Design Results for EHMT1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 3 To Exon 4 (Pair 1)
Forward (647,20)CGCAAGACCATGCCGAAGTCAmplicon SizecDNA: 137 bpgenomic: 11,303
Reverse (783,21)AGCTGCTGTCGTCCAAAGTCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.096 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-2.672 kcal/mol
Forward-Reverse Dimers-0.895 kcal/mol
Amplicon Folding0.054 kcal/mol inside primersite
Amplicon SequenceCGCAAGACCATGCCGAAGTCCGTCGTGGGCCTGCATGCAGCCAGTAAAGATCCCAGAGAA
GTTCGAGAAGCTAGAGATCATAAGGAACCAAAAGAGGAGATCAACAAAAACATTTCTGAC
TTTGGACGACAGCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)137647 - 783
NM_024757 (EHMT1)137647 - 783
Exon 3 To Exon 4 (Pair 2)
Forward (653,20)ACCATGCCGAAGTCCGTCGTAmplicon SizecDNA: 126 bpgenomic: 11,292
Reverse (778,22)CTGTCGTCCAAAGTCAGAAATGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.349 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops1.027 kcal/mol in 3' area
Reverse Dimers-0.232 kcal/mol
Forward-Reverse Dimers-0.766 kcal/mol
Amplicon Folding0.054 kcal/mol inside primersite
Amplicon SequenceACCATGCCGAAGTCCGTCGTGGGCCTGCATGCAGCCAGTAAAGATCCCAGAGAAGTTCGA
GAAGCTAGAGATCATAAGGAACCAAAAGAGGAGATCAACAAAAACATTTCTGACTTTGGA
CGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)126653 - 778
NM_001145527 (EHMT1)126653 - 778
Exon 3 To Exon 4 (Pair 3)
Forward (647,20)CGCAAGACCATGCCGAAGTCAmplicon SizecDNA: 132 bpgenomic: 11,298
Reverse (778,22)CTGTCGTCCAAAGTCAGAAATGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.096 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.027 kcal/mol in 3' area
Reverse Dimers-0.232 kcal/mol
Forward-Reverse Dimers-0.766 kcal/mol
Amplicon Folding0.054 kcal/mol inside primersite
Amplicon SequenceCGCAAGACCATGCCGAAGTCCGTCGTGGGCCTGCATGCAGCCAGTAAAGATCCCAGAGAA
GTTCGAGAAGCTAGAGATCATAAGGAACCAAAAGAGGAGATCAACAAAAACATTTCTGAC
TTTGGACGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)132647 - 778
NM_024757 (EHMT1)132647 - 778
Exon 3 To Exon 4 (Pair 4)
Forward (653,20)ACCATGCCGAAGTCCGTCGTAmplicon SizecDNA: 131 bpgenomic: 11,297
Reverse (783,21)AGCTGCTGTCGTCCAAAGTCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.349 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-2.672 kcal/mol
Forward-Reverse Dimers-0.766 kcal/mol
Amplicon Folding0.054 kcal/mol inside primersite
Amplicon SequenceACCATGCCGAAGTCCGTCGTGGGCCTGCATGCAGCCAGTAAAGATCCCAGAGAAGTTCGA
GAAGCTAGAGATCATAAGGAACCAAAAGAGGAGATCAACAAAAACATTTCTGACTTTGGA
CGACAGCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)131653 - 783
NM_001145527 (EHMT1)131653 - 783
Exon 3 To Exon 4 (Pair 5)
Forward (651,20)AGACCATGCCGAAGTCCGTCAmplicon SizecDNA: 126 bpgenomic: 11,292
Reverse (776,23)GTCGTCCAAAGTCAGAAATGTTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.349 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops0.999 kcal/mol in 3' area
Reverse Dimers0.088 kcal/mol in 3' area
Forward-Reverse Dimers-0.766 kcal/mol
Amplicon Folding0.054 kcal/mol inside primersite
Amplicon SequenceAGACCATGCCGAAGTCCGTCGTGGGCCTGCATGCAGCCAGTAAAGATCCCAGAGAAGTTC
GAGAAGCTAGAGATCATAAGGAACCAAAAGAGGAGATCAACAAAAACATTTCTGACTTTG
GACGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)126651 - 776
NM_024757 (EHMT1)126651 - 776
Exon 3 To Exon 4 (Pair 6)
Forward (647,20)CGCAAGACCATGCCGAAGTCAmplicon SizecDNA: 130 bpgenomic: 11,296
Reverse (776,23)GTCGTCCAAAGTCAGAAATGTTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.096 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops0.999 kcal/mol in 3' area
Reverse Dimers0.088 kcal/mol in 3' area
Forward-Reverse Dimers-0.766 kcal/mol
Amplicon Folding0.054 kcal/mol inside primersite
Amplicon SequenceCGCAAGACCATGCCGAAGTCCGTCGTGGGCCTGCATGCAGCCAGTAAAGATCCCAGAGAA
GTTCGAGAAGCTAGAGATCATAAGGAACCAAAAGAGGAGATCAACAAAAACATTTCTGAC
TTTGGACGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)130647 - 776
NM_001145527 (EHMT1)130647 - 776
Exon 3 To Exon 4 (Pair 7)
Forward (651,20)AGACCATGCCGAAGTCCGTCAmplicon SizecDNA: 127 bpgenomic: 11,293
Reverse (777,23)TGTCGTCCAAAGTCAGAAATGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.349 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops0.999 kcal/mol in 3' area
Reverse Dimers0.088 kcal/mol in 3' area
Forward-Reverse Dimers-0.766 kcal/mol
Amplicon Folding0.054 kcal/mol inside primersite
Amplicon SequenceAGACCATGCCGAAGTCCGTCGTGGGCCTGCATGCAGCCAGTAAAGATCCCAGAGAAGTTC
GAGAAGCTAGAGATCATAAGGAACCAAAAGAGGAGATCAACAAAAACATTTCTGACTTTG
GACGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)127651 - 777
NM_001145527 (EHMT1)127651 - 777
Exon 3 To Exon 4 (Pair 8)
Forward (649,20)CAAGACCATGCCGAAGTCCGAmplicon SizecDNA: 129 bpgenomic: 11,295
Reverse (777,23)TGTCGTCCAAAGTCAGAAATGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.377 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops0.999 kcal/mol in 3' area
Reverse Dimers0.088 kcal/mol in 3' area
Forward-Reverse Dimers-0.766 kcal/mol
Amplicon Folding0.054 kcal/mol inside primersite
Amplicon SequenceCAAGACCATGCCGAAGTCCGTCGTGGGCCTGCATGCAGCCAGTAAAGATCCCAGAGAAGT
TCGAGAAGCTAGAGATCATAAGGAACCAAAAGAGGAGATCAACAAAAACATTTCTGACTT
TGGACGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)129649 - 777
NM_024757 (EHMT1)129649 - 777
Exon 3 To Exon 4 (Pair 9)
Forward (649,20)CAAGACCATGCCGAAGTCCGAmplicon SizecDNA: 135 bpgenomic: 11,301
Reverse (783,21)AGCTGCTGTCGTCCAAAGTCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.377 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-2.672 kcal/mol
Forward-Reverse Dimers-0.895 kcal/mol
Amplicon Folding0.054 kcal/mol inside primersite
Amplicon SequenceCAAGACCATGCCGAAGTCCGTCGTGGGCCTGCATGCAGCCAGTAAAGATCCCAGAGAAGT
TCGAGAAGCTAGAGATCATAAGGAACCAAAAGAGGAGATCAACAAAAACATTTCTGACTT
TGGACGACAGCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)135649 - 783
NM_001145527 (EHMT1)135649 - 783
Exon 3 To Exon 4 (Pair 10)
Forward (648,20)GCAAGACCATGCCGAAGTCCAmplicon SizecDNA: 129 bpgenomic: 11,295
Reverse (776,23)GTCGTCCAAAGTCAGAAATGTTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.143 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops0.999 kcal/mol in 3' area
Reverse Dimers0.088 kcal/mol in 3' area
Forward-Reverse Dimers-0.766 kcal/mol
Amplicon Folding0.054 kcal/mol inside primersite
Amplicon SequenceGCAAGACCATGCCGAAGTCCGTCGTGGGCCTGCATGCAGCCAGTAAAGATCCCAGAGAAG
TTCGAGAAGCTAGAGATCATAAGGAACCAAAAGAGGAGATCAACAAAAACATTTCTGACT
TTGGACGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)129648 - 776
NM_024757 (EHMT1)129648 - 776
Exon 3 To Exon 4 (Pair 11)
Forward (648,20)GCAAGACCATGCCGAAGTCCAmplicon SizecDNA: 136 bpgenomic: 11,302
Reverse (783,21)AGCTGCTGTCGTCCAAAGTCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.143 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-2.672 kcal/mol
Forward-Reverse Dimers-0.895 kcal/mol
Amplicon Folding0.054 kcal/mol inside primersite
Amplicon SequenceGCAAGACCATGCCGAAGTCCGTCGTGGGCCTGCATGCAGCCAGTAAAGATCCCAGAGAAG
TTCGAGAAGCTAGAGATCATAAGGAACCAAAAGAGGAGATCAACAAAAACATTTCTGACT
TTGGACGACAGCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)136648 - 783
NM_024757 (EHMT1)136648 - 783
Exon 3 To Exon 4 (Pair 12)
Forward (649,20)CAAGACCATGCCGAAGTCCGAmplicon SizecDNA: 130 bpgenomic: 11,296
Reverse (778,22)CTGTCGTCCAAAGTCAGAAATGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.377 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops1.027 kcal/mol in 3' area
Reverse Dimers-0.232 kcal/mol
Forward-Reverse Dimers-0.766 kcal/mol
Amplicon Folding0.054 kcal/mol inside primersite
Amplicon SequenceCAAGACCATGCCGAAGTCCGTCGTGGGCCTGCATGCAGCCAGTAAAGATCCCAGAGAAGT
TCGAGAAGCTAGAGATCATAAGGAACCAAAAGAGGAGATCAACAAAAACATTTCTGACTT
TGGACGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)130649 - 778
NM_024757 (EHMT1)130649 - 778
Exon 3 To Exon 4 (Pair 13)
Forward (651,20)AGACCATGCCGAAGTCCGTCAmplicon SizecDNA: 128 bpgenomic: 11,294
Reverse (778,22)CTGTCGTCCAAAGTCAGAAATGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.349 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops1.027 kcal/mol in 3' area
Reverse Dimers-0.232 kcal/mol
Forward-Reverse Dimers-0.766 kcal/mol
Amplicon Folding0.054 kcal/mol inside primersite
Amplicon SequenceAGACCATGCCGAAGTCCGTCGTGGGCCTGCATGCAGCCAGTAAAGATCCCAGAGAAGTTC
GAGAAGCTAGAGATCATAAGGAACCAAAAGAGGAGATCAACAAAAACATTTCTGACTTTG
GACGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)128651 - 778
NM_024757 (EHMT1)128651 - 778
Exon 3 To Exon 4 (Pair 14)
