Design Results for Dlx5

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size700

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 1 To Exon 2 (Pair 17)
Forward (495,20)GCTACGCTAGCTCCTACCACAmplicon SizecDNA: 153 bpgenomic: 2,052
Reverse (647,22)AGCTGGAATAAATAGTCCTGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.73 kcal/mol
Forward Dimers-2.674 kcal/mol
Reverse Loops1.745 kcal/mol in 3' area
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers-2.437 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceGCTACGCTAGCTCCTACCACCAGTACGGCGGCGCCTACAACCGCGTCCCAAGCGCCACCA
ACCAGCCAGAGAAAGAAGTGACCGAGCCCGAGGTGAGAATGGTGAATGGCAAACCAAAGA
AAGTTCGTAAACCCAGGACTATTTATTCCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)153495 - 647
Exon 1 To Exon 2 (Pair 16)
Forward (496,20)CTACGCTAGCTCCTACCACCAmplicon SizecDNA: 158 bpgenomic: 2,057
Reverse (653,23)GCTGAAAGCTGGAATAAATAGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.135 kcal/mol
Forward Dimers-2.674 kcal/mol
Reverse Loops0.11 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.978 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceCTACGCTAGCTCCTACCACCAGTACGGCGGCGCCTACAACCGCGTCCCAAGCGCCACCAA
CCAGCCAGAGAAAGAAGTGACCGAGCCCGAGGTGAGAATGGTGAATGGCAAACCAAAGAA
AGTTCGTAAACCCAGGACTATTTATTCCAGCTTTCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)158496 - 653
Exon 1 To Exon 2 (Pair 15)
Forward (496,20)CTACGCTAGCTCCTACCACCAmplicon SizecDNA: 152 bpgenomic: 2,051
Reverse (647,22)AGCTGGAATAAATAGTCCTGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.135 kcal/mol
Forward Dimers-2.674 kcal/mol
Reverse Loops1.745 kcal/mol in 3' area
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers-2.437 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceCTACGCTAGCTCCTACCACCAGTACGGCGGCGCCTACAACCGCGTCCCAAGCGCCACCAA
CCAGCCAGAGAAAGAAGTGACCGAGCCCGAGGTGAGAATGGTGAATGGCAAACCAAAGAA
AGTTCGTAAACCCAGGACTATTTATTCCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)152496 - 647
Exon 1 To Exon 2 (Pair 14)
Forward (495,20)GCTACGCTAGCTCCTACCACAmplicon SizecDNA: 158 bpgenomic: 2,057
Reverse (652,23)CTGAAAGCTGGAATAAATAGTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.73 kcal/mol
Forward Dimers-2.674 kcal/mol
Reverse Loops1.686 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.978 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceGCTACGCTAGCTCCTACCACCAGTACGGCGGCGCCTACAACCGCGTCCCAAGCGCCACCA
ACCAGCCAGAGAAAGAAGTGACCGAGCCCGAGGTGAGAATGGTGAATGGCAAACCAAAGA
AAGTTCGTAAACCCAGGACTATTTATTCCAGCTTTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)158495 - 652
Exon 1 To Exon 2 (Pair 13)
Forward (499,20)CGCTAGCTCCTACCACCAGTAmplicon SizecDNA: 151 bpgenomic: 2,050
Reverse (649,23)AAAGCTGGAATAAATAGTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.645 kcal/mol in 3' area
Forward Dimers-2.674 kcal/mol
Reverse Loops1.745 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.978 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceCGCTAGCTCCTACCACCAGTACGGCGGCGCCTACAACCGCGTCCCAAGCGCCACCAACCA
GCCAGAGAAAGAAGTGACCGAGCCCGAGGTGAGAATGGTGAATGGCAAACCAAAGAAAGT
TCGTAAACCCAGGACTATTTATTCCAGCTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)151499 - 649
Exon 1 To Exon 2 (Pair 12)
Forward (495,20)GCTACGCTAGCTCCTACCACAmplicon SizecDNA: 155 bpgenomic: 2,054
Reverse (649,23)AAAGCTGGAATAAATAGTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.73 kcal/mol
Forward Dimers-2.674 kcal/mol
