Design Results for DFNA5

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size90Maximal Amplicon Size150
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size1000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 5 To Exon 6 (Pair 1)
Forward (895,22)ATGCAGAAGTGTGTGATCTCTGAmplicon SizecDNA: 118 bpgenomic: 1,790
Reverse (1012,21)CCTTGGTGACATTCCCATCCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.513 kcal/mol in 3' area
Forward Dimers-1.674 kcal/mol
Reverse Loops0.818 kcal/mol
Reverse Dimers-0.113 kcal/mol
Forward-Reverse Dimers-0.867 kcal/mol
Amplicon Folding-0.59 kcal/mol outside primersite
Amplicon SequenceATGCAGAAGTGTGTGATCTCTGAGCACATGCAGGTCGAGGAGAAGTGTGGTGGCATCGTG
GGCATCCAGACCAAGACGGTGCAGGTGTCAGCGACGGAGGATGGGAATGTCACCAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127454 (DFNA5)118596 - 713
NM_001127453 (DFNA5)118581 - 698
NM_004403 (DFNA5)118826 - 943
Exon 5 To Exon 6 (Pair 2)
Forward (895,22)ATGCAGAAGTGTGTGATCTCTGAmplicon SizecDNA: 117 bpgenomic: 1,789
Reverse (1011,21)CTTGGTGACATTCCCATCCTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.513 kcal/mol in 3' area
Forward Dimers-1.674 kcal/mol
Reverse Loops0.818 kcal/mol
Reverse Dimers-0.113 kcal/mol
Forward-Reverse Dimers-0.867 kcal/mol
Amplicon Folding-0.59 kcal/mol outside primersite
Amplicon SequenceATGCAGAAGTGTGTGATCTCTGAGCACATGCAGGTCGAGGAGAAGTGTGGTGGCATCGTG
GGCATCCAGACCAAGACGGTGCAGGTGTCAGCGACGGAGGATGGGAATGTCACCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127454 (DFNA5)117596 - 712
NM_001127453 (DFNA5)117581 - 697
NM_004403 (DFNA5)117826 - 942
Exon 5 To Exon 6 (Pair 3)
Forward (895,22)ATGCAGAAGTGTGTGATCTCTGAmplicon SizecDNA: 116 bpgenomic: 1,788
Reverse (1010,21)TTGGTGACATTCCCATCCTCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.513 kcal/mol in 3' area
Forward Dimers-1.674 kcal/mol
Reverse Loops0.818 kcal/mol
Reverse Dimers-0.113 kcal/mol
Forward-Reverse Dimers-0.867 kcal/mol
Amplicon Folding-0.59 kcal/mol outside primersite
Amplicon SequenceATGCAGAAGTGTGTGATCTCTGAGCACATGCAGGTCGAGGAGAAGTGTGGTGGCATCGTG
GGCATCCAGACCAAGACGGTGCAGGTGTCAGCGACGGAGGATGGGAATGTCACCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004403 (DFNA5)116826 - 941
NM_001127453 (DFNA5)116581 - 696
NM_001127454 (DFNA5)116596 - 711
Exon 6 To Exon 7 (Pair 1)
Forward (1039,20)GCTGCCACCACCATTGCCTAAmplicon SizecDNA: 123 bpgenomic: 6,988
Reverse (1161,23)GACAGAGTCAATTCTCTTCTTGTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.02 kcal/mol in 3' area
Forward Dimers-0.39 kcal/mol
Reverse Loops0.442 kcal/mol
Reverse Dimers-1.124 kcal/mol
Forward-Reverse Dimers-1.485 kcal/mol
Amplicon Folding-2.773 kcal/mol outside primersite
Amplicon SequenceGCTGCCACCACCATTGCCTACGGTGTCATTGAGTTATACGTGAAACTGGACGGCCAGTTC
GAGTTCTGCCTTCTCCGAGGGAAGCAAGGTGGCTTCGAGAACAAGAAGAGAATTGACTCT
GTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127454 (DFNA5)123740 - 862
NM_001127453 (DFNA5)123725 - 847
NM_004403 (DFNA5)123970 - 1092
Exon 6 To Exon 7 (Pair 2)
Forward (1039,20)GCTGCCACCACCATTGCCTAAmplicon SizecDNA: 124 bpgenomic: 6,989
Reverse (1162,23)AGACAGAGTCAATTCTCTTCTTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.02 kcal/mol in 3' area
Forward Dimers-0.39 kcal/mol
Reverse Loops0.442 kcal/mol
Reverse Dimers-1.124 kcal/mol
Forward-Reverse Dimers-1.485 kcal/mol
Amplicon Folding-2.773 kcal/mol outside primersite
Amplicon SequenceGCTGCCACCACCATTGCCTACGGTGTCATTGAGTTATACGTGAAACTGGACGGCCAGTTC
GAGTTCTGCCTTCTCCGAGGGAAGCAAGGTGGCTTCGAGAACAAGAAGAGAATTGACTCT
GTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127453 (DFNA5)124725 - 848
NM_004403 (DFNA5)124970 - 1093
NM_001127454 (DFNA5)124740 - 863
Exon 6 To Exon 7 (Pair 3)
Forward (1038,20)AGCTGCCACCACCATTGCCTAmplicon SizecDNA: 125 bpgenomic: 6,990
Reverse (1162,23)AGACAGAGTCAATTCTCTTCTTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.02 kcal/mol in 3' area
Forward Dimers-1.606 kcal/mol
Reverse Loops0.442 kcal/mol
Reverse Dimers-1.124 kcal/mol
Forward-Reverse Dimers-1.485 kcal/mol
Amplicon Folding-2.773 kcal/mol outside primersite
Amplicon SequenceAGCTGCCACCACCATTGCCTACGGTGTCATTGAGTTATACGTGAAACTGGACGGCCAGTT
CGAGTTCTGCCTTCTCCGAGGGAAGCAAGGTGGCTTCGAGAACAAGAAGAGAATTGACTC
TGTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004403 (DFNA5)125969 - 1093
NM_001127453 (DFNA5)125724 - 848
NM_001127454 (DFNA5)125739 - 863
Exon 6 To Exon 7 (Pair 4)
Forward (1038,20)AGCTGCCACCACCATTGCCTAmplicon SizecDNA: 124 bpgenomic: 6,989
Reverse (1161,23)GACAGAGTCAATTCTCTTCTTGTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.02 kcal/mol in 3' area
Forward Dimers-1.606 kcal/mol
Reverse Loops0.442 kcal/mol
Reverse Dimers-1.124 kcal/mol
Forward-Reverse Dimers-1.485 kcal/mol
Amplicon Folding-2.773 kcal/mol outside primersite
Amplicon SequenceAGCTGCCACCACCATTGCCTACGGTGTCATTGAGTTATACGTGAAACTGGACGGCCAGTT
CGAGTTCTGCCTTCTCCGAGGGAAGCAAGGTGGCTTCGAGAACAAGAAGAGAATTGACTC
TGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127453 (DFNA5)124724 - 847
NM_004403 (DFNA5)124969 - 1092
NM_001127454 (DFNA5)124739 - 862
 

See below for some more details.

Program Output:

Loading ...