Design Results for EDN1

(Canis Lupus Familiaris, Broad CanFam3.1/canFam3)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size150
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size750

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 3 (Pair 1)
Forward (385,21)TCATCTGGGTCAACACTCCTGAmplicon SizecDNA: 82 bpgenomic: 1,037
Reverse (466,24)AAATCCTTTAAAGATCGCTTAGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.103 kcal/mol in 3' area
Forward Dimers-0.203 kcal/mol
Reverse Loops0.862 kcal/mol in 3' area
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceTCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGT
CTAAGCGATCTTTAAAGGATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)82383 - 464
Exon 2 To Exon 3 (Pair 2)
Forward (354,22)AAAGAGTGTGTCTACTTCTGCCAmplicon SizecDNA: 78 bpgenomic: 1,033
Reverse (431,22)TCCAAGTCCATACGGAACAATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.621 kcal/mol
Forward Dimers-1.162 kcal/mol
Reverse Loops0.593 kcal/mol
Reverse Dimers-0.375 kcal/mol
Forward-Reverse Dimers-1.928 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTCCTGAGCACATT
GTTCCGTATGGACTTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)78352 - 429
Exon 2 To Exon 3 (Pair 3)
Forward (354,22)AAAGAGTGTGTCTACTTCTGCCAmplicon SizecDNA: 83 bpgenomic: 1,038
Reverse (436,20)GGGCTTCCAAGTCCATACGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.621 kcal/mol
Forward Dimers-1.162 kcal/mol
Reverse Loops0.374 kcal/mol
Reverse Dimers-1.884 kcal/mol
Forward-Reverse Dimers-1.928 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTCCTGAGCACATT
GTTCCGTATGGACTTGGAAGCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)83352 - 434
Exon 2 To Exon 3 (Pair 4)
Forward (380,22)TGACATCATCTGGGTCAACACTAmplicon SizecDNA: 133 bpgenomic: 1,088
Reverse (512,21)AGCACACTGGCATCTCTTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.186 kcal/mol
Forward Dimers-0.852 kcal/mol
Reverse Loops1.168 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-0.64 kcal/mol
Amplicon Folding0.016 kcal/mol inside primersite
Amplicon SequenceTGACATCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTC
TAGGTCTAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGACCACAGGAAGAG
ATGCCAGTGTGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)133378 - 510
Exon 2 To Exon 3 (Pair 5)
Forward (386,21)CATCTGGGTCAACACTCCTGAAmplicon SizecDNA: 107 bpgenomic: 1,062
Reverse (492,22)TGTGGTCTGTTGCCTTTGTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.344 kcal/mol in 3' area
Forward Dimers-0.203 kcal/mol
Reverse Loops1.303 kcal/mol
Reverse Dimers0.136 kcal/mol
Forward-Reverse Dimers-1.654 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTC
TAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGACCACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)107384 - 490
Exon 2 To Exon 3 (Pair 6)
Forward (386,21)CATCTGGGTCAACACTCCTGAAmplicon SizecDNA: 128 bpgenomic: 1,083
Reverse (513,21)TAGCACACTGGCATCTCTTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.344 kcal/mol in 3' area
Forward Dimers-0.203 kcal/mol
Reverse Loops1.168 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-0.595 kcal/mol
Amplicon Folding0.016 kcal/mol inside primersite
Amplicon SequenceCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTC
TAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGACCACAGGAAGAGATGCCA
GTGTGCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)128384 - 511
Exon 2 To Exon 3 (Pair 7)
Forward (344,22)CCTGATGGATAAAGAGTGTGTCAmplicon SizecDNA: 123 bpgenomic: 1,078
Reverse (466,24)AAATCCTTTAAAGATCGCTTAGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.035 kcal/mol
Forward Dimers-0.273 kcal/mol
Reverse Loops0.862 kcal/mol in 3' area
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.876 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTCC
TGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCTTTAAAGGA
TTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)123342 - 464
Exon 2 To Exon 3 (Pair 8)
Forward (354,22)AAAGAGTGTGTCTACTTCTGCCAmplicon SizecDNA: 139 bpgenomic: 1,094
Reverse (492,22)TGTGGTCTGTTGCCTTTGTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.621 kcal/mol
Forward Dimers-1.162 kcal/mol
Reverse Loops1.303 kcal/mol
Reverse Dimers0.136 kcal/mol
Forward-Reverse Dimers-1.285 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTCCTGAGCACATT
GTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCTTTAAAGGATTTATTTATC
ACAAAGGCAACAGACCACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)139352 - 490
Exon 2 To Exon 3 (Pair 9)
Forward (386,21)CATCTGGGTCAACACTCCTGAAmplicon SizecDNA: 129 bpgenomic: 1,084
Reverse (514,21)CTAGCACACTGGCATCTCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.344 kcal/mol in 3' area
Forward Dimers-0.203 kcal/mol
Reverse Loops1.168 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-0.595 kcal/mol
Amplicon Folding0.016 kcal/mol inside primersite
Amplicon SequenceCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTC
TAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGACCACAGGAAGAGATGCCA
GTGTGCTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)129384 - 512
Exon 2 To Exon 3 (Pair 10)
Forward (383,21)CATCATCTGGGTCAACACTCCAmplicon SizecDNA: 131 bpgenomic: 1,086
Reverse (513,21)TAGCACACTGGCATCTCTTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.897 kcal/mol
Forward Dimers-0.203 kcal/mol
Reverse Loops1.168 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-0.595 kcal/mol
Amplicon Folding0.016 kcal/mol inside primersite
Amplicon SequenceCATCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAG
GTCTAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGACCACAGGAAGAGATG
CCAGTGTGCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)131381 - 511
Exon 2 To Exon 3 (Pair 11)
Forward (385,21)TCATCTGGGTCAACACTCCTGAmplicon SizecDNA: 129 bpgenomic: 1,084
Reverse (513,21)TAGCACACTGGCATCTCTTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.103 kcal/mol in 3' area
Forward Dimers-0.203 kcal/mol
Reverse Loops1.168 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-0.595 kcal/mol
Amplicon Folding0.016 kcal/mol inside primersite
Amplicon SequenceTCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGT
CTAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGACCACAGGAAGAGATGCC
AGTGTGCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)129383 - 511
Exon 2 To Exon 3 (Pair 12)
Forward (329,20)CTGCTCCTGCTCTTCCCTGAAmplicon SizecDNA: 134 bpgenomic: 1,089