Reverse Loops1.745 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.978 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceGCTACGCTAGCTCCTACCACCAGTACGGCGGCGCCTACAACCGCGTCCCAAGCGCCACCA
ACCAGCCAGAGAAAGAAGTGACCGAGCCCGAGGTGAGAATGGTGAATGGCAAACCAAAGA
AAGTTCGTAAACCCAGGACTATTTATTCCAGCTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)155495 - 649
Exon 1 To Exon 2 (Pair 11)
Forward (496,20)CTACGCTAGCTCCTACCACCAmplicon SizecDNA: 155 bpgenomic: 2,054
Reverse (650,23)GAAAGCTGGAATAAATAGTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.135 kcal/mol
Forward Dimers-2.674 kcal/mol
Reverse Loops1.745 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.978 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceCTACGCTAGCTCCTACCACCAGTACGGCGGCGCCTACAACCGCGTCCCAAGCGCCACCAA
CCAGCCAGAGAAAGAAGTGACCGAGCCCGAGGTGAGAATGGTGAATGGCAAACCAAAGAA
AGTTCGTAAACCCAGGACTATTTATTCCAGCTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)155496 - 650
Exon 1 To Exon 2 (Pair 10)
Forward (499,20)CGCTAGCTCCTACCACCAGTAmplicon SizecDNA: 155 bpgenomic: 2,054
Reverse (653,23)GCTGAAAGCTGGAATAAATAGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.645 kcal/mol in 3' area
Forward Dimers-2.674 kcal/mol
Reverse Loops0.11 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.978 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceCGCTAGCTCCTACCACCAGTACGGCGGCGCCTACAACCGCGTCCCAAGCGCCACCAACCA
GCCAGAGAAAGAAGTGACCGAGCCCGAGGTGAGAATGGTGAATGGCAAACCAAAGAAAGT
TCGTAAACCCAGGACTATTTATTCCAGCTTTCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)155499 - 653
Exon 1 To Exon 2 (Pair 9)
Forward (498,20)ACGCTAGCTCCTACCACCAGAmplicon SizecDNA: 153 bpgenomic: 2,052
Reverse (650,23)GAAAGCTGGAATAAATAGTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.135 kcal/mol
Forward Dimers-2.674 kcal/mol
Reverse Loops1.745 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.978 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceACGCTAGCTCCTACCACCAGTACGGCGGCGCCTACAACCGCGTCCCAAGCGCCACCAACC
AGCCAGAGAAAGAAGTGACCGAGCCCGAGGTGAGAATGGTGAATGGCAAACCAAAGAAAG
TTCGTAAACCCAGGACTATTTATTCCAGCTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)153498 - 650
Exon 1 To Exon 2 (Pair 8)
Forward (495,20)GCTACGCTAGCTCCTACCACAmplicon SizecDNA: 156 bpgenomic: 2,055
Reverse (650,23)GAAAGCTGGAATAAATAGTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.73 kcal/mol
Forward Dimers-2.674 kcal/mol
Reverse Loops1.745 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.978 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceGCTACGCTAGCTCCTACCACCAGTACGGCGGCGCCTACAACCGCGTCCCAAGCGCCACCA
ACCAGCCAGAGAAAGAAGTGACCGAGCCCGAGGTGAGAATGGTGAATGGCAAACCAAAGA
AAGTTCGTAAACCCAGGACTATTTATTCCAGCTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)156495 - 650
Exon 1 To Exon 2 (Pair 7)
Forward (499,20)CGCTAGCTCCTACCACCAGTAmplicon SizecDNA: 152 bpgenomic: 2,051
Reverse (650,23)GAAAGCTGGAATAAATAGTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.645 kcal/mol in 3' area
Forward Dimers-2.674 kcal/mol
Reverse Loops1.745 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.978 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceCGCTAGCTCCTACCACCAGTACGGCGGCGCCTACAACCGCGTCCCAAGCGCCACCAACCA
GCCAGAGAAAGAAGTGACCGAGCCCGAGGTGAGAATGGTGAATGGCAAACCAAAGAAAGT
TCGTAAACCCAGGACTATTTATTCCAGCTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)152499 - 650
Exon 1 To Exon 2 (Pair 6)
Forward (498,20)ACGCTAGCTCCTACCACCAGAmplicon SizecDNA: 152 bpgenomic: 2,051
Reverse (649,23)AAAGCTGGAATAAATAGTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.135 kcal/mol
