Design Results for EIF2B1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size90Maximal Amplicon Size150
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size1000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 6 To Exon 8 (Pair 1)
Forward (740,21)CTGTCACTGTGGTGCTAGATGAmplicon SizecDNA: 130 bpgenomic: 3,717
Reverse (869,21)ACAGCCATCTGGTTGGTTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.95 kcal/mol
Forward Dimers-1.374 kcal/mol
Reverse Loops0.669 kcal/mol
Reverse Dimers-1.246 kcal/mol
Forward-Reverse Dimers-1.713 kcal/mol
Amplicon Folding-0.86 kcal/mol outside primersite
Amplicon SequenceCTGTCACTGTGGTGCTAGATGCTGCTGTCGGCTACATCATGGAGAAAGCAGATCTTGTCA
TAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACC
AGATGGCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)130740 - 869
Exon 7 To Exon 8 (Pair 1)
Forward (797,22)TCATAGTTGGTGCTGAAGGAGTAmplicon SizecDNA: 123 bpgenomic: 2,148
Reverse (919,23)TGAAACTTTCTGCAACCACATAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTCATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCA
ACCAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTT
TCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)123797 - 919
Exon 7 To Exon 8 (Pair 2)
Forward (798,22)CATAGTTGGTGCTGAAGGAGTTAmplicon SizecDNA: 120 bpgenomic: 2,145
Reverse (917,24)AAACTTTCTGCAACCACATAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.754 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceCATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAA
CCAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)120798 - 917
Exon 7 To Exon 8 (Pair 3)
Forward (799,22)ATAGTTGGTGCTGAAGGAGTTGAmplicon SizecDNA: 115 bpgenomic: 2,140
Reverse (913,23)TTTCTGCAACCACATAGAAAGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops0.881 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAAC
CAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)115799 - 913
Exon 7 To Exon 8 (Pair 4)
Forward (795,22)TGTCATAGTTGGTGCTGAAGGAAmplicon SizecDNA: 119 bpgenomic: 2,144
Reverse (913,23)TTTCTGCAACCACATAGAAAGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops0.881 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTGTCATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAAC
CAACCAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)119795 - 913
Exon 7 To Exon 8 (Pair 5)
Forward (804,22)TGGTGCTGAAGGAGTTGTTGAAAmplicon SizecDNA: 119 bpgenomic: 2,144
Reverse (922,23)ACTTGAAACTTTCTGCAACCACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.831 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.213 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACCAGAT
GGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTTCAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)119804 - 922
Exon 7 To Exon 8 (Pair 6)
Forward (793,22)CTTGTCATAGTTGGTGCTGAAGAmplicon SizecDNA: 127 bpgenomic: 2,152
Reverse (919,23)TGAAACTTTCTGCAACCACATAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceCTTGTCATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGA
ACCAACCAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAA
AGTTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)127793 - 919
Exon 7 To Exon 8 (Pair 7)
Forward (793,22)CTTGTCATAGTTGGTGCTGAAGAmplicon SizecDNA: 126 bpgenomic: 2,151
Reverse (918,23)GAAACTTTCTGCAACCACATAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceCTTGTCATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGA
ACCAACCAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAA
AGTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)126793 - 918
Exon 7 To Exon 8 (Pair 8)
Forward (805,22)GGTGCTGAAGGAGTTGTTGAAAAmplicon SizecDNA: 114 bpgenomic: 2,139
Reverse (918,23)GAAACTTTCTGCAACCACATAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.831 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.213 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACCAGATG
GCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)114805 - 918
Exon 7 To Exon 8 (Pair 9)
Forward (804,22)TGGTGCTGAAGGAGTTGTTGAAAmplicon SizecDNA: 118 bpgenomic: 2,143
Reverse (921,23)CTTGAAACTTTCTGCAACCACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.831 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.213 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACCAGAT
GGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTTCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)118804 - 921
Exon 7 To Exon 8 (Pair 10)
Forward (791,23)ATCTTGTCATAGTTGGTGCTGAAAmplicon SizecDNA: 123 bpgenomic: 2,148
Reverse (913,23)TTTCTGCAACCACATAGAAAGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol in 3' area
Reverse Loops0.881 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceATCTTGTCATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTG
GAACCAACCAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAG
AAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)123791 - 913
Exon 7 To Exon 8 (Pair 11)
Forward (805,22)GGTGCTGAAGGAGTTGTTGAAAAmplicon SizecDNA: 119 bpgenomic: 2,144
Reverse (923,23)AACTTGAAACTTTCTGCAACCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.831 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.213 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACCAGATG
GCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTTCAAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)119805 - 923
Exon 7 To Exon 8 (Pair 12)
Forward (803,22)TTGGTGCTGAAGGAGTTGTTGAAmplicon SizecDNA: 111 bpgenomic: 2,136
Reverse (913,23)TTTCTGCAACCACATAGAAAGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.831 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops0.881 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACCAGA
TGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)111803 - 913
Exon 7 To Exon 8 (Pair 13)
Forward (791,23)ATCTTGTCATAGTTGGTGCTGAAAmplicon SizecDNA: 128 bpgenomic: 2,153
Reverse (918,23)GAAACTTTCTGCAACCACATAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol in 3' area
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceATCTTGTCATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTG
GAACCAACCAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAG
AAAGTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)128791 - 918
Exon 7 To Exon 8 (Pair 14)
Forward (804,22)TGGTGCTGAAGGAGTTGTTGAAAmplicon SizecDNA: 120 bpgenomic: 2,145
Reverse (923,23)AACTTGAAACTTTCTGCAACCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.831 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.213 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACCAGAT
GGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTTCAAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)120804 - 923