Reverse (462,23)CCTTTAAAGATCGCTTAGACCTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.128 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.383 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCTGCTCCTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCAT
CTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAA
GCGATCTTTAAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)134327 - 460
Exon 2 To Exon 3 (Pair 13)
Forward (385,21)TCATCTGGGTCAACACTCCTGAmplicon SizecDNA: 130 bpgenomic: 1,085
Reverse (514,21)CTAGCACACTGGCATCTCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.103 kcal/mol in 3' area
Forward Dimers-0.203 kcal/mol
Reverse Loops1.168 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-0.595 kcal/mol
Amplicon Folding0.016 kcal/mol inside primersite
Amplicon SequenceTCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGT
CTAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGACCACAGGAAGAGATGCC
AGTGTGCTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)130383 - 512
Exon 2 To Exon 3 (Pair 14)
Forward (326,19)GCGCTGCTCCTGCTCTTCCAmplicon SizecDNA: 137 bpgenomic: 1,092
Reverse (462,23)CCTTTAAAGATCGCTTAGACCTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.128 kcal/mol
Forward Dimers-2.526 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.714 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceGCGCTGCTCCTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACAT
CATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTC
TAAGCGATCTTTAAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)137324 - 460
Exon 2 To Exon 3 (Pair 15)
Forward (332,20)CTCCTGCTCTTCCCTGATGGAmplicon SizecDNA: 114 bpgenomic: 1,069
Reverse (445,21)GACCTAGAAGGGCTTCCAAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.326 kcal/mol in 3' area
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops0.853 kcal/mol
Reverse Dimers-1.34 kcal/mol
Forward-Reverse Dimers-2.906 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCTCCTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTG
GGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)114330 - 443
Exon 2 To Exon 3 (Pair 16)
Forward (354,22)AAAGAGTGTGTCTACTTCTGCCAmplicon SizecDNA: 150 bpgenomic: 1,105
Reverse (503,21)GCATCTCTTCCTGTGGTCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.621 kcal/mol
Forward Dimers-1.162 kcal/mol
Reverse Loops2.087 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.099 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTCCTGAGCACATT
GTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCTTTAAAGGATTTATTTATC
ACAAAGGCAACAGACCACAGGAAGAGATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)150352 - 501
Exon 2 To Exon 3 (Pair 17)
Forward (342,22)TCCCTGATGGATAAAGAGTGTGAmplicon SizecDNA: 120 bpgenomic: 1,075
Reverse (461,23)CTTTAAAGATCGCTTAGACCTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.406 kcal/mol
Forward-Reverse Dimers-1.385 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACT
CCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCTTTAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)120340 - 459
Exon 2 To Exon 3 (Pair 18)
Forward (342,22)TCCCTGATGGATAAAGAGTGTGAmplicon SizecDNA: 97 bpgenomic: 1,052
Reverse (438,21)AAGGGCTTCCAAGTCCATACGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops0.047 kcal/mol
Reverse Dimers-2.211 kcal/mol
Forward-Reverse Dimers-2.906 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACT
CCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)97340 - 436
Exon 2 To Exon 3 (Pair 19)
Forward (343,22)CCCTGATGGATAAAGAGTGTGTAmplicon SizecDNA: 122 bpgenomic: 1,077
Reverse (464,23)ATCCTTTAAAGATCGCTTAGACCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.82 kcal/mol
Forward Dimers-0.273 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.385 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTC
CTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCTTTAAAGG
AT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)122341 - 462
Exon 2 To Exon 3 (Pair 20)
Forward (331,20)GCTCCTGCTCTTCCCTGATGAmplicon SizecDNA: 131 bpgenomic: 1,086
Reverse (461,23)CTTTAAAGATCGCTTAGACCTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.399 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.406 kcal/mol
Forward-Reverse Dimers-1.383 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceGCTCCTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCT
GGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGC
GATCTTTAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)131329 - 459
Exon 2 To Exon 3 (Pair 21)
Forward (332,20)CTCCTGCTCTTCCCTGATGGAmplicon SizecDNA: 135 bpgenomic: 1,090
Reverse (466,24)AAATCCTTTAAAGATCGCTTAGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.326 kcal/mol in 3' area
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops0.862 kcal/mol in 3' area
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.383 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCTCCTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTG
GGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCG
ATCTTTAAAGGATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)135330 - 464
Exon 2 To Exon 3 (Pair 22)
Forward (386,21)CATCTGGGTCAACACTCCTGAAmplicon SizecDNA: 118 bpgenomic: 1,073
Reverse (503,21)GCATCTCTTCCTGTGGTCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.344 kcal/mol in 3' area
Forward Dimers-0.203 kcal/mol
Reverse Loops2.087 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.856 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTC
TAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGACCACAGGAAGAGATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)118384 - 501
Exon 2 To Exon 3 (Pair 23)
Forward (344,22)CCTGATGGATAAAGAGTGTGTCAmplicon SizecDNA: 120 bpgenomic: 1,075
Reverse (463,23)TCCTTTAAAGATCGCTTAGACCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.035 kcal/mol
Forward Dimers-0.273 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.385 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTCC
TGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCTTTAAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)120342 - 461
Exon 2 To Exon 3 (Pair 24)
Forward (332,20)CTCCTGCTCTTCCCTGATGGAmplicon SizecDNA: 133 bpgenomic: 1,088
Reverse (464,23)ATCCTTTAAAGATCGCTTAGACCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.326 kcal/mol in 3' area
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.383 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCTCCTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTG
GGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCG
ATCTTTAAAGGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)133330 - 462
Exon 2 To Exon 3 (Pair 25)
Forward (336,22)TGCTCTTCCCTGATGGATAAAGAmplicon SizecDNA: 109 bpgenomic: 1,064
Reverse (444,21)ACCTAGAAGGGCTTCCAAGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops0.853 kcal/mol
Reverse Dimers-1.34 kcal/mol
Forward-Reverse Dimers-2.906 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTC
AACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)109334 - 442
Exon 2 To Exon 3 (Pair 26)
Forward (385,21)TCATCTGGGTCAACACTCCTGAmplicon SizecDNA: 126 bpgenomic: 1,081
Reverse (510,21)CACACTGGCATCTCTTCCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.103 kcal/mol in 3' area
Forward Dimers-0.203 kcal/mol
Reverse Loops1.878 kcal/mol in 3' area
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-0.595 kcal/mol
Amplicon Folding0.227 kcal/mol inside primersite
Amplicon SequenceTCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGT
CTAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGACCACAGGAAGAGATGCC
AGTGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)126383 - 508
Exon 2 To Exon 3 (Pair 27)
Forward (354,22)AAAGAGTGTGTCTACTTCTGCCAmplicon SizecDNA: 109 bpgenomic: 1,064
Reverse (462,23)CCTTTAAAGATCGCTTAGACCTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.621 kcal/mol
Forward Dimers-1.162 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.621 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTCCTGAGCACATT
GTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCTTTAAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)109352 - 460
Exon 2 To Exon 3 (Pair 28)
Forward (385,21)TCATCTGGGTCAACACTCCTGAmplicon SizecDNA: 128 bpgenomic: 1,083
Reverse (512,21)AGCACACTGGCATCTCTTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.103 kcal/mol in 3' area
Forward Dimers-0.203 kcal/mol
Reverse Loops1.168 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-0.595 kcal/mol
Amplicon Folding0.016 kcal/mol inside primersite
Amplicon SequenceTCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGT
CTAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGACCACAGGAAGAGATGCC
AGTGTGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)128383 - 510
Exon 2 To Exon 3 (Pair 29)
Forward (344,22)CCTGATGGATAAAGAGTGTGTCAmplicon SizecDNA: 88 bpgenomic: 1,043
Reverse (431,22)TCCAAGTCCATACGGAACAATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.035 kcal/mol
Forward Dimers-0.273 kcal/mol
Reverse Loops0.593 kcal/mol
Reverse Dimers-0.375 kcal/mol
Forward-Reverse Dimers-2.731 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTCC
TGAGCACATTGTTCCGTATGGACTTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)88342 - 429
Exon 2 To Exon 3 (Pair 30)
Forward (335,22)CTGCTCTTCCCTGATGGATAAAAmplicon SizecDNA: 130 bpgenomic: 1,085
Reverse (464,23)ATCCTTTAAAGATCGCTTAGACCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.383 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGT
CAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATC
TTTAAAGGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)130333 - 462
Exon 2 To Exon 3 (Pair 31)
Forward (332,20)CTCCTGCTCTTCCCTGATGGAmplicon SizecDNA: 131 bpgenomic: 1,086
Reverse (462,23)CCTTTAAAGATCGCTTAGACCTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.326 kcal/mol in 3' area
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.383 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCTCCTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTG
GGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCG
ATCTTTAAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)131330 - 460
Exon 2 To Exon 3 (Pair 32)
Forward (336,22)TGCTCTTCCCTGATGGATAAAGAmplicon SizecDNA: 127 bpgenomic: 1,082
Reverse (462,23)CCTTTAAAGATCGCTTAGACCTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.383 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTC
AACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCT
TTAAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)127334 - 460
Exon 2 To Exon 3 (Pair 33)
Forward (380,22)TGACATCATCTGGGTCAACACTAmplicon SizecDNA: 87 bpgenomic: 1,042
Reverse (466,24)AAATCCTTTAAAGATCGCTTAGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.186 kcal/mol
Forward Dimers-0.852 kcal/mol
Reverse Loops0.862 kcal/mol in 3' area
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceTGACATCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTC
TAGGTCTAAGCGATCTTTAAAGGATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)87378 - 464
Exon 2 To Exon 3 (Pair 34)
Forward (326,19)GCGCTGCTCCTGCTCTTCCAmplicon SizecDNA: 139 bpgenomic: 1,094
Reverse (464,23)ATCCTTTAAAGATCGCTTAGACCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.128 kcal/mol
Forward Dimers-2.526 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.714 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceGCGCTGCTCCTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACAT
CATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTC
TAAGCGATCTTTAAAGGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)139324 - 462
Exon 2 To Exon 3 (Pair 35)
Forward (383,21)CATCATCTGGGTCAACACTCCAmplicon SizecDNA: 130 bpgenomic: 1,085
Reverse (512,21)AGCACACTGGCATCTCTTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.897 kcal/mol
Forward Dimers-0.203 kcal/mol
Reverse Loops1.168 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-0.595 kcal/mol
Amplicon Folding0.016 kcal/mol inside primersite
Amplicon SequenceCATCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAG
GTCTAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGACCACAGGAAGAGATG
CCAGTGTGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)130381 - 510
Exon 2 To Exon 3 (Pair 36)
Forward (386,21)CATCTGGGTCAACACTCCTGAAmplicon SizecDNA: 125 bpgenomic: 1,080
Reverse (510,21)CACACTGGCATCTCTTCCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.344 kcal/mol in 3' area
Forward Dimers-0.203 kcal/mol
Reverse Loops1.878 kcal/mol in 3' area
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-0.595 kcal/mol
Amplicon Folding0.227 kcal/mol inside primersite
Amplicon SequenceCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTC
TAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGACCACAGGAAGAGATGCCA
GTGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)125384 - 508
Exon 2 To Exon 3 (Pair 37)
Forward (336,22)TGCTCTTCCCTGATGGATAAAGAmplicon SizecDNA: 103 bpgenomic: 1,058