Forward (653,20)ACCATGCCGAAGTCCGTCGTAmplicon SizecDNA: 125 bpgenomic: 11,291
Reverse (777,23)TGTCGTCCAAAGTCAGAAATGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.349 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops0.999 kcal/mol in 3' area
Reverse Dimers0.088 kcal/mol in 3' area
Forward-Reverse Dimers-0.766 kcal/mol
Amplicon Folding0.054 kcal/mol inside primersite
Amplicon SequenceACCATGCCGAAGTCCGTCGTGGGCCTGCATGCAGCCAGTAAAGATCCCAGAGAAGTTCGA
GAAGCTAGAGATCATAAGGAACCAAAAGAGGAGATCAACAAAAACATTTCTGACTTTGGA
CGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)125653 - 777
NM_001145527 (EHMT1)125653 - 777
Exon 3 To Exon 4 (Pair 15)
Forward (649,20)CAAGACCATGCCGAAGTCCGAmplicon SizecDNA: 128 bpgenomic: 11,294
Reverse (776,23)GTCGTCCAAAGTCAGAAATGTTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.377 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops0.999 kcal/mol in 3' area
Reverse Dimers0.088 kcal/mol in 3' area
Forward-Reverse Dimers-0.766 kcal/mol
Amplicon Folding0.054 kcal/mol inside primersite
Amplicon SequenceCAAGACCATGCCGAAGTCCGTCGTGGGCCTGCATGCAGCCAGTAAAGATCCCAGAGAAGT
TCGAGAAGCTAGAGATCATAAGGAACCAAAAGAGGAGATCAACAAAAACATTTCTGACTT
TGGACGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)128649 - 776
NM_024757 (EHMT1)128649 - 776
Exon 3 To Exon 4 (Pair 16)
Forward (647,20)CGCAAGACCATGCCGAAGTCAmplicon SizecDNA: 131 bpgenomic: 11,297
Reverse (777,23)TGTCGTCCAAAGTCAGAAATGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.096 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops0.999 kcal/mol in 3' area
Reverse Dimers0.088 kcal/mol in 3' area
Forward-Reverse Dimers-0.766 kcal/mol
Amplicon Folding0.054 kcal/mol inside primersite
Amplicon SequenceCGCAAGACCATGCCGAAGTCCGTCGTGGGCCTGCATGCAGCCAGTAAAGATCCCAGAGAA
GTTCGAGAAGCTAGAGATCATAAGGAACCAAAAGAGGAGATCAACAAAAACATTTCTGAC
TTTGGACGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)131647 - 777
NM_024757 (EHMT1)131647 - 777
Exon 3 To Exon 4 (Pair 17)
Forward (653,20)ACCATGCCGAAGTCCGTCGTAmplicon SizecDNA: 124 bpgenomic: 11,290
Reverse (776,23)GTCGTCCAAAGTCAGAAATGTTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.349 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops0.999 kcal/mol in 3' area
Reverse Dimers0.088 kcal/mol in 3' area
Forward-Reverse Dimers-0.766 kcal/mol
Amplicon Folding0.054 kcal/mol inside primersite
Amplicon SequenceACCATGCCGAAGTCCGTCGTGGGCCTGCATGCAGCCAGTAAAGATCCCAGAGAAGTTCGA
GAAGCTAGAGATCATAAGGAACCAAAAGAGGAGATCAACAAAAACATTTCTGACTTTGGA
CGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)124653 - 776
NM_024757 (EHMT1)124653 - 776
Exon 3 To Exon 4 (Pair 18)
Forward (648,20)GCAAGACCATGCCGAAGTCCAmplicon SizecDNA: 130 bpgenomic: 11,296
Reverse (777,23)TGTCGTCCAAAGTCAGAAATGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.143 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops0.999 kcal/mol in 3' area
Reverse Dimers0.088 kcal/mol in 3' area
Forward-Reverse Dimers-0.766 kcal/mol
Amplicon Folding0.054 kcal/mol inside primersite
Amplicon SequenceGCAAGACCATGCCGAAGTCCGTCGTGGGCCTGCATGCAGCCAGTAAAGATCCCAGAGAAG
TTCGAGAAGCTAGAGATCATAAGGAACCAAAAGAGGAGATCAACAAAAACATTTCTGACT
TTGGACGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)130648 - 777
NM_024757 (EHMT1)130648 - 777
Exon 3 To Exon 4 (Pair 19)
Forward (648,20)GCAAGACCATGCCGAAGTCCAmplicon SizecDNA: 131 bpgenomic: 11,297
Reverse (778,22)CTGTCGTCCAAAGTCAGAAATGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.143 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.027 kcal/mol in 3' area
Reverse Dimers-0.232 kcal/mol
Forward-Reverse Dimers-0.766 kcal/mol
Amplicon Folding0.054 kcal/mol inside primersite
Amplicon SequenceGCAAGACCATGCCGAAGTCCGTCGTGGGCCTGCATGCAGCCAGTAAAGATCCCAGAGAAG
TTCGAGAAGCTAGAGATCATAAGGAACCAAAAGAGGAGATCAACAAAAACATTTCTGACT
TTGGACGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)131648 - 778
NM_001145527 (EHMT1)131648 - 778
Exon 3 To Exon 4 (Pair 20)
Forward (651,20)AGACCATGCCGAAGTCCGTCAmplicon SizecDNA: 133 bpgenomic: 11,299
Reverse (783,21)AGCTGCTGTCGTCCAAAGTCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.349 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-2.672 kcal/mol
Forward-Reverse Dimers-0.766 kcal/mol
Amplicon Folding0.054 kcal/mol inside primersite
Amplicon SequenceAGACCATGCCGAAGTCCGTCGTGGGCCTGCATGCAGCCAGTAAAGATCCCAGAGAAGTTC
GAGAAGCTAGAGATCATAAGGAACCAAAAGAGGAGATCAACAAAAACATTTCTGACTTTG
GACGACAGCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)133651 - 783
NM_024757 (EHMT1)133651 - 783
Exon 4 To Exon 5 (Pair 1)
Forward (680,21)CATGCAGCCAGTAAAGATCCCAmplicon SizecDNA: 301 bpgenomic: 15,142
Reverse (980,22)TCTCAATCACCGTCCTCTGTTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.007 kcal/mol
Forward Dimers-1.674 kcal/mol
Reverse Loops2.076 kcal/mol in 3' area
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-0.938 kcal/mol
Amplicon Folding-1.165 kcal/mol outside primersite
Amplicon SequenceCATGCAGCCAGTAAAGATCCCAGAGAAGTTCGAGAAGCTAGAGATCATAAGGAACCAAAA
GAGGAGATCAACAAAAACATTTCTGACTTTGGACGACAGCAGCTTTTACCCCCCTTCCCA
TCCCTTCATCAGTCGCTACCTCAGAACCAGTGCTACATGGCCACCACAAAATCACAGACA
GCTTGCTTGCCTTTTGTTTTAGCAGCTGCAGTATCTCGGAAGAAAAAACGAAGAATGGGA
ACCTATAGCCTGGTTCCTAAGAAAAAGACCAAAGTATTAAAACAGAGGACGGTGATTGAG
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)301680 - 980
NM_024757 (EHMT1)301680 - 980
Exon 4 To Exon 5 (Pair 2)
Forward (758,22)ATTTCTGACTTTGGACGACAGCAmplicon SizecDNA: 241 bpgenomic: 15,082
Reverse (998,24)GAGTTATGCTCTTAAACATCTCAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.703 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops0.977 kcal/mol
Reverse Dimers-0.617 kcal/mol
Forward-Reverse Dimers-1.898 kcal/mol
Amplicon Folding-1.165 kcal/mol outside primersite
Amplicon SequenceATTTCTGACTTTGGACGACAGCAGCTTTTACCCCCCTTCCCATCCCTTCATCAGTCGCTA
CCTCAGAACCAGTGCTACATGGCCACCACAAAATCACAGACAGCTTGCTTGCCTTTTGTT
TTAGCAGCTGCAGTATCTCGGAAGAAAAAACGAAGAATGGGAACCTATAGCCTGGTTCCT
AAGAAAAAGACCAAAGTATTAAAACAGAGGACGGTGATTGAGATGTTTAAGAGCATAACT
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)241758 - 998
NM_024757 (EHMT1)241758 - 998
Exon 4 To Exon 5 (Pair 3)
Forward (758,22)ATTTCTGACTTTGGACGACAGCAmplicon SizecDNA: 249 bpgenomic: 15,090
Reverse (1006,24)AGTGGAATGAGTTATGCTCTTAAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.703 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops0.977 kcal/mol
Reverse Dimers-0.016 kcal/mol
Forward-Reverse Dimers-1.898 kcal/mol
Amplicon Folding-1.165 kcal/mol outside primersite
Amplicon SequenceATTTCTGACTTTGGACGACAGCAGCTTTTACCCCCCTTCCCATCCCTTCATCAGTCGCTA
CCTCAGAACCAGTGCTACATGGCCACCACAAAATCACAGACAGCTTGCTTGCCTTTTGTT
TTAGCAGCTGCAGTATCTCGGAAGAAAAAACGAAGAATGGGAACCTATAGCCTGGTTCCT
AAGAAAAAGACCAAAGTATTAAAACAGAGGACGGTGATTGAGATGTTTAAGAGCATAACT
CATTCCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)249758 - 1006
NM_024757 (EHMT1)249758 - 1006
Exon 4 To Exon 5 (Pair 4)
Forward (758,22)ATTTCTGACTTTGGACGACAGCAmplicon SizecDNA: 251 bpgenomic: 15,092
Reverse (1008,23)ACAGTGGAATGAGTTATGCTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.703 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops0.977 kcal/mol in 3' area
Reverse Dimers-0.33 kcal/mol
Forward-Reverse Dimers-1.898 kcal/mol
Amplicon Folding-1.165 kcal/mol outside primersite
Amplicon SequenceATTTCTGACTTTGGACGACAGCAGCTTTTACCCCCCTTCCCATCCCTTCATCAGTCGCTA
CCTCAGAACCAGTGCTACATGGCCACCACAAAATCACAGACAGCTTGCTTGCCTTTTGTT
TTAGCAGCTGCAGTATCTCGGAAGAAAAAACGAAGAATGGGAACCTATAGCCTGGTTCCT
AAGAAAAAGACCAAAGTATTAAAACAGAGGACGGTGATTGAGATGTTTAAGAGCATAACT
CATTCCACTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)251758 - 1008
NM_024757 (EHMT1)251758 - 1008
Exon 4 To Exon 5 (Pair 5)
Forward (758,22)ATTTCTGACTTTGGACGACAGCAmplicon SizecDNA: 242 bpgenomic: 15,083
Reverse (999,24)TGAGTTATGCTCTTAAACATCTCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.703 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops0.977 kcal/mol
Reverse Dimers-0.617 kcal/mol
Forward-Reverse Dimers-1.898 kcal/mol
Amplicon Folding-1.165 kcal/mol outside primersite
Amplicon SequenceATTTCTGACTTTGGACGACAGCAGCTTTTACCCCCCTTCCCATCCCTTCATCAGTCGCTA
CCTCAGAACCAGTGCTACATGGCCACCACAAAATCACAGACAGCTTGCTTGCCTTTTGTT
TTAGCAGCTGCAGTATCTCGGAAGAAAAAACGAAGAATGGGAACCTATAGCCTGGTTCCT
AAGAAAAAGACCAAAGTATTAAAACAGAGGACGGTGATTGAGATGTTTAAGAGCATAACT
CA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)242758 - 999
NM_024757 (EHMT1)242758 - 999
