Design Results for DNAJB6

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size150
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 3 To Exon 4 (Pair 1)
Forward (264,23)GAGAATAAAGAAGAAGCAGAGAGAmplicon SizecDNA: 102 bpgenomic: 3,333
Reverse (365,24)TTTGCCATATTTGTCATAGATGTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.076 kcal/mol in 3' area
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-1.055 kcal/mol
Amplicon Folding0.252 kcal/mol inside primersite
Amplicon SequenceGAGAATAAAGAAGAAGCAGAGAGAAAATTCAAGCAAGTAGCGGAGGCATATGAAGTGCTG
TCGGATGCTAAGAAACGGGACATCTATGACAAATATGGCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005494 (DNAJB6)102264 - 365
NM_058246 (DNAJB6)102263 - 364
Exon 3 To Exon 4 (Pair 2)
Forward (264,23)GAGAATAAAGAAGAAGCAGAGAGAmplicon SizecDNA: 94 bpgenomic: 3,325
Reverse (357,23)ATTTGTCATAGATGTCCCGTTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.813 kcal/mol in 3' area
Reverse Dimers-0.149 kcal/mol
Forward-Reverse Dimers-0.45 kcal/mol
Amplicon Folding0.333 kcal/mol outside primersite
Amplicon SequenceGAGAATAAAGAAGAAGCAGAGAGAAAATTCAAGCAAGTAGCGGAGGCATATGAAGTGCTG
TCGGATGCTAAGAAACGGGACATCTATGACAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_058246 (DNAJB6)94263 - 356
NM_005494 (DNAJB6)94264 - 357
Exon 3 To Exon 4 (Pair 3)
Forward (257,24)AAATCCTGAGAATAAAGAAGAAGCAmplicon SizecDNA: 104 bpgenomic: 3,335
Reverse (360,23)CATATTTGTCATAGATGTCCCGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops2.076 kcal/mol
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-0.724 kcal/mol
Amplicon Folding0.333 kcal/mol outside primersite
Amplicon SequenceAAATCCTGAGAATAAAGAAGAAGCAGAGAGAAAATTCAAGCAAGTAGCGGAGGCATATGA
AGTGCTGTCGGATGCTAAGAAACGGGACATCTATGACAAATATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005494 (DNAJB6)104257 - 360
NM_058246 (DNAJB6)104256 - 359
Exon 3 To Exon 4 (Pair 4)
Forward (266,24)GAATAAAGAAGAAGCAGAGAGAAAAmplicon SizecDNA: 92 bpgenomic: 3,323
Reverse (357,23)ATTTGTCATAGATGTCCCGTTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.813 kcal/mol in 3' area
Reverse Dimers-0.149 kcal/mol
Forward-Reverse Dimers-0.45 kcal/mol
Amplicon Folding0.333 kcal/mol outside primersite
Amplicon SequenceGAATAAAGAAGAAGCAGAGAGAAAATTCAAGCAAGTAGCGGAGGCATATGAAGTGCTGTC
GGATGCTAAGAAACGGGACATCTATGACAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005494 (DNAJB6)92266 - 357
NM_058246 (DNAJB6)92265 - 356
Exon 3 To Exon 4 (Pair 5)
Forward (265,24)AGAATAAAGAAGAAGCAGAGAGAAAmplicon SizecDNA: 93 bpgenomic: 3,324
Reverse (357,23)ATTTGTCATAGATGTCCCGTTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.813 kcal/mol in 3' area
Reverse Dimers-0.149 kcal/mol
Forward-Reverse Dimers-0.45 kcal/mol
Amplicon Folding0.333 kcal/mol outside primersite
Amplicon SequenceAGAATAAAGAAGAAGCAGAGAGAAAATTCAAGCAAGTAGCGGAGGCATATGAAGTGCTGT
CGGATGCTAAGAAACGGGACATCTATGACAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005494 (DNAJB6)93265 - 357
NM_058246 (DNAJB6)93264 - 356
Exon 3 To Exon 4 (Pair 6)
Forward (266,24)GAATAAAGAAGAAGCAGAGAGAAAAmplicon SizecDNA: 101 bpgenomic: 3,332
Reverse (366,24)CTTTGCCATATTTGTCATAGATGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.076 kcal/mol in 3' area
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-1.204 kcal/mol
Amplicon Folding0.252 kcal/mol inside primersite
Amplicon SequenceGAATAAAGAAGAAGCAGAGAGAAAATTCAAGCAAGTAGCGGAGGCATATGAAGTGCTGTC
GGATGCTAAGAAACGGGACATCTATGACAAATATGGCAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_058246 (DNAJB6)101265 - 365
NM_005494 (DNAJB6)101266 - 366
Exon 3 To Exon 4 (Pair 7)
Forward (265,24)AGAATAAAGAAGAAGCAGAGAGAAAmplicon SizecDNA: 101 bpgenomic: 3,332
Reverse (365,24)TTTGCCATATTTGTCATAGATGTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.076 kcal/mol in 3' area
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-1.055 kcal/mol
Amplicon Folding0.252 kcal/mol inside primersite
Amplicon SequenceAGAATAAAGAAGAAGCAGAGAGAAAATTCAAGCAAGTAGCGGAGGCATATGAAGTGCTGT
CGGATGCTAAGAAACGGGACATCTATGACAAATATGGCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_058246 (DNAJB6)101264 - 364