Forward Dimers-2.674 kcal/mol
Reverse Loops1.745 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.978 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceACGCTAGCTCCTACCACCAGTACGGCGGCGCCTACAACCGCGTCCCAAGCGCCACCAACC
AGCCAGAGAAAGAAGTGACCGAGCCCGAGGTGAGAATGGTGAATGGCAAACCAAAGAAAG
TTCGTAAACCCAGGACTATTTATTCCAGCTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)152498 - 649
Exon 1 To Exon 2 (Pair 5)
Forward (498,20)ACGCTAGCTCCTACCACCAGAmplicon SizecDNA: 156 bpgenomic: 2,055
Reverse (653,23)GCTGAAAGCTGGAATAAATAGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.135 kcal/mol
Forward Dimers-2.674 kcal/mol
Reverse Loops0.11 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.978 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceACGCTAGCTCCTACCACCAGTACGGCGGCGCCTACAACCGCGTCCCAAGCGCCACCAACC
AGCCAGAGAAAGAAGTGACCGAGCCCGAGGTGAGAATGGTGAATGGCAAACCAAAGAAAG
TTCGTAAACCCAGGACTATTTATTCCAGCTTTCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)156498 - 653
Exon 1 To Exon 2 (Pair 4)
Forward (496,20)CTACGCTAGCTCCTACCACCAmplicon SizecDNA: 157 bpgenomic: 2,056
Reverse (652,23)CTGAAAGCTGGAATAAATAGTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.135 kcal/mol
Forward Dimers-2.674 kcal/mol
Reverse Loops1.686 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.978 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceCTACGCTAGCTCCTACCACCAGTACGGCGGCGCCTACAACCGCGTCCCAAGCGCCACCAA
CCAGCCAGAGAAAGAAGTGACCGAGCCCGAGGTGAGAATGGTGAATGGCAAACCAAAGAA
AGTTCGTAAACCCAGGACTATTTATTCCAGCTTTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)157496 - 652
Exon 1 To Exon 2 (Pair 3)
Forward (498,20)ACGCTAGCTCCTACCACCAGAmplicon SizecDNA: 155 bpgenomic: 2,054
Reverse (652,23)CTGAAAGCTGGAATAAATAGTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.135 kcal/mol
Forward Dimers-2.674 kcal/mol
Reverse Loops1.686 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.978 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceACGCTAGCTCCTACCACCAGTACGGCGGCGCCTACAACCGCGTCCCAAGCGCCACCAACC
AGCCAGAGAAAGAAGTGACCGAGCCCGAGGTGAGAATGGTGAATGGCAAACCAAAGAAAG
TTCGTAAACCCAGGACTATTTATTCCAGCTTTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)155498 - 652
Exon 1 To Exon 2 (Pair 2)
Forward (495,20)GCTACGCTAGCTCCTACCACAmplicon SizecDNA: 159 bpgenomic: 2,058
Reverse (653,23)GCTGAAAGCTGGAATAAATAGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.73 kcal/mol
Forward Dimers-2.674 kcal/mol
Reverse Loops0.11 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.978 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceGCTACGCTAGCTCCTACCACCAGTACGGCGGCGCCTACAACCGCGTCCCAAGCGCCACCA
ACCAGCCAGAGAAAGAAGTGACCGAGCCCGAGGTGAGAATGGTGAATGGCAAACCAAAGA
AAGTTCGTAAACCCAGGACTATTTATTCCAGCTTTCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)159495 - 653
Exon 1 To Exon 2 (Pair 1)
Forward (496,20)CTACGCTAGCTCCTACCACCAmplicon SizecDNA: 154 bpgenomic: 2,053
Reverse (649,23)AAAGCTGGAATAAATAGTCCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.135 kcal/mol
Forward Dimers-2.674 kcal/mol
Reverse Loops1.745 kcal/mol in 3' area
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.978 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceCTACGCTAGCTCCTACCACCAGTACGGCGGCGCCTACAACCGCGTCCCAAGCGCCACCAA
CCAGCCAGAGAAAGAAGTGACCGAGCCCGAGGTGAGAATGGTGAATGGCAAACCAAAGAA
AGTTCGTAAACCCAGGACTATTTATTCCAGCTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)154496 - 649
Exon 1 To Exon 2 (Pair 18)
Forward (499,20)CGCTAGCTCCTACCACCAGTAmplicon SizecDNA: 154 bpgenomic: 2,053