Reverse (438,21)AAGGGCTTCCAAGTCCATACGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops0.047 kcal/mol
Reverse Dimers-2.211 kcal/mol
Forward-Reverse Dimers-2.906 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTC
AACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)103334 - 436
Exon 2 To Exon 3 (Pair 38)
Forward (343,22)CCCTGATGGATAAAGAGTGTGTAmplicon SizecDNA: 121 bpgenomic: 1,076
Reverse (463,23)TCCTTTAAAGATCGCTTAGACCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.82 kcal/mol
Forward Dimers-0.273 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.385 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTC
CTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCTTTAAAGG
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)121341 - 461
Exon 2 To Exon 3 (Pair 39)
Forward (383,21)CATCATCTGGGTCAACACTCCAmplicon SizecDNA: 132 bpgenomic: 1,087
Reverse (514,21)CTAGCACACTGGCATCTCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.897 kcal/mol
Forward Dimers-0.203 kcal/mol
Reverse Loops1.168 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-0.595 kcal/mol
Amplicon Folding0.016 kcal/mol inside primersite
Amplicon SequenceCATCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAG
GTCTAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGACCACAGGAAGAGATG
CCAGTGTGCTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)132381 - 512
Exon 2 To Exon 3 (Pair 40)
Forward (380,22)TGACATCATCTGGGTCAACACTAmplicon SizecDNA: 131 bpgenomic: 1,086
Reverse (510,21)CACACTGGCATCTCTTCCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.186 kcal/mol
Forward Dimers-0.852 kcal/mol
Reverse Loops1.878 kcal/mol in 3' area
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-0.64 kcal/mol
Amplicon Folding0.227 kcal/mol inside primersite
Amplicon SequenceTGACATCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTC
TAGGTCTAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGACCACAGGAAGAG
ATGCCAGTGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)131378 - 508
Exon 2 To Exon 3 (Pair 41)
Forward (343,22)CCCTGATGGATAAAGAGTGTGTAmplicon SizecDNA: 119 bpgenomic: 1,074
Reverse (461,23)CTTTAAAGATCGCTTAGACCTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.82 kcal/mol
Forward Dimers-0.273 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.406 kcal/mol
Forward-Reverse Dimers-1.385 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTC
CTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCTTTAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)119341 - 459
Exon 2 To Exon 3 (Pair 42)
Forward (354,22)AAAGAGTGTGTCTACTTCTGCCAmplicon SizecDNA: 144 bpgenomic: 1,099
Reverse (497,21)CTTCCTGTGGTCTGTTGCCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.621 kcal/mol
Forward Dimers-1.162 kcal/mol
Reverse Loops1.303 kcal/mol in 3' area
Reverse Dimers0.136 kcal/mol in 3' area
Forward-Reverse Dimers-1.078 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTCCTGAGCACATT
GTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCTTTAAAGGATTTATTTATC
ACAAAGGCAACAGACCACAGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)144352 - 495
Exon 2 To Exon 3 (Pair 43)
Forward (386,21)CATCTGGGTCAACACTCCTGAAmplicon SizecDNA: 81 bpgenomic: 1,036
Reverse (466,24)AAATCCTTTAAAGATCGCTTAGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.344 kcal/mol in 3' area
Forward Dimers-0.203 kcal/mol
Reverse Loops0.862 kcal/mol in 3' area
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTC
TAAGCGATCTTTAAAGGATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)81384 - 464
Exon 2 To Exon 3 (Pair 44)
Forward (329,20)CTGCTCCTGCTCTTCCCTGAAmplicon SizecDNA: 138 bpgenomic: 1,093
Reverse (466,24)AAATCCTTTAAAGATCGCTTAGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.128 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops0.862 kcal/mol in 3' area
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.383 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCTGCTCCTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCAT
CTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAA
GCGATCTTTAAAGGATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)138327 - 464
Exon 2 To Exon 3 (Pair 45)
Forward (385,21)TCATCTGGGTCAACACTCCTGAmplicon SizecDNA: 80 bpgenomic: 1,035
Reverse (464,23)ATCCTTTAAAGATCGCTTAGACCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.103 kcal/mol in 3' area
Forward Dimers-0.203 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceTCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGT
CTAAGCGATCTTTAAAGGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)80383 - 462
Exon 2 To Exon 3 (Pair 46)
Forward (283,20)AGAAGCCTGCTCCCAGTGCAAmplicon SizecDNA: 149 bpgenomic: 1,104
Reverse (431,22)TCCAAGTCCATACGGAACAATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.292 kcal/mol
Forward Dimers-2 kcal/mol
Reverse Loops0.593 kcal/mol
Reverse Dimers-0.375 kcal/mol
Forward-Reverse Dimers-0.74 kcal/mol
Amplicon Folding-2.088 kcal/mol outside primersite
Amplicon SequenceAGAAGCCTGCTCCCAGTGCACCCTGGCGGCCCCGCCGATCCAAGCGCTGCTCCTGCTCTT
CCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTC
CTGAGCACATTGTTCCGTATGGACTTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)149281 - 429
Exon 2 To Exon 3 (Pair 47)
Forward (326,19)GCGCTGCTCCTGCTCTTCCAmplicon SizecDNA: 138 bpgenomic: 1,093
Reverse (463,23)TCCTTTAAAGATCGCTTAGACCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.128 kcal/mol
Forward Dimers-2.526 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.714 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceGCGCTGCTCCTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACAT
CATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTC
TAAGCGATCTTTAAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)138324 - 461
Exon 2 To Exon 3 (Pair 48)
Forward (385,21)TCATCTGGGTCAACACTCCTGAmplicon SizecDNA: 108 bpgenomic: 1,063
Reverse (492,22)TGTGGTCTGTTGCCTTTGTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.103 kcal/mol in 3' area
Forward Dimers-0.203 kcal/mol
Reverse Loops1.303 kcal/mol
Reverse Dimers0.136 kcal/mol
Forward-Reverse Dimers-1.654 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceTCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGT
CTAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGACCACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)108383 - 490
Exon 2 To Exon 3 (Pair 49)
Forward (336,22)TGCTCTTCCCTGATGGATAAAGAmplicon SizecDNA: 126 bpgenomic: 1,081
Reverse (461,23)CTTTAAAGATCGCTTAGACCTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.406 kcal/mol