NM_005494 (DNAJB6)101265 - 365
Exon 3 To Exon 4 (Pair 8)
Forward (266,24)GAATAAAGAAGAAGCAGAGAGAAAAmplicon SizecDNA: 98 bpgenomic: 3,329
Reverse (363,23)TGCCATATTTGTCATAGATGTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.076 kcal/mol in 3' area
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-0.984 kcal/mol
Amplicon Folding0.322 kcal/mol inside primersite
Amplicon SequenceGAATAAAGAAGAAGCAGAGAGAAAATTCAAGCAAGTAGCGGAGGCATATGAAGTGCTGTC
GGATGCTAAGAAACGGGACATCTATGACAAATATGGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005494 (DNAJB6)98266 - 363
NM_058246 (DNAJB6)98265 - 362
Exon 3 To Exon 4 (Pair 9)
Forward (265,24)AGAATAAAGAAGAAGCAGAGAGAAAmplicon SizecDNA: 99 bpgenomic: 3,330
Reverse (363,23)TGCCATATTTGTCATAGATGTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.076 kcal/mol in 3' area
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-0.984 kcal/mol
Amplicon Folding0.322 kcal/mol inside primersite
Amplicon SequenceAGAATAAAGAAGAAGCAGAGAGAAAATTCAAGCAAGTAGCGGAGGCATATGAAGTGCTGT
CGGATGCTAAGAAACGGGACATCTATGACAAATATGGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005494 (DNAJB6)99265 - 363
NM_058246 (DNAJB6)99264 - 362
Exon 3 To Exon 4 (Pair 10)
Forward (257,24)AAATCCTGAGAATAAAGAAGAAGCAmplicon SizecDNA: 110 bpgenomic: 3,341
Reverse (366,24)CTTTGCCATATTTGTCATAGATGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops2.076 kcal/mol in 3' area
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-1.099 kcal/mol
Amplicon Folding0.252 kcal/mol inside primersite
Amplicon SequenceAAATCCTGAGAATAAAGAAGAAGCAGAGAGAAAATTCAAGCAAGTAGCGGAGGCATATGA
AGTGCTGTCGGATGCTAAGAAACGGGACATCTATGACAAATATGGCAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005494 (DNAJB6)110257 - 366
NM_058246 (DNAJB6)110256 - 365
Exon 3 To Exon 4 (Pair 11)
Forward (266,24)GAATAAAGAAGAAGCAGAGAGAAAAmplicon SizecDNA: 94 bpgenomic: 3,325
Reverse (359,24)ATATTTGTCATAGATGTCCCGTTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.813 kcal/mol in 3' area
Reverse Dimers-0.149 kcal/mol
Forward-Reverse Dimers-0.68 kcal/mol
Amplicon Folding0.333 kcal/mol outside primersite
Amplicon SequenceGAATAAAGAAGAAGCAGAGAGAAAATTCAAGCAAGTAGCGGAGGCATATGAAGTGCTGTC
GGATGCTAAGAAACGGGACATCTATGACAAATAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005494 (DNAJB6)94266 - 359
NM_058246 (DNAJB6)94265 - 358
Exon 3 To Exon 4 (Pair 12)
Forward (264,23)GAGAATAAAGAAGAAGCAGAGAGAmplicon SizecDNA: 97 bpgenomic: 3,328
Reverse (360,23)CATATTTGTCATAGATGTCCCGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.076 kcal/mol
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-0.68 kcal/mol
Amplicon Folding0.333 kcal/mol outside primersite
Amplicon SequenceGAGAATAAAGAAGAAGCAGAGAGAAAATTCAAGCAAGTAGCGGAGGCATATGAAGTGCTG
TCGGATGCTAAGAAACGGGACATCTATGACAAATATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005494 (DNAJB6)97264 - 360
NM_058246 (DNAJB6)97263 - 359
Exon 3 To Exon 4 (Pair 13)
Forward (257,24)AAATCCTGAGAATAAAGAAGAAGCAmplicon SizecDNA: 107 bpgenomic: 3,338
Reverse (363,23)TGCCATATTTGTCATAGATGTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops2.076 kcal/mol in 3' area
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-0.724 kcal/mol
Amplicon Folding0.322 kcal/mol inside primersite
Amplicon SequenceAAATCCTGAGAATAAAGAAGAAGCAGAGAGAAAATTCAAGCAAGTAGCGGAGGCATATGA
AGTGCTGTCGGATGCTAAGAAACGGGACATCTATGACAAATATGGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005494 (DNAJB6)107257 - 363
NM_058246 (DNAJB6)107256 - 362
Exon 3 To Exon 4 (Pair 14)
Forward (264,23)GAGAATAAAGAAGAAGCAGAGAGAmplicon SizecDNA: 100 bpgenomic: 3,331
Reverse (363,23)TGCCATATTTGTCATAGATGTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.076 kcal/mol in 3' area
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-0.984 kcal/mol
Amplicon Folding0.322 kcal/mol inside primersite
Amplicon SequenceGAGAATAAAGAAGAAGCAGAGAGAAAATTCAAGCAAGTAGCGGAGGCATATGAAGTGCTG
TCGGATGCTAAGAAACGGGACATCTATGACAAATATGGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005494 (DNAJB6)100264 - 363