Reverse (652,23)CTGAAAGCTGGAATAAATAGTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.645 kcal/mol in 3' area
Forward Dimers-2.674 kcal/mol
Reverse Loops1.686 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-2.978 kcal/mol
Amplicon Folding-2.034 kcal/mol outside primersite
Amplicon SequenceCGCTAGCTCCTACCACCAGTACGGCGGCGCCTACAACCGCGTCCCAAGCGCCACCAACCA
GCCAGAGAAAGAAGTGACCGAGCCCGAGGTGAGAATGGTGAATGGCAAACCAAAGAAAGT
TCGTAAACCCAGGACTATTTATTCCAGCTTTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)154499 - 652
Exon 2 To Exon 3 (Pair 10)
Forward (673,22)GTTTCAGAAGACTCAGTACCTCAmplicon SizecDNA: 188 bpgenomic: 1,307
Reverse (860,20)GCGAGTTACACGCCATTGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.285 kcal/mol
Forward Dimers-1.572 kcal/mol
Reverse Loops0.733 kcal/mol
Reverse Dimers-2.199 kcal/mol
Forward-Reverse Dimers-1.935 kcal/mol
Amplicon Folding-2.966 kcal/mol outside primersite
Amplicon SequenceGTTTCAGAAGACTCAGTACCTCGCCTTGCCGGAACGCGCCGAGCTGGCCGCCTCGCTGGG
ATTGACACAAACACAGGTGAAAATCTGGTTTCAGAACAAAAGATCCAAGATCAAGAAGAT
CATGAAAAACGGGGAGATGCCCCCGGAGCACAGTCCCAGCTCCAGCGACCCAATGGCGTG
TAACTCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)188673 - 860
Exon 2 To Exon 3 (Pair 9)
Forward (717,19)TGGCCGCCTCGCTGGGATTAmplicon SizecDNA: 144 bpgenomic: 1,263
Reverse (860,20)GCGAGTTACACGCCATTGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.927 kcal/mol in 3' area
Forward Dimers-2.658 kcal/mol
Reverse Loops0.733 kcal/mol
Reverse Dimers-2.199 kcal/mol
Forward-Reverse Dimers-2.936 kcal/mol
Amplicon Folding-2.393 kcal/mol outside primersite
Amplicon SequenceTGGCCGCCTCGCTGGGATTGACACAAACACAGGTGAAAATCTGGTTTCAGAACAAAAGAT
CCAAGATCAAGAAGATCATGAAAAACGGGGAGATGCCCCCGGAGCACAGTCCCAGCTCCA
GCGACCCAATGGCGTGTAACTCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)144717 - 860
Exon 2 To Exon 3 (Pair 8)
Forward (719,19)GCCGCCTCGCTGGGATTGAAmplicon SizecDNA: 142 bpgenomic: 1,261
Reverse (860,20)GCGAGTTACACGCCATTGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.927 kcal/mol
Forward Dimers-0.434 kcal/mol
Reverse Loops0.733 kcal/mol
Reverse Dimers-2.199 kcal/mol
Forward-Reverse Dimers-2.936 kcal/mol
Amplicon Folding-2.393 kcal/mol outside primersite
Amplicon SequenceGCCGCCTCGCTGGGATTGACACAAACACAGGTGAAAATCTGGTTTCAGAACAAAAGATCC
AAGATCAAGAAGATCATGAAAAACGGGGAGATGCCCCCGGAGCACAGTCCCAGCTCCAGC
GACCCAATGGCGTGTAACTCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)142719 - 860
Exon 2 To Exon 3 (Pair 7)
Forward (720,19)CCGCCTCGCTGGGATTGACAmplicon SizecDNA: 137 bpgenomic: 1,256
Reverse (856,20)GTTACACGCCATTGGGTCGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.927 kcal/mol
Forward Dimers-0.434 kcal/mol
Reverse Loops1.045 kcal/mol in 3' area
Reverse Dimers-1.009 kcal/mol
Forward-Reverse Dimers-1.147 kcal/mol
Amplicon Folding-2.393 kcal/mol outside primersite
Amplicon SequenceCCGCCTCGCTGGGATTGACACAAACACAGGTGAAAATCTGGTTTCAGAACAAAAGATCCA
AGATCAAGAAGATCATGAAAAACGGGGAGATGCCCCCGGAGCACAGTCCCAGCTCCAGCG
ACCCAATGGCGTGTAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)137720 - 856
Exon 2 To Exon 3 (Pair 6)
Forward (682,20)GACTCAGTACCTCGCCTTGCAmplicon SizecDNA: 179 bpgenomic: 1,298
Reverse (860,20)GCGAGTTACACGCCATTGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.765 kcal/mol
Forward Dimers-1.572 kcal/mol
Reverse Loops0.733 kcal/mol
Reverse Dimers-2.199 kcal/mol
Forward-Reverse Dimers-2.952 kcal/mol
Amplicon Folding-2.966 kcal/mol outside primersite