Forward-Reverse Dimers-1.383 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTC
AACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCT
TTAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)126334 - 459
Exon 2 To Exon 3 (Pair 50)
Forward (385,21)TCATCTGGGTCAACACTCCTGAmplicon SizecDNA: 104 bpgenomic: 1,059
Reverse (488,24)GTCTGTTGCCTTTGTGATAAATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.103 kcal/mol in 3' area
Forward Dimers-0.203 kcal/mol
Reverse Loops2.179 kcal/mol in 3' area
Reverse Dimers-0.046 kcal/mol
Forward-Reverse Dimers-1.654 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceTCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGT
CTAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)104383 - 486
Exon 2 To Exon 3 (Pair 51)
Forward (326,19)GCGCTGCTCCTGCTCTTCCAmplicon SizecDNA: 106 bpgenomic: 1,061
Reverse (431,22)TCCAAGTCCATACGGAACAATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.128 kcal/mol
Forward Dimers-2.526 kcal/mol
Reverse Loops0.593 kcal/mol
Reverse Dimers-0.375 kcal/mol
Forward-Reverse Dimers-0.7 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceGCGCTGCTCCTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACAT
CATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)106324 - 429
Exon 2 To Exon 3 (Pair 52)
Forward (336,22)TGCTCTTCCCTGATGGATAAAGAmplicon SizecDNA: 110 bpgenomic: 1,065
Reverse (445,21)GACCTAGAAGGGCTTCCAAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops0.853 kcal/mol
Reverse Dimers-1.34 kcal/mol
Forward-Reverse Dimers-2.906 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTC
AACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)110334 - 443
Exon 2 To Exon 3 (Pair 53)
Forward (342,22)TCCCTGATGGATAAAGAGTGTGAmplicon SizecDNA: 121 bpgenomic: 1,076
Reverse (462,23)CCTTTAAAGATCGCTTAGACCTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.385 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACT
CCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCTTTAAAG
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)121340 - 460
Exon 2 To Exon 3 (Pair 54)
Forward (383,21)CATCATCTGGGTCAACACTCCAmplicon SizecDNA: 82 bpgenomic: 1,037
Reverse (464,23)ATCCTTTAAAGATCGCTTAGACCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.897 kcal/mol
Forward Dimers-0.203 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceCATCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAG
GTCTAAGCGATCTTTAAAGGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)82381 - 462
Exon 2 To Exon 3 (Pair 55)
Forward (342,22)TCCCTGATGGATAAAGAGTGTGAmplicon SizecDNA: 104 bpgenomic: 1,059
Reverse (445,21)GACCTAGAAGGGCTTCCAAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops0.853 kcal/mol
Reverse Dimers-1.34 kcal/mol
Forward-Reverse Dimers-2.906 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACT
CCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)104340 - 443
Exon 2 To Exon 3 (Pair 56)
Forward (331,20)GCTCCTGCTCTTCCCTGATGAmplicon SizecDNA: 133 bpgenomic: 1,088
Reverse (463,23)TCCTTTAAAGATCGCTTAGACCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.399 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.383 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceGCTCCTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCT
GGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGC
GATCTTTAAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)133329 - 461
Exon 2 To Exon 3 (Pair 57)
Forward (343,22)CCCTGATGGATAAAGAGTGTGTAmplicon SizecDNA: 89 bpgenomic: 1,044
Reverse (431,22)TCCAAGTCCATACGGAACAATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.82 kcal/mol
Forward Dimers-0.273 kcal/mol
Reverse Loops0.593 kcal/mol
Reverse Dimers-0.375 kcal/mol
Forward-Reverse Dimers-2.731 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTC
CTGAGCACATTGTTCCGTATGGACTTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)89341 - 429
Exon 2 To Exon 3 (Pair 58)
Forward (335,22)CTGCTCTTCCCTGATGGATAAAAmplicon SizecDNA: 129 bpgenomic: 1,084
Reverse (463,23)TCCTTTAAAGATCGCTTAGACCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.383 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGT
CAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATC
TTTAAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)129333 - 461
Exon 2 To Exon 3 (Pair 59)
Forward (331,20)GCTCCTGCTCTTCCCTGATGAmplicon SizecDNA: 106 bpgenomic: 1,061
Reverse (436,20)GGGCTTCCAAGTCCATACGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.399 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops0.374 kcal/mol
Reverse Dimers-1.884 kcal/mol
Forward-Reverse Dimers-1.256 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceGCTCCTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCT
GGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)106329 - 434
Exon 2 To Exon 3 (Pair 60)
Forward (329,20)CTGCTCCTGCTCTTCCCTGAAmplicon SizecDNA: 133 bpgenomic: 1,088
Reverse (461,23)CTTTAAAGATCGCTTAGACCTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.128 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.406 kcal/mol
Forward-Reverse Dimers-1.383 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCTGCTCCTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCAT
CTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAA
GCGATCTTTAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)133327 - 459
Exon 2 To Exon 3 (Pair 61)
Forward (385,21)TCATCTGGGTCAACACTCCTGAmplicon SizecDNA: 119 bpgenomic: 1,074
Reverse (503,21)GCATCTCTTCCTGTGGTCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.103 kcal/mol in 3' area
Forward Dimers-0.203 kcal/mol
Reverse Loops2.087 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.856 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceTCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGT
CTAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGACCACAGGAAGAGATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)119383 - 501
Exon 2 To Exon 3 (Pair 62)
Forward (354,22)AAAGAGTGTGTCTACTTCTGCCAmplicon SizecDNA: 113 bpgenomic: 1,068
Reverse (466,24)AAATCCTTTAAAGATCGCTTAGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.621 kcal/mol
Forward Dimers-1.162 kcal/mol
Reverse Loops0.862 kcal/mol in 3' area
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.621 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTCCTGAGCACATT
GTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCTTTAAAGGATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)113352 - 464
Exon 2 To Exon 3 (Pair 63)
