAAAGACTTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2161256 - 1471
Exon 8 To Exon 9 (Pair 37)
Forward (1836,23)CTAAACTAGAACTTCCTCAAGAGAmplicon SizecDNA: 223 bpgenomic: 7,940
Reverse (2058,23)TCATTGACCAAGTCTTTCAGAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.698 kcal/mol
Reverse Dimers-0.652 kcal/mol
Forward-Reverse Dimers-2.24 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTTTA
TTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACTCT
CTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAGTA
CCAGCAAACTGAAGAATATGGTTCTGAAAGACTTGGTCAATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2231256 - 1478
Exon 8 To Exon 9 (Pair 38)
Forward (1737,23)ATGTTTATGTGCCCATTCTACCTAmplicon SizecDNA: 226 bpgenomic: 7,943
Reverse (1962,23)ACCTCAGAGAGTTCTTGGATAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.205 kcal/mol
Forward Dimers-0.322 kcal/mol
Reverse Loops0.851 kcal/mol
Reverse Dimers-1.356 kcal/mol
Forward-Reverse Dimers-1.335 kcal/mol
Amplicon Folding-0.864 kcal/mol outside primersite
Amplicon SequenceATGTTTATGTGCCCATTCTACCTGCTTCTCTGCTACATTTTCTTGATGCTCCTGTCCCTT
ATCTGATGGGCCTTCAGTCAAAAGAAGGAACTGACCGTTCTAAACTAGAACTTCCTCAAG
AGGCTAATTTGTGTTTTGTGGACATTGACAACCATTTTATTGAGTTGCCTGAAGAATTTC
CACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACTCTCTGAGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2261157 - 1382
Exon 8 To Exon 9 (Pair 39)
Forward (1834,24)TTCTAAACTAGAACTTCCTCAAGAAmplicon SizecDNA: 194 bpgenomic: 7,911
Reverse (2027,22)TCAGTTTGCTGGTACTCTCACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.022 kcal/mol
Reverse Dimers-1.021 kcal/mol
Forward-Reverse Dimers-2.254 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceTTCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTT
TATTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACT
CTCTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAG
TACCAGCAAACTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)1941254 - 1447
Exon 8 To Exon 9 (Pair 40)
Forward (1834,24)TTCTAAACTAGAACTTCCTCAAGAAmplicon SizecDNA: 225 bpgenomic: 7,942
Reverse (2058,23)TCATTGACCAAGTCTTTCAGAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.698 kcal/mol
Reverse Dimers-0.652 kcal/mol
Forward-Reverse Dimers-2.24 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceTTCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTT
TATTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACT
CTCTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAG
TACCAGCAAACTGAAGAATATGGTTCTGAAAGACTTGGTCAATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2251254 - 1478
Exon 8 To Exon 9 (Pair 41)
Forward (1836,23)CTAAACTAGAACTTCCTCAAGAGAmplicon SizecDNA: 86 bpgenomic: 7,803
Reverse (1921,22)CTGTGGAAATTCTTCAGGCAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.601 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.354 kcal/mol
Amplicon Folding0.521 kcal/mol inside primersite
Amplicon SequenceCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTTTA
TTGAGTTGCCTGAAGAATTTCCACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)861256 - 1341
Exon 8 To Exon 9 (Pair 42)
Forward (1836,23)CTAAACTAGAACTTCCTCAAGAGAmplicon SizecDNA: 225 bpgenomic: 7,942
Reverse (2060,23)TGTCATTGACCAAGTCTTTCAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.646 kcal/mol
Reverse Dimers-1.287 kcal/mol
Forward-Reverse Dimers-2.24 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTTTA
TTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACTCT
CTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAGTA
CCAGCAAACTGAAGAATATGGTTCTGAAAGACTTGGTCAATGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2251256 - 1480
Exon 8 To Exon 9 (Pair 43)
Forward (1740,22)TTTATGTGCCCATTCTACCTGCAmplicon SizecDNA: 223 bpgenomic: 7,940
Reverse (1962,23)ACCTCAGAGAGTTCTTGGATAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.205 kcal/mol
Forward Dimers-0.322 kcal/mol
Reverse Loops0.851 kcal/mol
Reverse Dimers-1.356 kcal/mol