Exon 4 To Exon 5 (Pair 6)
Forward (758,22)ATTTCTGACTTTGGACGACAGCAmplicon SizecDNA: 252 bpgenomic: 15,093
Reverse (1009,22)CACAGTGGAATGAGTTATGCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.703 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops0.977 kcal/mol in 3' area
Reverse Dimers-0.33 kcal/mol
Forward-Reverse Dimers-1.898 kcal/mol
Amplicon Folding-1.165 kcal/mol outside primersite
Amplicon SequenceATTTCTGACTTTGGACGACAGCAGCTTTTACCCCCCTTCCCATCCCTTCATCAGTCGCTA
CCTCAGAACCAGTGCTACATGGCCACCACAAAATCACAGACAGCTTGCTTGCCTTTTGTT
TTAGCAGCTGCAGTATCTCGGAAGAAAAAACGAAGAATGGGAACCTATAGCCTGGTTCCT
AAGAAAAAGACCAAAGTATTAAAACAGAGGACGGTGATTGAGATGTTTAAGAGCATAACT
CATTCCACTGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)252758 - 1009
NM_024757 (EHMT1)252758 - 1009
Exon 6 To Exon 8 (Pair 1)
Forward (1149,20)CCACAGAGGACAGCAGGACTAmplicon SizecDNA: 193 bpgenomic: 10,195
Reverse (1341,21)CTGTCGGTCTTTCCTTTCCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.527 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.492 kcal/mol
Reverse Dimers0.084 kcal/mol
Forward-Reverse Dimers-2.331 kcal/mol
Amplicon Folding-2.722 kcal/mol outside primersite
Amplicon SequenceCCACAGAGGACAGCAGGACTTCCAAGGAGAGCATGTCGGAGGCTGATCGCGCCCAGAAGA
TGGACGGGGAGTCCGAGGAGGAGCAGGAGTCCGTGGACACCGGGGAGGAGGAGGAAGGCG
GTGACGAGTCTGACCTGAGTTCGGAATCCAGCATTAAGAAGAAATTTCTCAAGAGGAAAG
GAAAGACCGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)1931149 - 1341
NM_024757 (EHMT1)1931149 - 1341
Exon 6 To Exon 8 (Pair 2)
Forward (1121,19)CATGGTGCAGAGCAGGCGGAmplicon SizecDNA: 214 bpgenomic: 10,216
Reverse (1334,24)TCTTTCCTTTCCTCTTGAGAAATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.131 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops0.496 kcal/mol
Reverse Dimers-0.497 kcal/mol
Forward-Reverse Dimers-1.672 kcal/mol
Amplicon Folding-2.722 kcal/mol outside primersite
Amplicon SequenceCATGGTGCAGAGCAGGCGGCCGCGTTCCCCACAGAGGACAGCAGGACTTCCAAGGAGAGC
ATGTCGGAGGCTGATCGCGCCCAGAAGATGGACGGGGAGTCCGAGGAGGAGCAGGAGTCC
GTGGACACCGGGGAGGAGGAGGAAGGCGGTGACGAGTCTGACCTGAGTTCGGAATCCAGC
ATTAAGAAGAAATTTCTCAAGAGGAAAGGAAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)2141121 - 1334
NM_024757 (EHMT1)2141121 - 1334
Exon 6 To Exon 8 (Pair 3)
Forward (1120,19)CCATGGTGCAGAGCAGGCGAmplicon SizecDNA: 228 bpgenomic: 10,230
Reverse (1347,20)CAGGGACTGTCGGTCTTTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.131 kcal/mol in 3' area
Forward Dimers-2.322 kcal/mol
Reverse Loops0.026 kcal/mol
Reverse Dimers-1.004 kcal/mol
Forward-Reverse Dimers-1.532 kcal/mol
Amplicon Folding-2.722 kcal/mol outside primersite
Amplicon SequenceCCATGGTGCAGAGCAGGCGGCCGCGTTCCCCACAGAGGACAGCAGGACTTCCAAGGAGAG
CATGTCGGAGGCTGATCGCGCCCAGAAGATGGACGGGGAGTCCGAGGAGGAGCAGGAGTC
CGTGGACACCGGGGAGGAGGAGGAAGGCGGTGACGAGTCTGACCTGAGTTCGGAATCCAG
CATTAAGAAGAAATTTCTCAAGAGGAAAGGAAAGACCGACAGTCCCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)2281120 - 1347
NM_001145527 (EHMT1)2281120 - 1347
Exon 6 To Exon 8 (Pair 4)
Forward (1149,20)CCACAGAGGACAGCAGGACTAmplicon SizecDNA: 196 bpgenomic: 10,198
Reverse (1344,21)GGACTGTCGGTCTTTCCTTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.527 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.948 kcal/mol
Reverse Dimers-1.004 kcal/mol
Forward-Reverse Dimers-2.874 kcal/mol
Amplicon Folding-2.722 kcal/mol outside primersite
Amplicon SequenceCCACAGAGGACAGCAGGACTTCCAAGGAGAGCATGTCGGAGGCTGATCGCGCCCAGAAGA
TGGACGGGGAGTCCGAGGAGGAGCAGGAGTCCGTGGACACCGGGGAGGAGGAGGAAGGCG
GTGACGAGTCTGACCTGAGTTCGGAATCCAGCATTAAGAAGAAATTTCTCAAGAGGAAAG
GAAAGACCGACAGTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1961149 - 1344
NM_001145527 (EHMT1)1961149 - 1344
Exon 6 To Exon 8 (Pair 5)
Forward (1121,19)CATGGTGCAGAGCAGGCGGAmplicon SizecDNA: 239 bpgenomic: 10,241
Reverse (1359,20)GCTGGCTTGATCCAGGGACTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.131 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops0.276 kcal/mol
Reverse Dimers-1.48 kcal/mol
Forward-Reverse Dimers-2.189 kcal/mol
Amplicon Folding-2.722 kcal/mol outside primersite
Amplicon SequenceCATGGTGCAGAGCAGGCGGCCGCGTTCCCCACAGAGGACAGCAGGACTTCCAAGGAGAGC
ATGTCGGAGGCTGATCGCGCCCAGAAGATGGACGGGGAGTCCGAGGAGGAGCAGGAGTCC
GTGGACACCGGGGAGGAGGAGGAAGGCGGTGACGAGTCTGACCTGAGTTCGGAATCCAGC
ATTAAGAAGAAATTTCTCAAGAGGAAAGGAAAGACCGACAGTCCCTGGATCAAGCCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)2391121 - 1359
NM_024757 (EHMT1)2391121 - 1359
Exon 6 To Exon 8 (Pair 6)
Forward (1122,19)ATGGTGCAGAGCAGGCGGCAmplicon SizecDNA: 213 bpgenomic: 10,215
Reverse (1334,24)TCTTTCCTTTCCTCTTGAGAAATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.838 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol
Reverse Loops0.496 kcal/mol
Reverse Dimers-0.497 kcal/mol
Forward-Reverse Dimers-1.672 kcal/mol
Amplicon Folding-2.722 kcal/mol outside primersite
Amplicon SequenceATGGTGCAGAGCAGGCGGCCGCGTTCCCCACAGAGGACAGCAGGACTTCCAAGGAGAGCA
TGTCGGAGGCTGATCGCGCCCAGAAGATGGACGGGGAGTCCGAGGAGGAGCAGGAGTCCG
TGGACACCGGGGAGGAGGAGGAAGGCGGTGACGAGTCTGACCTGAGTTCGGAATCCAGCA
TTAAGAAGAAATTTCTCAAGAGGAAAGGAAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)2131122 - 1334
NM_001145527 (EHMT1)2131122 - 1334
Exon 6 To Exon 8 (Pair 7)
Forward (1149,20)CCACAGAGGACAGCAGGACTAmplicon SizecDNA: 195 bpgenomic: 10,197
Reverse (1343,21)GACTGTCGGTCTTTCCTTTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.527 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.954 kcal/mol
Reverse Dimers-1.004 kcal/mol
Forward-Reverse Dimers-2.874 kcal/mol
Amplicon Folding-2.722 kcal/mol outside primersite
Amplicon SequenceCCACAGAGGACAGCAGGACTTCCAAGGAGAGCATGTCGGAGGCTGATCGCGCCCAGAAGA
TGGACGGGGAGTCCGAGGAGGAGCAGGAGTCCGTGGACACCGGGGAGGAGGAGGAAGGCG
GTGACGAGTCTGACCTGAGTTCGGAATCCAGCATTAAGAAGAAATTTCTCAAGAGGAAAG
GAAAGACCGACAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1951149 - 1343
NM_001145527 (EHMT1)1951149 - 1343
Exon 6 To Exon 8 (Pair 8)
Forward (1120,19)CCATGGTGCAGAGCAGGCGAmplicon SizecDNA: 215 bpgenomic: 10,217
Reverse (1334,24)TCTTTCCTTTCCTCTTGAGAAATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.131 kcal/mol in 3' area
Forward Dimers-2.322 kcal/mol
Reverse Loops0.496 kcal/mol
Reverse Dimers-0.497 kcal/mol
Forward-Reverse Dimers-1.672 kcal/mol
Amplicon Folding-2.722 kcal/mol outside primersite
Amplicon SequenceCCATGGTGCAGAGCAGGCGGCCGCGTTCCCCACAGAGGACAGCAGGACTTCCAAGGAGAG
CATGTCGGAGGCTGATCGCGCCCAGAAGATGGACGGGGAGTCCGAGGAGGAGCAGGAGTC
CGTGGACACCGGGGAGGAGGAGGAAGGCGGTGACGAGTCTGACCTGAGTTCGGAATCCAG
CATTAAGAAGAAATTTCTCAAGAGGAAAGGAAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)2151120 - 1334
NM_001145527 (EHMT1)2151120 - 1334
Exon 6 To Exon 8 (Pair 9)
Forward (1149,20)CCACAGAGGACAGCAGGACTAmplicon SizecDNA: 198 bpgenomic: 10,200
Reverse (1346,21)AGGGACTGTCGGTCTTTCCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.527 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.5 kcal/mol
Reverse Dimers-1.004 kcal/mol
Forward-Reverse Dimers-2.874 kcal/mol
Amplicon Folding-2.722 kcal/mol outside primersite
Amplicon SequenceCCACAGAGGACAGCAGGACTTCCAAGGAGAGCATGTCGGAGGCTGATCGCGCCCAGAAGA
TGGACGGGGAGTCCGAGGAGGAGCAGGAGTCCGTGGACACCGGGGAGGAGGAGGAAGGCG
GTGACGAGTCTGACCTGAGTTCGGAATCCAGCATTAAGAAGAAATTTCTCAAGAGGAAAG
GAAAGACCGACAGTCCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)1981149 - 1346
NM_024757 (EHMT1)1981149 - 1346
Exon 6 To Exon 8 (Pair 10)
Forward (1121,19)CATGGTGCAGAGCAGGCGGAmplicon SizecDNA: 227 bpgenomic: 10,229
Reverse (1347,20)CAGGGACTGTCGGTCTTTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.131 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops0.026 kcal/mol
Reverse Dimers-1.004 kcal/mol
Forward-Reverse Dimers-1.532 kcal/mol
Amplicon Folding-2.722 kcal/mol outside primersite
Amplicon SequenceCATGGTGCAGAGCAGGCGGCCGCGTTCCCCACAGAGGACAGCAGGACTTCCAAGGAGAGC
ATGTCGGAGGCTGATCGCGCCCAGAAGATGGACGGGGAGTCCGAGGAGGAGCAGGAGTCC
GTGGACACCGGGGAGGAGGAGGAAGGCGGTGACGAGTCTGACCTGAGTTCGGAATCCAGC
ATTAAGAAGAAATTTCTCAAGAGGAAAGGAAAGACCGACAGTCCCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)2271121 - 1347
NM_024757 (EHMT1)2271121 - 1347
Exon 6 To Exon 8 (Pair 11)
Forward (1149,20)CCACAGAGGACAGCAGGACTAmplicon SizecDNA: 211 bpgenomic: 10,213
Reverse (1359,20)GCTGGCTTGATCCAGGGACTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.527 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.276 kcal/mol
Reverse Dimers-1.48 kcal/mol
Forward-Reverse Dimers-2.809 kcal/mol