Forward (344,22)CCTGATGGATAAAGAGTGTGTCAmplicon SizecDNA: 149 bpgenomic: 1,104
Reverse (492,22)TGTGGTCTGTTGCCTTTGTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.035 kcal/mol
Forward Dimers-0.273 kcal/mol
Reverse Loops1.303 kcal/mol
Reverse Dimers0.136 kcal/mol
Forward-Reverse Dimers-1.31 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTCC
TGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCTTTAAAGGA
TTTATTTATCACAAAGGCAACAGACCACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)149342 - 490
Exon 2 To Exon 3 (Pair 64)
Forward (380,22)TGACATCATCTGGGTCAACACTAmplicon SizecDNA: 134 bpgenomic: 1,089
Reverse (513,21)TAGCACACTGGCATCTCTTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.186 kcal/mol
Forward Dimers-0.852 kcal/mol
Reverse Loops1.168 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-0.64 kcal/mol
Amplicon Folding0.016 kcal/mol inside primersite
Amplicon SequenceTGACATCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTC
TAGGTCTAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGACCACAGGAAGAG
ATGCCAGTGTGCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)134378 - 511
Exon 2 To Exon 3 (Pair 65)
Forward (331,20)GCTCCTGCTCTTCCCTGATGAmplicon SizecDNA: 101 bpgenomic: 1,056
Reverse (431,22)TCCAAGTCCATACGGAACAATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.399 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops0.593 kcal/mol
Reverse Dimers-0.375 kcal/mol
Forward-Reverse Dimers-0.74 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceGCTCCTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCT
GGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)101329 - 429
Exon 2 To Exon 3 (Pair 66)
Forward (336,22)TGCTCTTCCCTGATGGATAAAGAmplicon SizecDNA: 128 bpgenomic: 1,083
Reverse (463,23)TCCTTTAAAGATCGCTTAGACCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.383 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTC
AACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCT
TTAAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)128334 - 461
Exon 2 To Exon 3 (Pair 67)
Forward (342,22)TCCCTGATGGATAAAGAGTGTGAmplicon SizecDNA: 103 bpgenomic: 1,058
Reverse (444,21)ACCTAGAAGGGCTTCCAAGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops0.853 kcal/mol
Reverse Dimers-1.34 kcal/mol
Forward-Reverse Dimers-2.906 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACT
CCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)103340 - 442
Exon 2 To Exon 3 (Pair 68)
Forward (354,22)AAAGAGTGTGTCTACTTCTGCCAmplicon SizecDNA: 108 bpgenomic: 1,063
Reverse (461,23)CTTTAAAGATCGCTTAGACCTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.621 kcal/mol
Forward Dimers-1.162 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.406 kcal/mol
Forward-Reverse Dimers-1.621 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTCCTGAGCACATT
GTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCTTTAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)108352 - 459
Exon 2 To Exon 3 (Pair 69)
Forward (335,22)CTGCTCTTCCCTGATGGATAAAAmplicon SizecDNA: 111 bpgenomic: 1,066
Reverse (445,21)GACCTAGAAGGGCTTCCAAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops0.853 kcal/mol
Reverse Dimers-1.34 kcal/mol
Forward-Reverse Dimers-2.906 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGT
CAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)111333 - 443
Exon 2 To Exon 3 (Pair 70)
Forward (386,21)CATCTGGGTCAACACTCCTGAAmplicon SizecDNA: 103 bpgenomic: 1,058
Reverse (488,24)GTCTGTTGCCTTTGTGATAAATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.344 kcal/mol in 3' area
Forward Dimers-0.203 kcal/mol
Reverse Loops2.179 kcal/mol in 3' area
Reverse Dimers-0.046 kcal/mol
Forward-Reverse Dimers-1.654 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTC
TAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)103384 - 486
Exon 2 To Exon 3 (Pair 71)
Forward (386,21)CATCTGGGTCAACACTCCTGAAmplicon SizecDNA: 108 bpgenomic: 1,063
Reverse (493,21)CTGTGGTCTGTTGCCTTTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.344 kcal/mol in 3' area
Forward Dimers-0.203 kcal/mol
Reverse Loops1.303 kcal/mol
Reverse Dimers0.136 kcal/mol
Forward-Reverse Dimers-1.654 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTC
TAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGACCACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)108384 - 491
Exon 2 To Exon 3 (Pair 72)
Forward (342,22)TCCCTGATGGATAAAGAGTGTGAmplicon SizecDNA: 90 bpgenomic: 1,045
Reverse (431,22)TCCAAGTCCATACGGAACAATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops0.593 kcal/mol
Reverse Dimers-0.375 kcal/mol
Forward-Reverse Dimers-2.731 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACT
CCTGAGCACATTGTTCCGTATGGACTTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)90340 - 429
Exon 2 To Exon 3 (Pair 73)
Forward (332,20)CTCCTGCTCTTCCCTGATGGAmplicon SizecDNA: 132 bpgenomic: 1,087
Reverse (463,23)TCCTTTAAAGATCGCTTAGACCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.326 kcal/mol in 3' area
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.383 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCTCCTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTG
GGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCG
ATCTTTAAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)132330 - 461
Exon 2 To Exon 3 (Pair 74)
Forward (343,22)CCCTGATGGATAAAGAGTGTGTAmplicon SizecDNA: 124 bpgenomic: 1,079
Reverse (466,24)AAATCCTTTAAAGATCGCTTAGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.82 kcal/mol
Forward Dimers-0.273 kcal/mol
Reverse Loops0.862 kcal/mol in 3' area
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.876 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTC
CTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCTTTAAAGG
ATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)124341 - 464
Exon 2 To Exon 3 (Pair 75)
Forward (385,21)TCATCTGGGTCAACACTCCTGAmplicon SizecDNA: 109 bpgenomic: 1,064
Reverse (493,21)CTGTGGTCTGTTGCCTTTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.103 kcal/mol in 3' area
Forward Dimers-0.203 kcal/mol
Reverse Loops1.303 kcal/mol
Reverse Dimers0.136 kcal/mol
Forward-Reverse Dimers-1.654 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceTCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGT
CTAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGACCACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)109383 - 491
Exon 2 To Exon 3 (Pair 76)
Forward (386,21)CATCTGGGTCAACACTCCTGAAmplicon SizecDNA: 79 bpgenomic: 1,034