Forward-Reverse Dimers-1.335 kcal/mol
Amplicon Folding-0.864 kcal/mol outside primersite
Amplicon SequenceTTTATGTGCCCATTCTACCTGCTTCTCTGCTACATTTTCTTGATGCTCCTGTCCCTTATC
TGATGGGCCTTCAGTCAAAAGAAGGAACTGACCGTTCTAAACTAGAACTTCCTCAAGAGG
CTAATTTGTGTTTTGTGGACATTGACAACCATTTTATTGAGTTGCCTGAAGAATTTCCAC
AGTTCCCCAATAAAGTGGATTTTATCCAAGAACTCTCTGAGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2231160 - 1382
Exon 8 To Exon 9 (Pair 44)
Forward (1739,22)GTTTATGTGCCCATTCTACCTGAmplicon SizecDNA: 188 bpgenomic: 7,905
Reverse (1926,22)GGGAACTGTGGAAATTCTTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.205 kcal/mol
Forward Dimers-0.322 kcal/mol
Reverse Loops1.318 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.196 kcal/mol
Amplicon Folding-0.717 kcal/mol outside primersite
Amplicon SequenceGTTTATGTGCCCATTCTACCTGCTTCTCTGCTACATTTTCTTGATGCTCCTGTCCCTTAT
CTGATGGGCCTTCAGTCAAAAGAAGGAACTGACCGTTCTAAACTAGAACTTCCTCAAGAG
GCTAATTTGTGTTTTGTGGACATTGACAACCATTTTATTGAGTTGCCTGAAGAATTTCCA
CAGTTCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)1881159 - 1346
Exon 8 To Exon 9 (Pair 45)
Forward (1836,23)CTAAACTAGAACTTCCTCAAGAGAmplicon SizecDNA: 221 bpgenomic: 7,938
Reverse (2056,23)ATTGACCAAGTCTTTCAGAACCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.698 kcal/mol
Reverse Dimers-0.652 kcal/mol
Forward-Reverse Dimers-2.24 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTTTA
TTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACTCT
CTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAGTA
CCAGCAAACTGAAGAATATGGTTCTGAAAGACTTGGTCAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2211256 - 1476
Exon 8 To Exon 9 (Pair 46)
Forward (1740,22)TTTATGTGCCCATTCTACCTGCAmplicon SizecDNA: 300 bpgenomic: 8,017
Reverse (2039,23)GAACCATATTCTTCAGTTTGCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.205 kcal/mol
Forward Dimers-0.322 kcal/mol
Reverse Loops1.184 kcal/mol in 3' area
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-0.39 kcal/mol
Amplicon Folding-2.087 kcal/mol outside primersite
Amplicon SequenceTTTATGTGCCCATTCTACCTGCTTCTCTGCTACATTTTCTTGATGCTCCTGTCCCTTATC
TGATGGGCCTTCAGTCAAAAGAAGGAACTGACCGTTCTAAACTAGAACTTCCTCAAGAGG
CTAATTTGTGTTTTGTGGACATTGACAACCATTTTATTGAGTTGCCTGAAGAATTTCCAC
AGTTCCCCAATAAAGTGGATTTTATCCAAGAACTCTCTGAGGTTCTTGTTCAATTTGGGA
TCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAGTACCAGCAAACTGAAGAATATGGTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)3001160 - 1459
Exon 8 To Exon 9 (Pair 47)
Forward (1836,23)CTAAACTAGAACTTCCTCAAGAGAmplicon SizecDNA: 220 bpgenomic: 7,937
Reverse (2055,23)TTGACCAAGTCTTTCAGAACCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.698 kcal/mol
Reverse Dimers-0.652 kcal/mol
Forward-Reverse Dimers-2.24 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTTTA
TTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACTCT
CTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAGTA
CCAGCAAACTGAAGAATATGGTTCTGAAAGACTTGGTCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2201256 - 1475
Exon 8 To Exon 9 (Pair 48)
Forward (1834,24)TTCTAAACTAGAACTTCCTCAAGAAmplicon SizecDNA: 205 bpgenomic: 7,922
Reverse (2038,23)AACCATATTCTTCAGTTTGCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops1.022 kcal/mol in 3' area
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-2.254 kcal/mol
Amplicon Folding-1.37 kcal/mol outside primersite
Amplicon SequenceTTCTAAACTAGAACTTCCTCAAGAGGCTAATTTGTGTTTTGTGGACATTGACAACCATTT
TATTGAGTTGCCTGAAGAATTTCCACAGTTCCCCAATAAAGTGGATTTTATCCAAGAACT
CTCTGAGGTTCTTGTTCAATTTGGGATCCCTCCTGAGGGCAGCCTACATTGCAGTGAGAG
TACCAGCAAACTGAAGAATATGGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2051254 - 1458
Exon 9 To Exon 10 (Pair 1)
Forward (2294,24)TTTACACAGATGTTTGCAGATTACAmplicon SizecDNA: 142 bpgenomic: 4,312
Reverse (2435,20)ATGGCAGGTAAGGCTCAGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.67 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.304 kcal/mol in 3' area