Amplicon Folding-2.722 kcal/mol outside primersite
Amplicon SequenceCCACAGAGGACAGCAGGACTTCCAAGGAGAGCATGTCGGAGGCTGATCGCGCCCAGAAGA
TGGACGGGGAGTCCGAGGAGGAGCAGGAGTCCGTGGACACCGGGGAGGAGGAGGAAGGCG
GTGACGAGTCTGACCTGAGTTCGGAATCCAGCATTAAGAAGAAATTTCTCAAGAGGAAAG
GAAAGACCGACAGTCCCTGGATCAAGCCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)2111149 - 1359
NM_024757 (EHMT1)2111149 - 1359
Exon 6 To Exon 8 (Pair 12)
Forward (1122,19)ATGGTGCAGAGCAGGCGGCAmplicon SizecDNA: 226 bpgenomic: 10,228
Reverse (1347,20)CAGGGACTGTCGGTCTTTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.838 kcal/mol in 3' area
Forward Dimers-1.072 kcal/mol
Reverse Loops0.026 kcal/mol
Reverse Dimers-1.004 kcal/mol
Forward-Reverse Dimers-1.532 kcal/mol
Amplicon Folding-2.722 kcal/mol outside primersite
Amplicon SequenceATGGTGCAGAGCAGGCGGCCGCGTTCCCCACAGAGGACAGCAGGACTTCCAAGGAGAGCA
TGTCGGAGGCTGATCGCGCCCAGAAGATGGACGGGGAGTCCGAGGAGGAGCAGGAGTCCG
TGGACACCGGGGAGGAGGAGGAAGGCGGTGACGAGTCTGACCTGAGTTCGGAATCCAGCA
TTAAGAAGAAATTTCTCAAGAGGAAAGGAAAGACCGACAGTCCCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)2261122 - 1347
NM_024757 (EHMT1)2261122 - 1347
Exon 6 To Exon 8 (Pair 13)
Forward (1149,20)CCACAGAGGACAGCAGGACTAmplicon SizecDNA: 199 bpgenomic: 10,201
Reverse (1347,20)CAGGGACTGTCGGTCTTTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.527 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.026 kcal/mol
Reverse Dimers-1.004 kcal/mol
Forward-Reverse Dimers-2.874 kcal/mol
Amplicon Folding-2.722 kcal/mol outside primersite
Amplicon SequenceCCACAGAGGACAGCAGGACTTCCAAGGAGAGCATGTCGGAGGCTGATCGCGCCCAGAAGA
TGGACGGGGAGTCCGAGGAGGAGCAGGAGTCCGTGGACACCGGGGAGGAGGAGGAAGGCG
GTGACGAGTCTGACCTGAGTTCGGAATCCAGCATTAAGAAGAAATTTCTCAAGAGGAAAG
GAAAGACCGACAGTCCCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1991149 - 1347
NM_001145527 (EHMT1)1991149 - 1347
Exon 6 To Exon 8 (Pair 14)
Forward (1149,20)CCACAGAGGACAGCAGGACTAmplicon SizecDNA: 197 bpgenomic: 10,199
Reverse (1345,21)GGGACTGTCGGTCTTTCCTTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.527 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.931 kcal/mol
Reverse Dimers-1.004 kcal/mol
Forward-Reverse Dimers-2.874 kcal/mol
Amplicon Folding-2.722 kcal/mol outside primersite
Amplicon SequenceCCACAGAGGACAGCAGGACTTCCAAGGAGAGCATGTCGGAGGCTGATCGCGCCCAGAAGA
TGGACGGGGAGTCCGAGGAGGAGCAGGAGTCCGTGGACACCGGGGAGGAGGAGGAAGGCG
GTGACGAGTCTGACCTGAGTTCGGAATCCAGCATTAAGAAGAAATTTCTCAAGAGGAAAG
GAAAGACCGACAGTCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1971149 - 1345
NM_001145527 (EHMT1)1971149 - 1345
Exon 7 To Exon 9 (Pair 1)
Forward (1219,19)GTCCGAGGAGGAGCAGGAGAmplicon SizecDNA: 211 bpgenomic: 5,561
Reverse (1429,23)AGATGACTTATACGACTCAGAACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.393 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.696 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.787 kcal/mol
Amplicon Folding-2.814 kcal/mol outside primersite
Amplicon SequenceGTCCGAGGAGGAGCAGGAGTCCGTGGACACCGGGGAGGAGGAGGAAGGCGGTGACGAGTC
TGACCTGAGTTCGGAATCCAGCATTAAGAAGAAATTTCTCAAGAGGAAAGGAAAGACCGA
CAGTCCCTGGATCAAGCCAGCCAGGAAAAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGG
TGCCCTCGGTTCTGAGTCGTATAAGTCATCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)2111219 - 1429
NM_024757 (EHMT1)2111219 - 1429
Exon 7 To Exon 9 (Pair 2)
Forward (1219,19)GTCCGAGGAGGAGCAGGAGAmplicon SizecDNA: 213 bpgenomic: 5,563
Reverse (1431,22)GCAGATGACTTATACGACTCAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.393 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.289 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.787 kcal/mol
Amplicon Folding-2.814 kcal/mol outside primersite
Amplicon SequenceGTCCGAGGAGGAGCAGGAGTCCGTGGACACCGGGGAGGAGGAGGAAGGCGGTGACGAGTC
TGACCTGAGTTCGGAATCCAGCATTAAGAAGAAATTTCTCAAGAGGAAAGGAAAGACCGA
CAGTCCCTGGATCAAGCCAGCCAGGAAAAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGG
TGCCCTCGGTTCTGAGTCGTATAAGTCATCTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)2131219 - 1431
NM_024757 (EHMT1)2131219 - 1431
Exon 7 To Exon 9 (Pair 3)
Forward (1217,19)GAGTCCGAGGAGGAGCAGGAmplicon SizecDNA: 213 bpgenomic: 5,563
Reverse (1429,23)AGATGACTTATACGACTCAGAACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.393 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.696 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.906 kcal/mol
Amplicon Folding-2.814 kcal/mol outside primersite
Amplicon SequenceGAGTCCGAGGAGGAGCAGGAGTCCGTGGACACCGGGGAGGAGGAGGAAGGCGGTGACGAG
TCTGACCTGAGTTCGGAATCCAGCATTAAGAAGAAATTTCTCAAGAGGAAAGGAAAGACC
GACAGTCCCTGGATCAAGCCAGCCAGGAAAAGGAGGCGGAGAAGTAGAAAGAAGCCCAGC
GGTGCCCTCGGTTCTGAGTCGTATAAGTCATCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)2131217 - 1429
NM_001145527 (EHMT1)2131217 - 1429
Exon 7 To Exon 9 (Pair 4)
Forward (1219,19)GTCCGAGGAGGAGCAGGAGAmplicon SizecDNA: 212 bpgenomic: 5,562
Reverse (1430,23)CAGATGACTTATACGACTCAGAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.393 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.289 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.787 kcal/mol
Amplicon Folding-2.814 kcal/mol outside primersite
Amplicon SequenceGTCCGAGGAGGAGCAGGAGTCCGTGGACACCGGGGAGGAGGAGGAAGGCGGTGACGAGTC
TGACCTGAGTTCGGAATCCAGCATTAAGAAGAAATTTCTCAAGAGGAAAGGAAAGACCGA
CAGTCCCTGGATCAAGCCAGCCAGGAAAAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGG
TGCCCTCGGTTCTGAGTCGTATAAGTCATCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)2121219 - 1430
NM_001145527 (EHMT1)2121219 - 1430
Exon 7 To Exon 9 (Pair 5)
Forward (1216,19)GGAGTCCGAGGAGGAGCAGAmplicon SizecDNA: 214 bpgenomic: 5,564
Reverse (1429,23)AGATGACTTATACGACTCAGAACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.393 kcal/mol
Forward Dimers-1.324 kcal/mol
Reverse Loops1.696 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.183 kcal/mol
Amplicon Folding-2.814 kcal/mol outside primersite
Amplicon SequenceGGAGTCCGAGGAGGAGCAGGAGTCCGTGGACACCGGGGAGGAGGAGGAAGGCGGTGACGA
GTCTGACCTGAGTTCGGAATCCAGCATTAAGAAGAAATTTCTCAAGAGGAAAGGAAAGAC
CGACAGTCCCTGGATCAAGCCAGCCAGGAAAAGGAGGCGGAGAAGTAGAAAGAAGCCCAG
CGGTGCCCTCGGTTCTGAGTCGTATAAGTCATCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)2141216 - 1429
NM_024757 (EHMT1)2141216 - 1429
Exon 7 To Exon 9 (Pair 6)
Forward (1217,19)GAGTCCGAGGAGGAGCAGGAmplicon SizecDNA: 214 bpgenomic: 5,564
Reverse (1430,23)CAGATGACTTATACGACTCAGAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.393 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.289 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.906 kcal/mol
Amplicon Folding-2.814 kcal/mol outside primersite
Amplicon SequenceGAGTCCGAGGAGGAGCAGGAGTCCGTGGACACCGGGGAGGAGGAGGAAGGCGGTGACGAG
TCTGACCTGAGTTCGGAATCCAGCATTAAGAAGAAATTTCTCAAGAGGAAAGGAAAGACC
GACAGTCCCTGGATCAAGCCAGCCAGGAAAAGGAGGCGGAGAAGTAGAAAGAAGCCCAGC
GGTGCCCTCGGTTCTGAGTCGTATAAGTCATCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)2141217 - 1430
NM_001145527 (EHMT1)2141217 - 1430
Exon 8 To Exon 10 (Pair 1)
Forward (1345,20)CTGGATCAAGCCAGCCAGGAAmplicon SizecDNA: 285 bpgenomic: 8,536
Reverse (1629,21)TCTCGACTCTTCGGTGTTTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.153 kcal/mol in 3' area
Forward Dimers-1.824 kcal/mol
Reverse Loops0.798 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-0.716 kcal/mol
Amplicon Folding-1.892 kcal/mol outside primersite
Amplicon SequenceCTGGATCAAGCCAGCCAGGAAAAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCT
CGGTTCTGAGTCGTATAAGTCATCTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAG
CACAGGGTACATGGAAGTTTCTCTGGACTCCCTGGATCTCCGAGTCAAAGGAATTCTGTC
TTCACAAGCAGAAGGGTTGGCCAACGGTCCAGATGTGCTGGAGACAGACGGCCTCCAGGA
AGTGCCTCTCTGCAGCTGCCGGATGGAAACACCGAAGAGTCGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)2851345 - 1629
NM_024757 (EHMT1)2851345 - 1629
Exon 8 To Exon 9 (Pair 1)
Forward (1309,24)GAAATTTCTCAAGAGGAAAGGAAAAmplicon SizecDNA: 171 bpgenomic: 3,759
Reverse (1479,21)TCCATGTACCCTGTGCTGTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.192 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops2.144 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-1.816 kcal/mol outside primersite
Amplicon SequenceGAAATTTCTCAAGAGGAAAGGAAAGACCGACAGTCCCTGGATCAAGCCAGCCAGGAAAAG
GAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCATC
TGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)1711309 - 1479
NM_024757 (EHMT1)1711309 - 1479
Exon 8 To Exon 10 (Pair 2)