Reverse (464,23)ATCCTTTAAAGATCGCTTAGACCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.344 kcal/mol in 3' area
Forward Dimers-0.203 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTC
TAAGCGATCTTTAAAGGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)79384 - 462
Exon 2 To Exon 3 (Pair 77)
Forward (385,21)TCATCTGGGTCAACACTCCTGAmplicon SizecDNA: 111 bpgenomic: 1,066
Reverse (495,21)TCCTGTGGTCTGTTGCCTTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.103 kcal/mol in 3' area
Forward Dimers-0.203 kcal/mol
Reverse Loops1.303 kcal/mol in 3' area
Reverse Dimers0.136 kcal/mol
Forward-Reverse Dimers-1.654 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceTCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGT
CTAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGACCACAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)111383 - 493
Exon 2 To Exon 3 (Pair 78)
Forward (343,22)CCCTGATGGATAAAGAGTGTGTAmplicon SizecDNA: 146 bpgenomic: 1,101
Reverse (488,24)GTCTGTTGCCTTTGTGATAAATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.82 kcal/mol
Forward Dimers-0.273 kcal/mol
Reverse Loops2.179 kcal/mol in 3' area
Reverse Dimers-0.046 kcal/mol
Forward-Reverse Dimers-1.31 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTC
CTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCTTTAAAGG
ATTTATTTATCACAAAGGCAACAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)146341 - 486
Exon 2 To Exon 3 (Pair 79)
Forward (354,22)AAAGAGTGTGTCTACTTCTGCCAmplicon SizecDNA: 111 bpgenomic: 1,066
Reverse (464,23)ATCCTTTAAAGATCGCTTAGACCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.621 kcal/mol
Forward Dimers-1.162 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.621 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTCCTGAGCACATT
GTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCTTTAAAGGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)111352 - 462
Exon 2 To Exon 3 (Pair 80)
Forward (336,22)TGCTCTTCCCTGATGGATAAAGAmplicon SizecDNA: 96 bpgenomic: 1,051
Reverse (431,22)TCCAAGTCCATACGGAACAATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops0.593 kcal/mol
Reverse Dimers-0.375 kcal/mol
Forward-Reverse Dimers-2.731 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTC
AACACTCCTGAGCACATTGTTCCGTATGGACTTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)96334 - 429
Exon 2 To Exon 3 (Pair 81)
Forward (342,22)TCCCTGATGGATAAAGAGTGTGAmplicon SizecDNA: 151 bpgenomic: 1,106
Reverse (492,22)TGTGGTCTGTTGCCTTTGTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops1.303 kcal/mol
Reverse Dimers0.136 kcal/mol
Forward-Reverse Dimers-1.31 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACT
CCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCTTTAAAG
GATTTATTTATCACAAAGGCAACAGACCACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)151340 - 490
Exon 2 To Exon 3 (Pair 82)
Forward (354,22)AAAGAGTGTGTCTACTTCTGCCAmplicon SizecDNA: 110 bpgenomic: 1,065
Reverse (463,23)TCCTTTAAAGATCGCTTAGACCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.621 kcal/mol
Forward Dimers-1.162 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.621 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTCCTGAGCACATT
GTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCTTTAAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)110352 - 461
Exon 2 To Exon 3 (Pair 83)
Forward (385,21)TCATCTGGGTCAACACTCCTGAmplicon SizecDNA: 121 bpgenomic: 1,076
Reverse (505,21)TGGCATCTCTTCCTGTGGTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.103 kcal/mol in 3' area
Forward Dimers-0.203 kcal/mol
Reverse Loops2.087 kcal/mol in 3' area
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-0.856 kcal/mol
Amplicon Folding0.247 kcal/mol inside primersite
Amplicon SequenceTCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGT
CTAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGACCACAGGAAGAGATGCC
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)121383 - 503
Exon 2 To Exon 3 (Pair 84)
Forward (344,22)CCTGATGGATAAAGAGTGTGTCAmplicon SizecDNA: 121 bpgenomic: 1,076
Reverse (464,23)ATCCTTTAAAGATCGCTTAGACCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.035 kcal/mol
Forward Dimers-0.273 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.385 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTCC
TGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCTTTAAAGGA
T
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)121342 - 462
Exon 2 To Exon 3 (Pair 85)
Forward (331,20)GCTCCTGCTCTTCCCTGATGAmplicon SizecDNA: 132 bpgenomic: 1,087
Reverse (462,23)CCTTTAAAGATCGCTTAGACCTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.399 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.383 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceGCTCCTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCT
GGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGC
GATCTTTAAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)132329 - 460
Exon 2 To Exon 3 (Pair 86)
Forward (386,21)CATCTGGGTCAACACTCCTGAAmplicon SizecDNA: 109 bpgenomic: 1,064
Reverse (494,21)CCTGTGGTCTGTTGCCTTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.344 kcal/mol in 3' area
Forward Dimers-0.203 kcal/mol
Reverse Loops1.303 kcal/mol
Reverse Dimers0.136 kcal/mol
Forward-Reverse Dimers-1.654 kcal/mol
Amplicon Folding0.445 kcal/mol outside primersite
Amplicon SequenceCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTC
TAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGACCACAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)109384 - 492
Exon 2 To Exon 3 (Pair 87)
Forward (380,22)TGACATCATCTGGGTCAACACTAmplicon SizecDNA: 135 bpgenomic: 1,090
Reverse (514,21)CTAGCACACTGGCATCTCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.186 kcal/mol
Forward Dimers-0.852 kcal/mol
Reverse Loops1.168 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-0.64 kcal/mol
Amplicon Folding0.016 kcal/mol inside primersite
Amplicon SequenceTGACATCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTC
TAGGTCTAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGACCACAGGAAGAG
ATGCCAGTGTGCTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)135378 - 512
Exon 2 To Exon 3 (Pair 88)
Forward (386,21)CATCTGGGTCAACACTCCTGAAmplicon SizecDNA: 120 bpgenomic: 1,075
Reverse (505,21)TGGCATCTCTTCCTGTGGTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.344 kcal/mol in 3' area
Forward Dimers-0.203 kcal/mol
Reverse Loops2.087 kcal/mol in 3' area