Reverse Dimers-2.633 kcal/mol
Forward-Reverse Dimers-1.322 kcal/mol
Amplicon Folding-1.347 kcal/mol outside primersite
Amplicon SequenceTTTACACAGATGTTTGCAGATTACGAAGCATTTGTCATTCAGACTGCCCAGGACATGGAA
TCCTGGCTGACCAACCGGGAACAGATGCAGAACTTTGACAAAGCTTCCTTTCTGTCTGAC
CAGCCTGAGCCTTACCTGCCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)1421714 - 1855
Exon 9 To Exon 10 (Pair 2)
Forward (2264,21)GTACAGCTCCGAGAGGTCTTTAmplicon SizecDNA: 294 bpgenomic: 4,464
Reverse (2557,23)CCTTATCTTATCAATCCGAGTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.291 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.679 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.455 kcal/mol
Amplicon Folding-2.198 kcal/mol outside primersite
Amplicon SequenceGTACAGCTCCGAGAGGTCTTTGCTAACCGTTTTACACAGATGTTTGCAGATTACGAAGCA
TTTGTCATTCAGACTGCCCAGGACATGGAATCCTGGCTGACCAACCGGGAACAGATGCAG
AACTTTGACAAAGCTTCCTTTCTGTCTGACCAGCCTGAGCCTTACCTGCCATTTCTTTCA
CGCTTCATTGAAACACAGATGTTTGCCACCTTTATTGATAATAAAATTATGTCTCAGTGG
GAAGAGAAAGATCCTTTGCTTCGGGTCTTTGACACTCGGATTGATAAGATAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2941684 - 1977
Exon 9 To Exon 10 (Pair 3)
Forward (2257,21)GCTCAATGTACAGCTCCGAGAAmplicon SizecDNA: 162 bpgenomic: 4,332
Reverse (2418,21)GGCTGGTCAGACAGAAAGGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.546 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.696 kcal/mol
Reverse Dimers-2.354 kcal/mol
Forward-Reverse Dimers-2.329 kcal/mol
Amplicon Folding-1.347 kcal/mol outside primersite
Amplicon SequenceGCTCAATGTACAGCTCCGAGAGGTCTTTGCTAACCGTTTTACACAGATGTTTGCAGATTA
CGAAGCATTTGTCATTCAGACTGCCCAGGACATGGAATCCTGGCTGACCAACCGGGAACA
GATGCAGAACTTTGACAAAGCTTCCTTTCTGTCTGACCAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)1621677 - 1838
Exon 9 To Exon 10 (Pair 4)
Forward (2258,21)CTCAATGTACAGCTCCGAGAGAmplicon SizecDNA: 186 bpgenomic: 4,356
Reverse (2443,22)TGAAAGAAATGGCAGGTAAGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.712 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.948 kcal/mol in 3' area
Reverse Dimers-1.395 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding-1.347 kcal/mol outside primersite
Amplicon SequenceCTCAATGTACAGCTCCGAGAGGTCTTTGCTAACCGTTTTACACAGATGTTTGCAGATTAC
GAAGCATTTGTCATTCAGACTGCCCAGGACATGGAATCCTGGCTGACCAACCGGGAACAG
ATGCAGAACTTTGACAAAGCTTCCTTTCTGTCTGACCAGCCTGAGCCTTACCTGCCATTT
CTTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)1861678 - 1863
Exon 9 To Exon 10 (Pair 5)
Forward (2260,21)CAATGTACAGCTCCGAGAGGTAmplicon SizecDNA: 185 bpgenomic: 4,355
Reverse (2444,22)GTGAAAGAAATGGCAGGTAAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.291 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops2.22 kcal/mol in 3' area
Reverse Dimers-1.395 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding-1.347 kcal/mol outside primersite
Amplicon SequenceCAATGTACAGCTCCGAGAGGTCTTTGCTAACCGTTTTACACAGATGTTTGCAGATTACGA
AGCATTTGTCATTCAGACTGCCCAGGACATGGAATCCTGGCTGACCAACCGGGAACAGAT
GCAGAACTTTGACAAAGCTTCCTTTCTGTCTGACCAGCCTGAGCCTTACCTGCCATTTCT
TTCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)1851680 - 1864
Exon 9 To Exon 10 (Pair 6)
Forward (2263,21)TGTACAGCTCCGAGAGGTCTTAmplicon SizecDNA: 295 bpgenomic: 4,465
Reverse (2557,23)CCTTATCTTATCAATCCGAGTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.291 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.679 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.455 kcal/mol
Amplicon Folding-2.198 kcal/mol outside primersite
Amplicon SequenceTGTACAGCTCCGAGAGGTCTTTGCTAACCGTTTTACACAGATGTTTGCAGATTACGAAGC
ATTTGTCATTCAGACTGCCCAGGACATGGAATCCTGGCTGACCAACCGGGAACAGATGCA
GAACTTTGACAAAGCTTCCTTTCTGTCTGACCAGCCTGAGCCTTACCTGCCATTTCTTTC
ACGCTTCATTGAAACACAGATGTTTGCCACCTTTATTGATAATAAAATTATGTCTCAGTG
GGAAGAGAAAGATCCTTTGCTTCGGGTCTTTGACACTCGGATTGATAAGATAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_144973 (DENND5B)2951683 - 1977
 

See below for some more details.

Program Output:

Loading ...