Forward (1368,21)GGAGGCGGAGAAGTAGAAAGAAmplicon SizecDNA: 261 bpgenomic: 8,512
Reverse (1628,21)CTCGACTCTTCGGTGTTTCCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.97 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops0.798 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-2.579 kcal/mol
Amplicon Folding-1.892 kcal/mol outside primersite
Amplicon SequenceGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCAT
CTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTTCTC
TGGACTCCCTGGATCTCCGAGTCAAAGGAATTCTGTCTTCACAAGCAGAAGGGTTGGCCA
ACGGTCCAGATGTGCTGGAGACAGACGGCCTCCAGGAAGTGCCTCTCTGCAGCTGCCGGA
TGGAAACACCGAAGAGTCGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)2611368 - 1628
NM_024757 (EHMT1)2611368 - 1628
Exon 8 To Exon 10 (Pair 3)
Forward (1365,22)AAAGGAGGCGGAGAAGTAGAAAAmplicon SizecDNA: 270 bpgenomic: 8,521
Reverse (1634,21)TGATCTCTCGACTCTTCGGTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.97 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops0.798 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-2.658 kcal/mol
Amplicon Folding-1.892 kcal/mol outside primersite
Amplicon SequenceAAAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGT
CATCTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTT
CTCTGGACTCCCTGGATCTCCGAGTCAAAGGAATTCTGTCTTCACAAGCAGAAGGGTTGG
CCAACGGTCCAGATGTGCTGGAGACAGACGGCCTCCAGGAAGTGCCTCTCTGCAGCTGCC
GGATGGAAACACCGAAGAGTCGAGAGATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)2701365 - 1634
NM_024757 (EHMT1)2701365 - 1634
Exon 8 To Exon 9 (Pair 2)
Forward (1367,21)AGGAGGCGGAGAAGTAGAAAGAmplicon SizecDNA: 118 bpgenomic: 3,706
Reverse (1484,22)AAACTTCCATGTACCCTGTGCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.97 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.75 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-2.272 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCA
TCTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)1181367 - 1484
NM_024757 (EHMT1)1181367 - 1484
Exon 8 To Exon 9 (Pair 3)
Forward (1368,21)GGAGGCGGAGAAGTAGAAAGAAmplicon SizecDNA: 127 bpgenomic: 3,715
Reverse (1494,22)GAGTCCAGAGAAACTTCCATGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.97 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.074 kcal/mol
Reverse Dimers-1.421 kcal/mol
Forward-Reverse Dimers-2.272 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCAT
CTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTTCTC
TGGACTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)1271368 - 1494
NM_024757 (EHMT1)1271368 - 1494
Exon 8 To Exon 10 (Pair 4)
Forward (1345,20)CTGGATCAAGCCAGCCAGGAAmplicon SizecDNA: 286 bpgenomic: 8,537
Reverse (1630,21)CTCTCGACTCTTCGGTGTTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.153 kcal/mol in 3' area
Forward Dimers-1.824 kcal/mol
Reverse Loops0.798 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-0.716 kcal/mol
Amplicon Folding-1.892 kcal/mol outside primersite
Amplicon SequenceCTGGATCAAGCCAGCCAGGAAAAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCT
CGGTTCTGAGTCGTATAAGTCATCTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAG
CACAGGGTACATGGAAGTTTCTCTGGACTCCCTGGATCTCCGAGTCAAAGGAATTCTGTC
TTCACAAGCAGAAGGGTTGGCCAACGGTCCAGATGTGCTGGAGACAGACGGCCTCCAGGA
AGTGCCTCTCTGCAGCTGCCGGATGGAAACACCGAAGAGTCGAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)2861345 - 1630
NM_024757 (EHMT1)2861345 - 1630
Exon 8 To Exon 9 (Pair 4)
Forward (1367,21)AGGAGGCGGAGAAGTAGAAAGAmplicon SizecDNA: 122 bpgenomic: 3,710
Reverse (1488,22)AGAGAAACTTCCATGTACCCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.97 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.548 kcal/mol
Reverse Dimers-0.735 kcal/mol
Forward-Reverse Dimers-2.272 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCA
TCTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTTCT
CT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)1221367 - 1488
NM_024757 (EHMT1)1221367 - 1488
Exon 8 To Exon 9 (Pair 5)
Forward (1323,21)GGAAAGGAAAGACCGACAGTCAmplicon SizecDNA: 160 bpgenomic: 3,748
Reverse (1482,21)ACTTCCATGTACCCTGTGCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.802 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops2.144 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-2.072 kcal/mol
Amplicon Folding-1.816 kcal/mol outside primersite
Amplicon SequenceGGAAAGGAAAGACCGACAGTCCCTGGATCAAGCCAGCCAGGAAAAGGAGGCGGAGAAGTA
GAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCATCTGCAGGAAGCGCTG
AGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1601323 - 1482
NM_001145527 (EHMT1)1601323 - 1482
Exon 8 To Exon 9 (Pair 6)
Forward (1367,21)AGGAGGCGGAGAAGTAGAAAGAmplicon SizecDNA: 113 bpgenomic: 3,701
Reverse (1479,21)TCCATGTACCCTGTGCTGTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.97 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops2.144 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.531 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCA
TCTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1131367 - 1479
NM_001145527 (EHMT1)1131367 - 1479
Exon 8 To Exon 9 (Pair 7)
Forward (1367,21)AGGAGGCGGAGAAGTAGAAAGAmplicon SizecDNA: 121 bpgenomic: 3,709
Reverse (1487,22)GAGAAACTTCCATGTACCCTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.97 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.739 kcal/mol
Reverse Dimers-0.735 kcal/mol
Forward-Reverse Dimers-2.272 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCA
TCTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTTCT
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1211367 - 1487
NM_001145527 (EHMT1)1211367 - 1487
Exon 8 To Exon 9 (Pair 8)
Forward (1368,21)GGAGGCGGAGAAGTAGAAAGAAmplicon SizecDNA: 124 bpgenomic: 3,712
Reverse (1491,22)TCCAGAGAAACTTCCATGTACCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.97 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.074 kcal/mol
Reverse Dimers-0.735 kcal/mol
Forward-Reverse Dimers-2.272 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCAT
CTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTTCTC
TGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1241368 - 1491
NM_001145527 (EHMT1)1241368 - 1491
Exon 8 To Exon 9 (Pair 9)
Forward (1367,21)AGGAGGCGGAGAAGTAGAAAGAmplicon SizecDNA: 143 bpgenomic: 3,731
Reverse (1509,20)ACTCGGAGATCCAGGGAGTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.97 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops0.644 kcal/mol
Reverse Dimers-2.624 kcal/mol
Forward-Reverse Dimers-1.254 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCA
TCTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTTCT
CTGGACTCCCTGGATCTCCGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1431367 - 1509
NM_001145527 (EHMT1)1431367 - 1509
Exon 8 To Exon 9 (Pair 10)
Forward (1368,21)GGAGGCGGAGAAGTAGAAAGAAmplicon SizecDNA: 135 bpgenomic: 3,723
Reverse (1502,21)GATCCAGGGAGTCCAGAGAAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.97 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.086 kcal/mol
Reverse Dimers-2.75 kcal/mol
Forward-Reverse Dimers-0.873 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCAT
CTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTTCTC
TGGACTCCCTGGATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1351368 - 1502
NM_001145527 (EHMT1)1351368 - 1502
Exon 8 To Exon 9 (Pair 11)
Forward (1309,24)GAAATTTCTCAAGAGGAAAGGAAAAmplicon SizecDNA: 122 bpgenomic: 3,710
Reverse (1430,23)CAGATGACTTATACGACTCAGAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.192 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.289 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.487 kcal/mol
Amplicon Folding-1.328 kcal/mol outside primersite
Amplicon SequenceGAAATTTCTCAAGAGGAAAGGAAAGACCGACAGTCCCTGGATCAAGCCAGCCAGGAAAAG
GAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCATC
TG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1221309 - 1430
NM_001145527 (EHMT1)1221309 - 1430
Exon 8 To Exon 9 (Pair 12)
Forward (1345,20)CTGGATCAAGCCAGCCAGGAAmplicon SizecDNA: 86 bpgenomic: 3,674
Reverse (1430,23)CAGATGACTTATACGACTCAGAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.153 kcal/mol in 3' area
Forward Dimers-1.824 kcal/mol
Reverse Loops1.289 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-0.886 kcal/mol
Amplicon Folding0.153 kcal/mol inside primersite
Amplicon SequenceCTGGATCAAGCCAGCCAGGAAAAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCT
CGGTTCTGAGTCGTATAAGTCATCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)861345 - 1430
NM_024757 (EHMT1)861345 - 1430
Exon 8 To Exon 9 (Pair 13)
Forward (1371,21)GGCGGAGAAGTAGAAAGAAGCAmplicon SizecDNA: 153 bpgenomic: 3,741
Reverse (1523,22)ACAGAATTCCTTTGACTCGGAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.533 kcal/mol in 3' area
Forward Dimers-0.024 kcal/mol
Reverse Loops1.248 kcal/mol
Reverse Dimers-1.09 kcal/mol
Forward-Reverse Dimers-1.817 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCATCTG
CAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTTCTCTGG
ACTCCCTGGATCTCCGAGTCAAAGGAATTCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1531371 - 1523
NM_001145527 (EHMT1)1531371 - 1523
Exon 8 To Exon 10 (Pair 5)
Forward (1345,20)CTGGATCAAGCCAGCCAGGAAmplicon SizecDNA: 294 bpgenomic: 8,545
Reverse (1638,21)GTGGTGATCTCTCGACTCTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.153 kcal/mol in 3' area
Forward Dimers-1.824 kcal/mol
Reverse Loops2.164 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.289 kcal/mol
Amplicon Folding-1.892 kcal/mol outside primersite
Amplicon SequenceCTGGATCAAGCCAGCCAGGAAAAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCT
CGGTTCTGAGTCGTATAAGTCATCTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAG
CACAGGGTACATGGAAGTTTCTCTGGACTCCCTGGATCTCCGAGTCAAAGGAATTCTGTC
TTCACAAGCAGAAGGGTTGGCCAACGGTCCAGATGTGCTGGAGACAGACGGCCTCCAGGA
AGTGCCTCTCTGCAGCTGCCGGATGGAAACACCGAAGAGTCGAGAGATCACCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)2941345 - 1638
NM_024757 (EHMT1)2941345 - 1638
Exon 8 To Exon 9 (Pair 14)
Forward (1371,21)GGCGGAGAAGTAGAAAGAAGCAmplicon SizecDNA: 114 bpgenomic: 3,702
Reverse (1484,22)AAACTTCCATGTACCCTGTGCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.533 kcal/mol in 3' area
Forward Dimers-0.024 kcal/mol
Reverse Loops1.75 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-2.272 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCATCTG
CAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1141371 - 1484
NM_001145527 (EHMT1)1141371 - 1484
Exon 8 To Exon 9 (Pair 15)
Forward (1368,21)GGAGGCGGAGAAGTAGAAAGAAmplicon SizecDNA: 125 bpgenomic: 3,713
Reverse (1492,22)GTCCAGAGAAACTTCCATGTACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.97 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.074 kcal/mol
Reverse Dimers-0.735 kcal/mol
Forward-Reverse Dimers-2.272 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCAT
CTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTTCTC
TGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1251368 - 1492
NM_001145527 (EHMT1)1251368 - 1492
Exon 8 To Exon 9 (Pair 16)
Forward (1368,21)GGAGGCGGAGAAGTAGAAAGAAmplicon SizecDNA: 136 bpgenomic: 3,724
Reverse (1503,21)AGATCCAGGGAGTCCAGAGAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.97 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.086 kcal/mol
Reverse Dimers-2.75 kcal/mol
Forward-Reverse Dimers-0.873 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCAT
CTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTTCTC
TGGACTCCCTGGATCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)1361368 - 1503
NM_024757 (EHMT1)1361368 - 1503
Exon 8 To Exon 9 (Pair 17)
Forward (1309,24)GAAATTTCTCAAGAGGAAAGGAAAAmplicon SizecDNA: 180 bpgenomic: 3,768
Reverse (1488,22)AGAGAAACTTCCATGTACCCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.192 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.548 kcal/mol
Reverse Dimers-0.735 kcal/mol
Forward-Reverse Dimers-2.228 kcal/mol
Amplicon Folding-1.816 kcal/mol outside primersite
Amplicon SequenceGAAATTTCTCAAGAGGAAAGGAAAGACCGACAGTCCCTGGATCAAGCCAGCCAGGAAAAG
GAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCATC
TGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTTCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1801309 - 1488
NM_001145527 (EHMT1)1801309 - 1488
Exon 8 To Exon 10 (Pair 6)
Forward (1345,20)CTGGATCAAGCCAGCCAGGAAmplicon SizecDNA: 290 bpgenomic: 8,541
Reverse (1634,21)TGATCTCTCGACTCTTCGGTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.153 kcal/mol in 3' area
Forward Dimers-1.824 kcal/mol
Reverse Loops0.798 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.289 kcal/mol
Amplicon Folding-1.892 kcal/mol outside primersite
Amplicon SequenceCTGGATCAAGCCAGCCAGGAAAAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCT
CGGTTCTGAGTCGTATAAGTCATCTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAG
CACAGGGTACATGGAAGTTTCTCTGGACTCCCTGGATCTCCGAGTCAAAGGAATTCTGTC
TTCACAAGCAGAAGGGTTGGCCAACGGTCCAGATGTGCTGGAGACAGACGGCCTCCAGGA
AGTGCCTCTCTGCAGCTGCCGGATGGAAACACCGAAGAGTCGAGAGATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)2901345 - 1634
NM_024757 (EHMT1)2901345 - 1634
Exon 8 To Exon 9 (Pair 18)
Forward (1372,21)GCGGAGAAGTAGAAAGAAGCCAmplicon SizecDNA: 113 bpgenomic: 3,701
Reverse (1484,22)AAACTTCCATGTACCCTGTGCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.705 kcal/mol in 3' area
Forward Dimers-0.024 kcal/mol
Reverse Loops1.75 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-2.272 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCATCTGC
AGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1131372 - 1484
NM_001145527 (EHMT1)1131372 - 1484
Exon 8 To Exon 9 (Pair 19)
Forward (1365,22)AAAGGAGGCGGAGAAGTAGAAAAmplicon SizecDNA: 149 bpgenomic: 3,737
Reverse (1513,21)TTTGACTCGGAGATCCAGGGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.97 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops0.644 kcal/mol
Reverse Dimers-2.624 kcal/mol
Forward-Reverse Dimers-1.817 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceAAAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGT
CATCTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTT
CTCTGGACTCCCTGGATCTCCGAGTCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1491365 - 1513
NM_001145527 (EHMT1)1491365 - 1513
Exon 8 To Exon 9 (Pair 20)
Forward (1310,24)AAATTTCTCAAGAGGAAAGGAAAGAmplicon SizecDNA: 171 bpgenomic: 3,759
Reverse (1480,21)TTCCATGTACCCTGTGCTGTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.192 kcal/mol
Forward Dimers-1.018 kcal/mol
Reverse Loops2.144 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-1.816 kcal/mol outside primersite
Amplicon SequenceAAATTTCTCAAGAGGAAAGGAAAGACCGACAGTCCCTGGATCAAGCCAGCCAGGAAAAGG
AGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCATCT
GCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)1711310 - 1480
NM_024757 (EHMT1)1711310 - 1480
Exon 8 To Exon 9 (Pair 21)
Forward (1372,21)GCGGAGAAGTAGAAAGAAGCCAmplicon SizecDNA: 121 bpgenomic: 3,709
Reverse (1492,22)GTCCAGAGAAACTTCCATGTACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.705 kcal/mol in 3' area
Forward Dimers-0.024 kcal/mol
Reverse Loops1.074 kcal/mol
Reverse Dimers-0.735 kcal/mol
Forward-Reverse Dimers-2.272 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCATCTGC
AGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTTCTCTGGA
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1211372 - 1492
NM_001145527 (EHMT1)1211372 - 1492
Exon 8 To Exon 9 (Pair 22)
Forward (1365,22)AAAGGAGGCGGAGAAGTAGAAAAmplicon SizecDNA: 130 bpgenomic: 3,718
Reverse (1494,22)GAGTCCAGAGAAACTTCCATGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.97 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.074 kcal/mol
Reverse Dimers-1.421 kcal/mol
Forward-Reverse Dimers-2.272 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceAAAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGT
CATCTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTT
CTCTGGACTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1301365 - 1494
NM_001145527 (EHMT1)1301365 - 1494
Exon 8 To Exon 9 (Pair 23)
Forward (1365,22)AAAGGAGGCGGAGAAGTAGAAAAmplicon SizecDNA: 147 bpgenomic: 3,735
Reverse (1511,20)TGACTCGGAGATCCAGGGAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.97 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops0.644 kcal/mol
Reverse Dimers-2.624 kcal/mol
Forward-Reverse Dimers-1.817 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceAAAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGT
CATCTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTT
CTCTGGACTCCCTGGATCTCCGAGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1471365 - 1511
NM_001145527 (EHMT1)1471365 - 1511
Exon 8 To Exon 9 (Pair 24)
Forward (1309,24)GAAATTTCTCAAGAGGAAAGGAAAAmplicon SizecDNA: 121 bpgenomic: 3,709