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-0.856 kcal/mol
Amplicon Folding0.247 kcal/mol inside primersite
Amplicon SequenceCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTC
TAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGACCACAGGAAGAGATGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)120384 - 503
Exon 2 To Exon 3 (Pair 89)
Forward (386,21)CATCTGGGTCAACACTCCTGAAmplicon SizecDNA: 127 bpgenomic: 1,082
Reverse (512,21)AGCACACTGGCATCTCTTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.344 kcal/mol in 3' area
Forward Dimers-0.203 kcal/mol
Reverse Loops1.168 kcal/mol
Reverse Dimers-0.793 kcal/mol
Forward-Reverse Dimers-0.595 kcal/mol
Amplicon Folding0.016 kcal/mol inside primersite
Amplicon SequenceCATCTGGGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTC
TAAGCGATCTTTAAAGGATTTATTTATCACAAAGGCAACAGACCACAGGAAGAGATGCCA
GTGTGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)127384 - 510
Exon 2 To Exon 3 (Pair 90)
Forward (332,20)CTCCTGCTCTTCCCTGATGGAmplicon SizecDNA: 130 bpgenomic: 1,085
Reverse (461,23)CTTTAAAGATCGCTTAGACCTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.326 kcal/mol in 3' area
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.406 kcal/mol
Forward-Reverse Dimers-1.383 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCTCCTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTG
GGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCG
ATCTTTAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)130330 - 459
Exon 2 To Exon 3 (Pair 91)
Forward (342,22)TCCCTGATGGATAAAGAGTGTGAmplicon SizecDNA: 123 bpgenomic: 1,078
Reverse (464,23)ATCCTTTAAAGATCGCTTAGACCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.385 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACT
CCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCTTTAAAG
GAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)123340 - 462
Exon 2 To Exon 3 (Pair 92)
Forward (336,22)TGCTCTTCCCTGATGGATAAAGAmplicon SizecDNA: 129 bpgenomic: 1,084
Reverse (464,23)ATCCTTTAAAGATCGCTTAGACCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.383 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTC
AACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCT
TTAAAGGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)129334 - 462
Exon 2 To Exon 3 (Pair 93)
Forward (342,22)TCCCTGATGGATAAAGAGTGTGAmplicon SizecDNA: 122 bpgenomic: 1,077
Reverse (463,23)TCCTTTAAAGATCGCTTAGACCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.385 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACT
CCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCTTTAAAG
GA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)122340 - 461
Exon 2 To Exon 3 (Pair 94)
Forward (343,22)CCCTGATGGATAAAGAGTGTGTAmplicon SizecDNA: 150 bpgenomic: 1,105
Reverse (492,22)TGTGGTCTGTTGCCTTTGTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.82 kcal/mol
Forward Dimers-0.273 kcal/mol
Reverse Loops1.303 kcal/mol
Reverse Dimers0.136 kcal/mol
Forward-Reverse Dimers-1.31 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTC
CTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCTTTAAAGG
ATTTATTTATCACAAAGGCAACAGACCACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)150341 - 490
Exon 2 To Exon 3 (Pair 95)
Forward (342,22)TCCCTGATGGATAAAGAGTGTGAmplicon SizecDNA: 125 bpgenomic: 1,080
Reverse (466,24)AAATCCTTTAAAGATCGCTTAGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.515 kcal/mol
Forward Dimers-0.295 kcal/mol
Reverse Loops0.862 kcal/mol in 3' area
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.876 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACT
CCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCTTTAAAG
GATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)125340 - 464
Exon 2 To Exon 3 (Pair 96)
Forward (354,22)AAAGAGTGTGTCTACTTCTGCCAmplicon SizecDNA: 85 bpgenomic: 1,040
Reverse (438,21)AAGGGCTTCCAAGTCCATACGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.621 kcal/mol
Forward Dimers-1.162 kcal/mol
Reverse Loops0.047 kcal/mol
Reverse Dimers-2.211 kcal/mol
Forward-Reverse Dimers-1.928 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTCCTGAGCACATT
GTTCCGTATGGACTTGGAAGCCCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)85352 - 436
Exon 2 To Exon 3 (Pair 97)
Forward (332,20)CTCCTGCTCTTCCCTGATGGAmplicon SizecDNA: 113 bpgenomic: 1,068
Reverse (444,21)ACCTAGAAGGGCTTCCAAGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.326 kcal/mol in 3' area
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops0.853 kcal/mol
Reverse Dimers-1.34 kcal/mol
Forward-Reverse Dimers-2.906 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCTCCTGCTCTTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTG
GGTCAACACTCCTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)113330 - 442
Exon 2 To Exon 3 (Pair 98)
Forward (344,22)CCTGATGGATAAAGAGTGTGTCAmplicon SizecDNA: 119 bpgenomic: 1,074
Reverse (462,23)CCTTTAAAGATCGCTTAGACCTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.035 kcal/mol
Forward Dimers-0.273 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.828 kcal/mol
Forward-Reverse Dimers-1.385 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTCC
TGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCTTTAAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)119342 - 460
Exon 2 To Exon 3 (Pair 99)
Forward (344,22)CCTGATGGATAAAGAGTGTGTCAmplicon SizecDNA: 118 bpgenomic: 1,073
Reverse (461,23)CTTTAAAGATCGCTTAGACCTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.035 kcal/mol
Forward Dimers-0.273 kcal/mol
Reverse Loops0.862 kcal/mol
Reverse Dimers-2.406 kcal/mol
Forward-Reverse Dimers-1.385 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTCC
TGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTCTAAGCGATCTTTAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)118342 - 459
Exon 2 To Exon 3 (Pair 100)
Forward (343,22)CCCTGATGGATAAAGAGTGTGTAmplicon SizecDNA: 103 bpgenomic: 1,058
Reverse (445,21)GACCTAGAAGGGCTTCCAAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.82 kcal/mol
Forward Dimers-0.273 kcal/mol
Reverse Loops0.853 kcal/mol
Reverse Dimers-1.34 kcal/mol
Forward-Reverse Dimers-2.601 kcal/mol
Amplicon Folding-0.185 kcal/mol outside primersite
Amplicon SequenceCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTTGACATCATCTGGGTCAACACTC
CTGAGCACATTGTTCCGTATGGACTTGGAAGCCCTTCTAGGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001002956 (EDN1)103341 - 443
 

See below for some more details.

Program Output:

Loading ...