NM_058246 (DNAJB6)100263 - 362
Exon 3 To Exon 4 (Pair 15)
Forward (265,24)AGAATAAAGAAGAAGCAGAGAGAAAmplicon SizecDNA: 96 bpgenomic: 3,327
Reverse (360,23)CATATTTGTCATAGATGTCCCGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.076 kcal/mol
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-0.68 kcal/mol
Amplicon Folding0.333 kcal/mol outside primersite
Amplicon SequenceAGAATAAAGAAGAAGCAGAGAGAAAATTCAAGCAAGTAGCGGAGGCATATGAAGTGCTGT
CGGATGCTAAGAAACGGGACATCTATGACAAATATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_058246 (DNAJB6)96264 - 359
NM_005494 (DNAJB6)96265 - 360
Exon 3 To Exon 4 (Pair 16)
Forward (266,24)GAATAAAGAAGAAGCAGAGAGAAAAmplicon SizecDNA: 100 bpgenomic: 3,331
Reverse (365,24)TTTGCCATATTTGTCATAGATGTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.076 kcal/mol in 3' area
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-1.055 kcal/mol
Amplicon Folding0.252 kcal/mol inside primersite
Amplicon SequenceGAATAAAGAAGAAGCAGAGAGAAAATTCAAGCAAGTAGCGGAGGCATATGAAGTGCTGTC
GGATGCTAAGAAACGGGACATCTATGACAAATATGGCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005494 (DNAJB6)100266 - 365
NM_058246 (DNAJB6)100265 - 364
Exon 3 To Exon 4 (Pair 17)
Forward (257,24)AAATCCTGAGAATAAAGAAGAAGCAmplicon SizecDNA: 103 bpgenomic: 3,334
Reverse (359,24)ATATTTGTCATAGATGTCCCGTTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops1.813 kcal/mol in 3' area
Reverse Dimers-0.149 kcal/mol
Forward-Reverse Dimers-0.724 kcal/mol
Amplicon Folding0.333 kcal/mol outside primersite
Amplicon SequenceAAATCCTGAGAATAAAGAAGAAGCAGAGAGAAAATTCAAGCAAGTAGCGGAGGCATATGA
AGTGCTGTCGGATGCTAAGAAACGGGACATCTATGACAAATAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_058246 (DNAJB6)103256 - 358
NM_005494 (DNAJB6)103257 - 359
Exon 3 To Exon 4 (Pair 18)
Forward (257,24)AAATCCTGAGAATAAAGAAGAAGCAmplicon SizecDNA: 109 bpgenomic: 3,340
Reverse (365,24)TTTGCCATATTTGTCATAGATGTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops2.076 kcal/mol in 3' area
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-0.724 kcal/mol
Amplicon Folding0.252 kcal/mol inside primersite
Amplicon SequenceAAATCCTGAGAATAAAGAAGAAGCAGAGAGAAAATTCAAGCAAGTAGCGGAGGCATATGA
AGTGCTGTCGGATGCTAAGAAACGGGACATCTATGACAAATATGGCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005494 (DNAJB6)109257 - 365
NM_058246 (DNAJB6)109256 - 364
Exon 3 To Exon 4 (Pair 19)
Forward (264,23)GAGAATAAAGAAGAAGCAGAGAGAmplicon SizecDNA: 96 bpgenomic: 3,327
Reverse (359,24)ATATTTGTCATAGATGTCCCGTTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.813 kcal/mol in 3' area
Reverse Dimers-0.149 kcal/mol
Forward-Reverse Dimers-0.68 kcal/mol
Amplicon Folding0.333 kcal/mol outside primersite
Amplicon SequenceGAGAATAAAGAAGAAGCAGAGAGAAAATTCAAGCAAGTAGCGGAGGCATATGAAGTGCTG
TCGGATGCTAAGAAACGGGACATCTATGACAAATAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_058246 (DNAJB6)96263 - 358
NM_005494 (DNAJB6)96264 - 359
Exon 3 To Exon 4 (Pair 20)
Forward (266,24)GAATAAAGAAGAAGCAGAGAGAAAAmplicon SizecDNA: 95 bpgenomic: 3,326
Reverse (360,23)CATATTTGTCATAGATGTCCCGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.076 kcal/mol
Reverse Dimers-0.408 kcal/mol
Forward-Reverse Dimers-0.68 kcal/mol
Amplicon Folding0.333 kcal/mol outside primersite
Amplicon SequenceGAATAAAGAAGAAGCAGAGAGAAAATTCAAGCAAGTAGCGGAGGCATATGAAGTGCTGTC
GGATGCTAAGAAACGGGACATCTATGACAAATATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005494 (DNAJB6)95266 - 360
NM_058246 (DNAJB6)95265 - 359
Exon 3 To Exon 4 (Pair 21)
Forward (265,24)AGAATAAAGAAGAAGCAGAGAGAAAmplicon SizecDNA: 95 bpgenomic: 3,326
Reverse (359,24)ATATTTGTCATAGATGTCCCGTTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.814 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.813 kcal/mol in 3' area
Reverse Dimers-0.149 kcal/mol
Forward-Reverse Dimers-0.68 kcal/mol
Amplicon Folding0.333 kcal/mol outside primersite
Amplicon SequenceAGAATAAAGAAGAAGCAGAGAGAAAATTCAAGCAAGTAGCGGAGGCATATGAAGTGCTGT
CGGATGCTAAGAAACGGGACATCTATGACAAATAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_058246 (DNAJB6)95264 - 358