Reverse (1429,23)AGATGACTTATACGACTCAGAACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.192 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops1.696 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.487 kcal/mol
Amplicon Folding-1.328 kcal/mol outside primersite
Amplicon SequenceGAAATTTCTCAAGAGGAAAGGAAAGACCGACAGTCCCTGGATCAAGCCAGCCAGGAAAAG
GAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCATC
T
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)1211309 - 1429
NM_024757 (EHMT1)1211309 - 1429
Exon 8 To Exon 9 (Pair 25)
Forward (1372,21)GCGGAGAAGTAGAAAGAAGCCAmplicon SizecDNA: 152 bpgenomic: 3,740
Reverse (1523,22)ACAGAATTCCTTTGACTCGGAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.705 kcal/mol in 3' area
Forward Dimers-0.024 kcal/mol
Reverse Loops1.248 kcal/mol
Reverse Dimers-1.09 kcal/mol
Forward-Reverse Dimers-1.817 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCATCTGC
AGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTTCTCTGGA
CTCCCTGGATCTCCGAGTCAAAGGAATTCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)1521372 - 1523
NM_024757 (EHMT1)1521372 - 1523
Exon 8 To Exon 9 (Pair 26)
Forward (1309,24)GAAATTTCTCAAGAGGAAAGGAAAAmplicon SizecDNA: 174 bpgenomic: 3,762
Reverse (1482,21)ACTTCCATGTACCCTGTGCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.192 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops2.144 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-1.816 kcal/mol outside primersite
Amplicon SequenceGAAATTTCTCAAGAGGAAAGGAAAGACCGACAGTCCCTGGATCAAGCCAGCCAGGAAAAG
GAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCATC
TGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1741309 - 1482
NM_001145527 (EHMT1)1741309 - 1482
Exon 8 To Exon 9 (Pair 27)
Forward (1365,22)AAAGGAGGCGGAGAAGTAGAAAAmplicon SizecDNA: 137 bpgenomic: 3,725
Reverse (1501,21)ATCCAGGGAGTCCAGAGAAACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.97 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.086 kcal/mol
Reverse Dimers-2.75 kcal/mol
Forward-Reverse Dimers-1.153 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceAAAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGT
CATCTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTT
CTCTGGACTCCCTGGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1371365 - 1501
NM_001145527 (EHMT1)1371365 - 1501
Exon 8 To Exon 9 (Pair 28)
Forward (1365,22)AAAGGAGGCGGAGAAGTAGAAAAmplicon SizecDNA: 124 bpgenomic: 3,712
Reverse (1488,22)AGAGAAACTTCCATGTACCCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.97 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.548 kcal/mol
Reverse Dimers-0.735 kcal/mol
Forward-Reverse Dimers-2.272 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceAAAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGT
CATCTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTT
CTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1241365 - 1488
NM_001145527 (EHMT1)1241365 - 1488
Exon 8 To Exon 10 (Pair 7)
Forward (1367,21)AGGAGGCGGAGAAGTAGAAAGAmplicon SizecDNA: 279 bpgenomic: 8,530
Reverse (1645,20)GGCCAGTGTGGTGATCTCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.97 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops0.796 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-1.925 kcal/mol
Amplicon Folding-1.892 kcal/mol outside primersite
Amplicon SequenceAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCA
TCTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTTCT
CTGGACTCCCTGGATCTCCGAGTCAAAGGAATTCTGTCTTCACAAGCAGAAGGGTTGGCC
AACGGTCCAGATGTGCTGGAGACAGACGGCCTCCAGGAAGTGCCTCTCTGCAGCTGCCGG
ATGGAAACACCGAAGAGTCGAGAGATCACCACACTGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)2791367 - 1645
NM_001145527 (EHMT1)2791367 - 1645
Exon 8 To Exon 10 (Pair 8)
Forward (1371,21)GGCGGAGAAGTAGAAAGAAGCAmplicon SizecDNA: 259 bpgenomic: 8,510
Reverse (1629,21)TCTCGACTCTTCGGTGTTTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.533 kcal/mol in 3' area
Forward Dimers-0.024 kcal/mol
Reverse Loops0.798 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.817 kcal/mol
Amplicon Folding-1.892 kcal/mol outside primersite
Amplicon SequenceGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCATCTG
CAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTTCTCTGG
ACTCCCTGGATCTCCGAGTCAAAGGAATTCTGTCTTCACAAGCAGAAGGGTTGGCCAACG
GTCCAGATGTGCTGGAGACAGACGGCCTCCAGGAAGTGCCTCTCTGCAGCTGCCGGATGG
AAACACCGAAGAGTCGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)2591371 - 1629
NM_001145527 (EHMT1)2591371 - 1629
Exon 8 To Exon 10 (Pair 9)
Forward (1371,21)GGCGGAGAAGTAGAAAGAAGCAmplicon SizecDNA: 247 bpgenomic: 8,498
Reverse (1617,20)GGTGTTTCCATCCGGCAGCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.533 kcal/mol in 3' area
Forward Dimers-0.024 kcal/mol
Reverse Loops1.193 kcal/mol
Reverse Dimers-2.664 kcal/mol
Forward-Reverse Dimers-2.442 kcal/mol
Amplicon Folding-1.892 kcal/mol outside primersite
Amplicon SequenceGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCATCTG
CAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTTCTCTGG
ACTCCCTGGATCTCCGAGTCAAAGGAATTCTGTCTTCACAAGCAGAAGGGTTGGCCAACG
GTCCAGATGTGCTGGAGACAGACGGCCTCCAGGAAGTGCCTCTCTGCAGCTGCCGGATGG
AAACACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)2471371 - 1617
NM_024757 (EHMT1)2471371 - 1617
Exon 8 To Exon 10 (Pair 10)
Forward (1368,21)GGAGGCGGAGAAGTAGAAAGAAmplicon SizecDNA: 262 bpgenomic: 8,513
Reverse (1629,21)TCTCGACTCTTCGGTGTTTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.97 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops0.798 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-2.579 kcal/mol
Amplicon Folding-1.892 kcal/mol outside primersite
Amplicon SequenceGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCAT
CTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTTCTC
TGGACTCCCTGGATCTCCGAGTCAAAGGAATTCTGTCTTCACAAGCAGAAGGGTTGGCCA
ACGGTCCAGATGTGCTGGAGACAGACGGCCTCCAGGAAGTGCCTCTCTGCAGCTGCCGGA
TGGAAACACCGAAGAGTCGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)2621368 - 1629
NM_024757 (EHMT1)2621368 - 1629
Exon 8 To Exon 9 (Pair 29)
Forward (1345,20)CTGGATCAAGCCAGCCAGGAAmplicon SizecDNA: 150 bpgenomic: 3,738
Reverse (1494,22)GAGTCCAGAGAAACTTCCATGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.153 kcal/mol in 3' area
Forward Dimers-1.824 kcal/mol
Reverse Loops1.074 kcal/mol
Reverse Dimers-1.421 kcal/mol
Forward-Reverse Dimers-2.814 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceCTGGATCAAGCCAGCCAGGAAAAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCT
CGGTTCTGAGTCGTATAAGTCATCTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAG
CACAGGGTACATGGAAGTTTCTCTGGACTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)1501345 - 1494
NM_024757 (EHMT1)1501345 - 1494
Exon 8 To Exon 9 (Pair 30)
Forward (1371,21)GGCGGAGAAGTAGAAAGAAGCAmplicon SizecDNA: 139 bpgenomic: 3,727
Reverse (1509,20)ACTCGGAGATCCAGGGAGTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.533 kcal/mol in 3' area
Forward Dimers-0.024 kcal/mol
Reverse Loops0.644 kcal/mol
Reverse Dimers-2.624 kcal/mol
Forward-Reverse Dimers-1.254 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCATCTG
CAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTTCTCTGG
ACTCCCTGGATCTCCGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)1391371 - 1509
NM_024757 (EHMT1)1391371 - 1509
Exon 8 To Exon 9 (Pair 31)
Forward (1371,21)GGCGGAGAAGTAGAAAGAAGCAmplicon SizecDNA: 133 bpgenomic: 3,721
Reverse (1503,21)AGATCCAGGGAGTCCAGAGAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.533 kcal/mol in 3' area
Forward Dimers-0.024 kcal/mol
Reverse Loops1.086 kcal/mol
Reverse Dimers-2.75 kcal/mol
Forward-Reverse Dimers-0.873 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCATCTG
CAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTTCTCTGG
ACTCCCTGGATCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1331371 - 1503
NM_001145527 (EHMT1)1331371 - 1503
Exon 8 To Exon 10 (Pair 11)
Forward (1345,20)CTGGATCAAGCCAGCCAGGAAmplicon SizecDNA: 289 bpgenomic: 8,540
Reverse (1633,21)GATCTCTCGACTCTTCGGTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.153 kcal/mol in 3' area
Forward Dimers-1.824 kcal/mol
Reverse Loops0.798 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-0.716 kcal/mol
Amplicon Folding-1.892 kcal/mol outside primersite
Amplicon SequenceCTGGATCAAGCCAGCCAGGAAAAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCT
CGGTTCTGAGTCGTATAAGTCATCTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAG
CACAGGGTACATGGAAGTTTCTCTGGACTCCCTGGATCTCCGAGTCAAAGGAATTCTGTC
TTCACAAGCAGAAGGGTTGGCCAACGGTCCAGATGTGCTGGAGACAGACGGCCTCCAGGA
AGTGCCTCTCTGCAGCTGCCGGATGGAAACACCGAAGAGTCGAGAGATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)2891345 - 1633
NM_024757 (EHMT1)2891345 - 1633
Exon 8 To Exon 9 (Pair 32)
Forward (1310,24)AAATTTCTCAAGAGGAAAGGAAAGAmplicon SizecDNA: 122 bpgenomic: 3,710
Reverse (1431,22)GCAGATGACTTATACGACTCAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.192 kcal/mol
Forward Dimers-1.018 kcal/mol
Reverse Loops1.289 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.487 kcal/mol
Amplicon Folding-1.328 kcal/mol outside primersite
Amplicon SequenceAAATTTCTCAAGAGGAAAGGAAAGACCGACAGTCCCTGGATCAAGCCAGCCAGGAAAAGG
AGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCATCT
GC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)1221310 - 1431
NM_024757 (EHMT1)1221310 - 1431
Exon 8 To Exon 9 (Pair 33)
Forward (1365,22)AAAGGAGGCGGAGAAGTAGAAAAmplicon SizecDNA: 164 bpgenomic: 3,752
Reverse (1528,23)TGAAGACAGAATTCCTTTGACTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.97 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.248 kcal/mol
Reverse Dimers-1.09 kcal/mol
Forward-Reverse Dimers-2.719 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceAAAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGT
CATCTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTT
CTCTGGACTCCCTGGATCTCCGAGTCAAAGGAATTCTGTCTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)1641365 - 1528
NM_024757 (EHMT1)1641365 - 1528
Exon 8 To Exon 9 (Pair 34)
Forward (1367,21)AGGAGGCGGAGAAGTAGAAAGAmplicon SizecDNA: 125 bpgenomic: 3,713
Reverse (1491,22)TCCAGAGAAACTTCCATGTACCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.97 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.074 kcal/mol
Reverse Dimers-0.735 kcal/mol
Forward-Reverse Dimers-2.272 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCA
TCTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTTCT
CTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1251367 - 1491
NM_001145527 (EHMT1)1251367 - 1491
Exon 8 To Exon 10 (Pair 12)
Forward (1365,22)AAAGGAGGCGGAGAAGTAGAAAAmplicon SizecDNA: 253 bpgenomic: 8,504
Reverse (1617,20)GGTGTTTCCATCCGGCAGCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.97 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.193 kcal/mol
Reverse Dimers-2.664 kcal/mol
Forward-Reverse Dimers-2.442 kcal/mol
Amplicon Folding-1.892 kcal/mol outside primersite
Amplicon SequenceAAAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGT
CATCTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTT
CTCTGGACTCCCTGGATCTCCGAGTCAAAGGAATTCTGTCTTCACAAGCAGAAGGGTTGG
CCAACGGTCCAGATGTGCTGGAGACAGACGGCCTCCAGGAAGTGCCTCTCTGCAGCTGCC
GGATGGAAACACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)2531365 - 1617
NM_024757 (EHMT1)2531365 - 1617
Exon 8 To Exon 9 (Pair 35)
Forward (1372,21)GCGGAGAAGTAGAAAGAAGCCAmplicon SizecDNA: 130 bpgenomic: 3,718
Reverse (1501,21)ATCCAGGGAGTCCAGAGAAACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.705 kcal/mol in 3' area
Forward Dimers-0.024 kcal/mol
Reverse Loops1.086 kcal/mol
Reverse Dimers-2.75 kcal/mol
Forward-Reverse Dimers-0.873 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCATCTGC
AGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTTCTCTGGA
CTCCCTGGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)1301372 - 1501
NM_024757 (EHMT1)1301372 - 1501
Exon 8 To Exon 9 (Pair 36)
Forward (1323,21)GGAAAGGAAAGACCGACAGTCAmplicon SizecDNA: 180 bpgenomic: 3,768
Reverse (1502,21)GATCCAGGGAGTCCAGAGAAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.802 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops1.086 kcal/mol
Reverse Dimers-2.75 kcal/mol
Forward-Reverse Dimers-1.223 kcal/mol
Amplicon Folding-1.816 kcal/mol outside primersite
Amplicon SequenceGGAAAGGAAAGACCGACAGTCCCTGGATCAAGCCAGCCAGGAAAAGGAGGCGGAGAAGTA
GAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCATCTGCAGGAAGCGCTG
AGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTTCTCTGGACTCCCTGGATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1801323 - 1502
NM_001145527 (EHMT1)1801323 - 1502
Exon 8 To Exon 9 (Pair 37)
Forward (1371,21)GGCGGAGAAGTAGAAAGAAGCAmplicon SizecDNA: 112 bpgenomic: 3,700
Reverse (1482,21)ACTTCCATGTACCCTGTGCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.533 kcal/mol in 3' area
Forward Dimers-0.024 kcal/mol
Reverse Loops2.144 kcal/mol in 3' area
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-1.731 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCATCTG
CAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1121371 - 1482
NM_001145527 (EHMT1)1121371 - 1482
Exon 8 To Exon 9 (Pair 38)
Forward (1309,24)GAAATTTCTCAAGAGGAAAGGAAAAmplicon SizecDNA: 173 bpgenomic: 3,761
Reverse (1481,21)CTTCCATGTACCCTGTGCTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.192 kcal/mol
Forward Dimers-1.96 kcal/mol
Reverse Loops2.144 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-1.816 kcal/mol outside primersite
Amplicon SequenceGAAATTTCTCAAGAGGAAAGGAAAGACCGACAGTCCCTGGATCAAGCCAGCCAGGAAAAG
GAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCATC
TGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1731309 - 1481
NM_001145527 (EHMT1)1731309 - 1481
Exon 8 To Exon 10 (Pair 13)
Forward (1372,21)GCGGAGAAGTAGAAAGAAGCCAmplicon SizecDNA: 262 bpgenomic: 8,513
Reverse (1633,21)GATCTCTCGACTCTTCGGTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.705 kcal/mol in 3' area
Forward Dimers-0.024 kcal/mol
Reverse Loops0.798 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.817 kcal/mol
Amplicon Folding-1.892 kcal/mol outside primersite
Amplicon SequenceGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCATCTGC
AGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTTCTCTGGA
CTCCCTGGATCTCCGAGTCAAAGGAATTCTGTCTTCACAAGCAGAAGGGTTGGCCAACGG
TCCAGATGTGCTGGAGACAGACGGCCTCCAGGAAGTGCCTCTCTGCAGCTGCCGGATGGA
AACACCGAAGAGTCGAGAGATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)2621372 - 1633
NM_024757 (EHMT1)2621372 - 1633
Exon 8 To Exon 9 (Pair 39)
Forward (1365,22)AAAGGAGGCGGAGAAGTAGAAAAmplicon SizecDNA: 165 bpgenomic: 3,753
Reverse (1529,23)GTGAAGACAGAATTCCTTTGACTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.97 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops1.248 kcal/mol
Reverse Dimers-1.09 kcal/mol
Forward-Reverse Dimers-2.719 kcal/mol
Amplicon Folding-0.488 kcal/mol outside primersite
Amplicon SequenceAAAGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGT
CATCTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTT
CTCTGGACTCCCTGGATCTCCGAGTCAAAGGAATTCTGTCTTCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001145527 (EHMT1)1651365 - 1529
NM_024757 (EHMT1)1651365 - 1529
Exon 8 To Exon 10 (Pair 14)
Forward (1368,21)GGAGGCGGAGAAGTAGAAAGAAmplicon SizecDNA: 277 bpgenomic: 8,528
Reverse (1644,20)GCCAGTGTGGTGATCTCTCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.97 kcal/mol
Forward Dimers-0.024 kcal/mol
Reverse Loops0.874 kcal/mol
Reverse Dimers-0.336 kcal/mol
Forward-Reverse Dimers-1.634 kcal/mol
Amplicon Folding-1.892 kcal/mol outside primersite
Amplicon SequenceGGAGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCAT
CTGCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAGTTTCTC
TGGACTCCCTGGATCTCCGAGTCAAAGGAATTCTGTCTTCACAAGCAGAAGGGTTGGCCA
ACGGTCCAGATGTGCTGGAGACAGACGGCCTCCAGGAAGTGCCTCTCTGCAGCTGCCGGA
TGGAAACACCGAAGAGTCGAGAGATCACCACACTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)2771368 - 1644
NM_001145527 (EHMT1)2771368 - 1644
Exon 8 To Exon 9 (Pair 40)
Forward (1310,24)AAATTTCTCAAGAGGAAAGGAAAGAmplicon SizecDNA: 172 bpgenomic: 3,760
Reverse (1481,21)CTTCCATGTACCCTGTGCTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.192 kcal/mol
Forward Dimers-1.018 kcal/mol
Reverse Loops2.144 kcal/mol
Reverse Dimers-0.064 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-1.816 kcal/mol outside primersite
Amplicon SequenceAAATTTCTCAAGAGGAAAGGAAAGACCGACAGTCCCTGGATCAAGCCAGCCAGGAAAAGG
AGGCGGAGAAGTAGAAAGAAGCCCAGCGGTGCCCTCGGTTCTGAGTCGTATAAGTCATCT
GCAGGAAGCGCTGAGCAGACGGCACCAGGAGACAGCACAGGGTACATGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_024757 (EHMT1)1721310 - 1481
NM_001145527 (EHMT1)1721310 - 1481
 

See below for some more details.

Program Output:

Loading ...