Amplicon SequenceGACTCAGTACCTCGCCTTGCCGGAACGCGCCGAGCTGGCCGCCTCGCTGGGATTGACACA
AACACAGGTGAAAATCTGGTTTCAGAACAAAAGATCCAAGATCAAGAAGATCATGAAAAA
CGGGGAGATGCCCCCGGAGCACAGTCCCAGCTCCAGCGACCCAATGGCGTGTAACTCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)179682 - 860
Exon 2 To Exon 3 (Pair 5)
Forward (719,19)GCCGCCTCGCTGGGATTGAAmplicon SizecDNA: 138 bpgenomic: 1,257
Reverse (856,20)GTTACACGCCATTGGGTCGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.927 kcal/mol
Forward Dimers-0.434 kcal/mol
Reverse Loops1.045 kcal/mol in 3' area
Reverse Dimers-1.009 kcal/mol
Forward-Reverse Dimers-1.147 kcal/mol
Amplicon Folding-2.393 kcal/mol outside primersite
Amplicon SequenceGCCGCCTCGCTGGGATTGACACAAACACAGGTGAAAATCTGGTTTCAGAACAAAAGATCC
AAGATCAAGAAGATCATGAAAAACGGGGAGATGCCCCCGGAGCACAGTCCCAGCTCCAGC
GACCCAATGGCGTGTAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)138719 - 856
Exon 2 To Exon 3 (Pair 4)
Forward (717,19)TGGCCGCCTCGCTGGGATTAmplicon SizecDNA: 140 bpgenomic: 1,259
Reverse (856,20)GTTACACGCCATTGGGTCGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.927 kcal/mol in 3' area
Forward Dimers-2.658 kcal/mol
Reverse Loops1.045 kcal/mol in 3' area
Reverse Dimers-1.009 kcal/mol
Forward-Reverse Dimers-2.044 kcal/mol
Amplicon Folding-2.393 kcal/mol outside primersite
Amplicon SequenceTGGCCGCCTCGCTGGGATTGACACAAACACAGGTGAAAATCTGGTTTCAGAACAAAAGAT
CCAAGATCAAGAAGATCATGAAAAACGGGGAGATGCCCCCGGAGCACAGTCCCAGCTCCA
GCGACCCAATGGCGTGTAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)140717 - 856
Exon 2 To Exon 3 (Pair 3)
Forward (720,19)CCGCCTCGCTGGGATTGACAmplicon SizecDNA: 141 bpgenomic: 1,260
Reverse (860,20)GCGAGTTACACGCCATTGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.927 kcal/mol
Forward Dimers-0.434 kcal/mol
Reverse Loops0.733 kcal/mol
Reverse Dimers-2.199 kcal/mol
Forward-Reverse Dimers-2.936 kcal/mol
Amplicon Folding-2.393 kcal/mol outside primersite
Amplicon SequenceCCGCCTCGCTGGGATTGACACAAACACAGGTGAAAATCTGGTTTCAGAACAAAAGATCCA
AGATCAAGAAGATCATGAAAAACGGGGAGATGCCCCCGGAGCACAGTCCCAGCTCCAGCG
ACCCAATGGCGTGTAACTCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)141720 - 860
Exon 2 To Exon 3 (Pair 2)
Forward (674,22)TTTCAGAAGACTCAGTACCTCGAmplicon SizecDNA: 187 bpgenomic: 1,306
Reverse (860,20)GCGAGTTACACGCCATTGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.285 kcal/mol
Forward Dimers-1.572 kcal/mol
Reverse Loops0.733 kcal/mol
Reverse Dimers-2.199 kcal/mol
Forward-Reverse Dimers-1.935 kcal/mol
Amplicon Folding-2.966 kcal/mol outside primersite
Amplicon SequenceTTTCAGAAGACTCAGTACCTCGCCTTGCCGGAACGCGCCGAGCTGGCCGCCTCGCTGGGA
TTGACACAAACACAGGTGAAAATCTGGTTTCAGAACAAAAGATCCAAGATCAAGAAGATC
ATGAAAAACGGGGAGATGCCCCCGGAGCACAGTCCCAGCTCCAGCGACCCAATGGCGTGT
AACTCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)187674 - 860
Exon 2 To Exon 3 (Pair 1)
Forward (722,20)GCCTCGCTGGGATTGACACAAmplicon SizecDNA: 139 bpgenomic: 1,258
Reverse (860,20)GCGAGTTACACGCCATTGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.927 kcal/mol
Forward Dimers-0.434 kcal/mol
Reverse Loops0.733 kcal/mol
Reverse Dimers-2.199 kcal/mol
Forward-Reverse Dimers-2.936 kcal/mol
Amplicon Folding-2.393 kcal/mol outside primersite
Amplicon SequenceGCCTCGCTGGGATTGACACAAACACAGGTGAAAATCTGGTTTCAGAACAAAAGATCCAAG
ATCAAGAAGATCATGAAAAACGGGGAGATGCCCCCGGAGCACAGTCCCAGCTCCAGCGAC
CCAATGGCGTGTAACTCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005221 (DLX5)139722 - 860
 

See below for some more details.

Program Output:

Loading ...