NM_005494 (DNAJB6)95265 - 359
Exon 3 To Exon 4 (Pair 22)
Forward (257,24)AAATCCTGAGAATAAAGAAGAAGCAmplicon SizecDNA: 101 bpgenomic: 3,332
Reverse (357,23)ATTTGTCATAGATGTCCCGTTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops1.813 kcal/mol in 3' area
Reverse Dimers-0.149 kcal/mol
Forward-Reverse Dimers-0.515 kcal/mol
Amplicon Folding0.333 kcal/mol outside primersite
Amplicon SequenceAAATCCTGAGAATAAAGAAGAAGCAGAGAGAAAATTCAAGCAAGTAGCGGAGGCATATGA
AGTGCTGTCGGATGCTAAGAAACGGGACATCTATGACAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005494 (DNAJB6)101257 - 357
NM_058246 (DNAJB6)101256 - 356
Exon 8 To Exon 9 (Pair 1)
Forward (1466,22)CTGGTAAACTGGGTCTTTGTCAAmplicon SizecDNA: 124 bpgenomic: 23,594
Reverse (1589,19)CCTCAGCGAGGGCATCGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol
Forward Dimers0.051 kcal/mol
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-0.782 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAATGCGAA
TGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCCTCGCT
GAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 2)
Forward (1457,23)AAAGTAAAGCTGGTAAACTGGGTAmplicon SizecDNA: 130 bpgenomic: 23,600
Reverse (1586,19)CAGCGAGGGCATCGTCGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.111 kcal/mol
Forward Dimers-2.688 kcal/mol
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.672 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceAAAGTAAAGCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAAT
AAATGCGAATGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGAT
GCCCTCGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 3)
Forward (1467,23)TGGTAAACTGGGTCTTTGTCATTAmplicon SizecDNA: 123 bpgenomic: 23,593
Reverse (1589,19)CCTCAGCGAGGGCATCGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol
Forward Dimers0.006 kcal/mol in 3' area
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-0.782 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAATGCGAAT
GTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCCTCGCTG
AGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 4)
Forward (1461,23)TAAAGCTGGTAAACTGGGTCTTTAmplicon SizecDNA: 126 bpgenomic: 23,596
Reverse (1586,19)CAGCGAGGGCATCGTCGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol in 3' area
Forward Dimers-2.688 kcal/mol
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.672 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceTAAAGCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAAT
GCGAATGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCC
TCGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 5)
Forward (1464,22)AGCTGGTAAACTGGGTCTTTGTAmplicon SizecDNA: 123 bpgenomic: 23,593
Reverse (1586,19)CAGCGAGGGCATCGTCGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol
Forward Dimers-1.606 kcal/mol
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.672 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceAGCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAATGCG
AATGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCCTCG
CTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 6)
Forward (1469,23)GTAAACTGGGTCTTTGTCATTTGAmplicon SizecDNA: 121 bpgenomic: 23,591
Reverse (1589,19)CCTCAGCGAGGGCATCGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol
Forward Dimers0.006 kcal/mol in 3' area
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-0.782 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAATGCGAATGT
GTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCCTCGCTGAG
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 7)
Forward (1460,22)GTAAAGCTGGTAAACTGGGTCTAmplicon SizecDNA: 126 bpgenomic: 23,596
Reverse (1585,19)AGCGAGGGCATCGTCGTCGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol in 3' area
Forward Dimers-2.688 kcal/mol
Reverse Loops0.223 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.132 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceGTAAAGCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAA
TGCGAATGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCC
CTCGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 8)
Forward (1463,22)AAGCTGGTAAACTGGGTCTTTGAmplicon SizecDNA: 127 bpgenomic: 23,597
Reverse (1589,19)CCTCAGCGAGGGCATCGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol
Forward Dimers-2.688 kcal/mol
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.992 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceAAGCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAATGC
GAATGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCCTC
GCTGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 9)
Forward (1469,23)GTAAACTGGGTCTTTGTCATTTGAmplicon SizecDNA: 118 bpgenomic: 23,588
Reverse (1586,19)CAGCGAGGGCATCGTCGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol
Forward Dimers0.006 kcal/mol in 3' area
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-0.462 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAATGCGAATGT
GTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCCTCGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 11)
Forward (1461,23)TAAAGCTGGTAAACTGGGTCTTTAmplicon SizecDNA: 129 bpgenomic: 23,599
Reverse (1589,19)CCTCAGCGAGGGCATCGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol in 3' area
Forward Dimers-2.688 kcal/mol
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.992 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceTAAAGCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAAT
GCGAATGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCC
TCGCTGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 12)
Forward (1460,22)GTAAAGCTGGTAAACTGGGTCTAmplicon SizecDNA: 127 bpgenomic: 23,597
Reverse (1586,19)CAGCGAGGGCATCGTCGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol in 3' area
Forward Dimers-2.688 kcal/mol
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.672 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceGTAAAGCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAA
TGCGAATGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCC
CTCGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 13)
Forward (1475,24)TGGGTCTTTGTCATTTGCTTTAAAAmplicon SizecDNA: 112 bpgenomic: 23,582
Reverse (1586,19)CAGCGAGGGCATCGTCGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.878 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.911 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAATGCGAATGTGTTGGT
GCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCCTCGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 14)
Forward (1466,22)CTGGTAAACTGGGTCTTTGTCAAmplicon SizecDNA: 120 bpgenomic: 23,590
Reverse (1585,19)AGCGAGGGCATCGTCGTCGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol
Forward Dimers0.051 kcal/mol
Reverse Loops0.223 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-0.436 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAATGCGAA
TGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCCTCGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 15)
Forward (1468,23)GGTAAACTGGGTCTTTGTCATTTAmplicon SizecDNA: 119 bpgenomic: 23,589
Reverse (1586,19)CAGCGAGGGCATCGTCGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol
Forward Dimers0.006 kcal/mol in 3' area
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-0.462 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAATGCGAATG
TGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCCTCGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 16)
Forward (1468,23)GGTAAACTGGGTCTTTGTCATTTAmplicon SizecDNA: 122 bpgenomic: 23,592
Reverse (1589,19)CCTCAGCGAGGGCATCGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol
Forward Dimers0.006 kcal/mol in 3' area
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-0.782 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAATGCGAATG
TGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCCTCGCTGA
GG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 17)
Forward (1461,23)TAAAGCTGGTAAACTGGGTCTTTAmplicon SizecDNA: 125 bpgenomic: 23,595
Reverse (1585,19)AGCGAGGGCATCGTCGTCGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol in 3' area
Forward Dimers-2.688 kcal/mol
Reverse Loops0.223 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.132 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceTAAAGCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAAT
GCGAATGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCC
TCGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 18)
Forward (1457,23)AAAGTAAAGCTGGTAAACTGGGTAmplicon SizecDNA: 133 bpgenomic: 23,603
Reverse (1589,19)CCTCAGCGAGGGCATCGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.111 kcal/mol
Forward Dimers-2.688 kcal/mol
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.992 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceAAAGTAAAGCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAAT
AAATGCGAATGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGAT
GCCCTCGCTGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 19)
Forward (1460,22)GTAAAGCTGGTAAACTGGGTCTAmplicon SizecDNA: 130 bpgenomic: 23,600
Reverse (1589,19)CCTCAGCGAGGGCATCGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol in 3' area
Forward Dimers-2.688 kcal/mol
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.992 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceGTAAAGCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAA
TGCGAATGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCC
CTCGCTGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 20)
Forward (1461,23)TAAAGCTGGTAAACTGGGTCTTTAmplicon SizecDNA: 128 bpgenomic: 23,598
Reverse (1588,19)CTCAGCGAGGGCATCGTCGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol in 3' area
Forward Dimers-2.688 kcal/mol
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.992 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceTAAAGCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAAT
GCGAATGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCC
TCGCTGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 21)
Forward (1463,22)AAGCTGGTAAACTGGGTCTTTGAmplicon SizecDNA: 123 bpgenomic: 23,593
Reverse (1585,19)AGCGAGGGCATCGTCGTCGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol
Forward Dimers-2.688 kcal/mol
Reverse Loops0.223 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.132 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceAAGCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAATGC
GAATGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCCTC
GCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 22)
Forward (1464,22)AGCTGGTAAACTGGGTCTTTGTAmplicon SizecDNA: 122 bpgenomic: 23,592
Reverse (1585,19)AGCGAGGGCATCGTCGTCGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol
Forward Dimers-1.606 kcal/mol
Reverse Loops0.223 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.132 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceAGCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAATGCG
AATGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCCTCG
CT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 23)
Forward (1457,23)AAAGTAAAGCTGGTAAACTGGGTAmplicon SizecDNA: 129 bpgenomic: 23,599
Reverse (1585,19)AGCGAGGGCATCGTCGTCGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.111 kcal/mol
Forward Dimers-2.688 kcal/mol
Reverse Loops0.223 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.132 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceAAAGTAAAGCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAAT
AAATGCGAATGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGAT
GCCCTCGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 24)
Forward (1459,22)AGTAAAGCTGGTAAACTGGGTCAmplicon SizecDNA: 128 bpgenomic: 23,598
Reverse (1586,19)CAGCGAGGGCATCGTCGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.652 kcal/mol
Forward Dimers-2.688 kcal/mol
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.672 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceAGTAAAGCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAA
ATGCGAATGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGC
CCTCGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 25)
Forward (1464,22)AGCTGGTAAACTGGGTCTTTGTAmplicon SizecDNA: 125 bpgenomic: 23,595
Reverse (1588,19)CTCAGCGAGGGCATCGTCGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol
Forward Dimers-1.606 kcal/mol
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.992 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceAGCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAATGCG
AATGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCCTCG
CTGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 26)
Forward (1466,22)CTGGTAAACTGGGTCTTTGTCAAmplicon SizecDNA: 121 bpgenomic: 23,591
Reverse (1586,19)CAGCGAGGGCATCGTCGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol
Forward Dimers0.051 kcal/mol
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-0.462 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAATGCGAA
TGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCCTCGCT
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 27)
Forward (1459,22)AGTAAAGCTGGTAAACTGGGTCAmplicon SizecDNA: 127 bpgenomic: 23,597
Reverse (1585,19)AGCGAGGGCATCGTCGTCGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.652 kcal/mol
Forward Dimers-2.688 kcal/mol
Reverse Loops0.223 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.132 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceAGTAAAGCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAA
ATGCGAATGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGC
CCTCGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 28)
Forward (1467,23)TGGTAAACTGGGTCTTTGTCATTAmplicon SizecDNA: 122 bpgenomic: 23,592
Reverse (1588,19)CTCAGCGAGGGCATCGTCGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol
Forward Dimers0.006 kcal/mol in 3' area
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-0.782 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAATGCGAAT
GTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCCTCGCTG
AG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 29)
Forward (1464,22)AGCTGGTAAACTGGGTCTTTGTAmplicon SizecDNA: 126 bpgenomic: 23,596
Reverse (1589,19)CCTCAGCGAGGGCATCGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol
Forward Dimers-1.606 kcal/mol
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.992 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceAGCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAATGCG
AATGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCCTCG
CTGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 30)
Forward (1466,22)CTGGTAAACTGGGTCTTTGTCAAmplicon SizecDNA: 123 bpgenomic: 23,593
Reverse (1588,19)CTCAGCGAGGGCATCGTCGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol
Forward Dimers0.051 kcal/mol
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-0.782 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAATGCGAA
TGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCCTCGCT
GAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 31)
Forward (1475,24)TGGGTCTTTGTCATTTGCTTTAAAAmplicon SizecDNA: 111 bpgenomic: 23,581
Reverse (1585,19)AGCGAGGGCATCGTCGTCGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.878 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops0.223 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.437 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAATGCGAATGTGTTGGT
GCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCCTCGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 32)
Forward (1468,23)GGTAAACTGGGTCTTTGTCATTTAmplicon SizecDNA: 121 bpgenomic: 23,591
Reverse (1588,19)CTCAGCGAGGGCATCGTCGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol
Forward Dimers0.006 kcal/mol in 3' area
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-0.782 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAATGCGAATG
TGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCCTCGCTGA
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 33)
Forward (1463,22)AAGCTGGTAAACTGGGTCTTTGAmplicon SizecDNA: 126 bpgenomic: 23,596
Reverse (1588,19)CTCAGCGAGGGCATCGTCGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol
Forward Dimers-2.688 kcal/mol
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.992 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceAAGCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAATGC
GAATGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCCTC
GCTGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 34)
Forward (1459,22)AGTAAAGCTGGTAAACTGGGTCAmplicon SizecDNA: 130 bpgenomic: 23,600
Reverse (1588,19)CTCAGCGAGGGCATCGTCGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.652 kcal/mol
Forward Dimers-2.688 kcal/mol
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.992 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceAGTAAAGCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAA
ATGCGAATGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGC
CCTCGCTGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 35)
Forward (1467,23)TGGTAAACTGGGTCTTTGTCATTAmplicon SizecDNA: 120 bpgenomic: 23,590
Reverse (1586,19)CAGCGAGGGCATCGTCGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol
Forward Dimers0.006 kcal/mol in 3' area
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-0.462 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAATGCGAAT
GTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCCTCGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 36)
Forward (1469,23)GTAAACTGGGTCTTTGTCATTTGAmplicon SizecDNA: 120 bpgenomic: 23,590
Reverse (1588,19)CTCAGCGAGGGCATCGTCGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol
Forward Dimers0.006 kcal/mol in 3' area
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-0.782 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAATGCGAATGT
GTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCCTCGCTGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 37)
Forward (1457,23)AAAGTAAAGCTGGTAAACTGGGTAmplicon SizecDNA: 132 bpgenomic: 23,602
Reverse (1588,19)CTCAGCGAGGGCATCGTCGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.111 kcal/mol
Forward Dimers-2.688 kcal/mol
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.992 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceAAAGTAAAGCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAAT
AAATGCGAATGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGAT
GCCCTCGCTGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 38)
Forward (1463,22)AAGCTGGTAAACTGGGTCTTTGAmplicon SizecDNA: 124 bpgenomic: 23,594
Reverse (1586,19)CAGCGAGGGCATCGTCGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol
Forward Dimers-2.688 kcal/mol
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.672 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceAAGCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAATGC
GAATGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCCCTC
GCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 39)
Forward (1460,22)GTAAAGCTGGTAAACTGGGTCTAmplicon SizecDNA: 129 bpgenomic: 23,599
Reverse (1588,19)CTCAGCGAGGGCATCGTCGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.72 kcal/mol in 3' area
Forward Dimers-2.688 kcal/mol
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.992 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceGTAAAGCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAAA
TGCGAATGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGCC
CTCGCTGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 8 To Exon 9 (Pair 41)
Forward (1459,22)AGTAAAGCTGGTAAACTGGGTCAmplicon SizecDNA: 131 bpgenomic: 23,601
Reverse (1589,19)CCTCAGCGAGGGCATCGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.652 kcal/mol
Forward Dimers-2.688 kcal/mol
Reverse Loops0.223 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.992 kcal/mol
Amplicon Folding-0.568 kcal/mol outside primersite
Amplicon SequenceAGTAAAGCTGGTAAACTGGGTCTTTGTCATTTGCTTTAAAAAAAAAAAAAAAGAAAATAA
ATGCGAATGTGTTGGTGCATTCTTCCTGAGTGGGATCTGGAGTGTGGCCGACGACGATGC
CCTCGCTGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
 

See below for some more details.

Program Output:

Loading ...