Exon 7 To Exon 8 (Pair 15)
Forward (798,22)CATAGTTGGTGCTGAAGGAGTTAmplicon SizecDNA: 122 bpgenomic: 2,147
Reverse (919,23)TGAAACTTTCTGCAACCACATAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceCATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAA
CCAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTT
CA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)122798 - 919
Exon 7 To Exon 8 (Pair 16)
Forward (803,22)TTGGTGCTGAAGGAGTTGTTGAAmplicon SizecDNA: 115 bpgenomic: 2,140
Reverse (917,24)AAACTTTCTGCAACCACATAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.831 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.754 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACCAGA
TGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)115803 - 917
Exon 7 To Exon 8 (Pair 17)
Forward (791,23)ATCTTGTCATAGTTGGTGCTGAAAmplicon SizecDNA: 129 bpgenomic: 2,154
Reverse (919,23)TGAAACTTTCTGCAACCACATAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol in 3' area
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceATCTTGTCATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTG
GAACCAACCAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAG
AAAGTTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)129791 - 919
Exon 7 To Exon 8 (Pair 18)
Forward (797,22)TCATAGTTGGTGCTGAAGGAGTAmplicon SizecDNA: 117 bpgenomic: 2,142
Reverse (913,23)TTTCTGCAACCACATAGAAAGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops0.881 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTCATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCA
ACCAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)117797 - 913
Exon 7 To Exon 8 (Pair 19)
Forward (804,22)TGGTGCTGAAGGAGTTGTTGAAAmplicon SizecDNA: 114 bpgenomic: 2,139
Reverse (917,24)AAACTTTCTGCAACCACATAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.831 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.754 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.213 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACCAGAT
GGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)114804 - 917
Exon 7 To Exon 8 (Pair 20)
Forward (795,22)TGTCATAGTTGGTGCTGAAGGAAmplicon SizecDNA: 124 bpgenomic: 2,149
Reverse (918,23)GAAACTTTCTGCAACCACATAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTGTCATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAAC
CAACCAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAG
TTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)124795 - 918
Exon 7 To Exon 8 (Pair 21)
Forward (803,22)TTGGTGCTGAAGGAGTTGTTGAAmplicon SizecDNA: 117 bpgenomic: 2,142
Reverse (919,23)TGAAACTTTCTGCAACCACATAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.831 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACCAGA
TGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)117803 - 919
Exon 7 To Exon 8 (Pair 22)
Forward (799,22)ATAGTTGGTGCTGAAGGAGTTGAmplicon SizecDNA: 119 bpgenomic: 2,144
Reverse (917,24)AAACTTTCTGCAACCACATAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.754 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAAC
CAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)119799 - 917
Exon 7 To Exon 8 (Pair 23)
Forward (794,22)TTGTCATAGTTGGTGCTGAAGGAmplicon SizecDNA: 125 bpgenomic: 2,150
Reverse (918,23)GAAACTTTCTGCAACCACATAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTTGTCATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAA
CCAACCAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAA
GTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)125794 - 918
Exon 7 To Exon 8 (Pair 24)
Forward (800,22)TAGTTGGTGCTGAAGGAGTTGTAmplicon SizecDNA: 119 bpgenomic: 2,144
Reverse (918,23)GAAACTTTCTGCAACCACATAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACC
AGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)119800 - 918
Exon 7 To Exon 8 (Pair 25)
Forward (799,22)ATAGTTGGTGCTGAAGGAGTTGAmplicon SizecDNA: 121 bpgenomic: 2,146
Reverse (919,23)TGAAACTTTCTGCAACCACATAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAAC
CAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTTC
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)121799 - 919
Exon 7 To Exon 8 (Pair 26)
Forward (801,22)AGTTGGTGCTGAAGGAGTTGTTAmplicon SizecDNA: 113 bpgenomic: 2,138
Reverse (913,23)TTTCTGCAACCACATAGAAAGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.831 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops0.881 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACCA
GATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)113801 - 913
Exon 7 To Exon 8 (Pair 27)
Forward (804,22)TGGTGCTGAAGGAGTTGTTGAAAmplicon SizecDNA: 116 bpgenomic: 2,141
Reverse (919,23)TGAAACTTTCTGCAACCACATAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.831 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.213 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACCAGAT
GGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)116804 - 919
Exon 7 To Exon 8 (Pair 28)
Forward (798,22)CATAGTTGGTGCTGAAGGAGTTAmplicon SizecDNA: 121 bpgenomic: 2,146
Reverse (918,23)GAAACTTTCTGCAACCACATAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceCATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAA
CCAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTT
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)121798 - 918
Exon 7 To Exon 8 (Pair 29)
Forward (805,22)GGTGCTGAAGGAGTTGTTGAAAAmplicon SizecDNA: 115 bpgenomic: 2,140
Reverse (919,23)TGAAACTTTCTGCAACCACATAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.831 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.213 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACCAGATG
GCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)115805 - 919
Exon 7 To Exon 8 (Pair 30)
Forward (794,22)TTGTCATAGTTGGTGCTGAAGGAmplicon SizecDNA: 120 bpgenomic: 2,145
Reverse (913,23)TTTCTGCAACCACATAGAAAGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops0.881 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTTGTCATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAA
CCAACCAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)120794 - 913
Exon 7 To Exon 8 (Pair 31)
Forward (805,22)GGTGCTGAAGGAGTTGTTGAAAAmplicon SizecDNA: 118 bpgenomic: 2,143
Reverse (922,23)ACTTGAAACTTTCTGCAACCACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.831 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.213 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACCAGATG
GCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTTCAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)118805 - 922
Exon 7 To Exon 8 (Pair 32)
Forward (797,22)TCATAGTTGGTGCTGAAGGAGTAmplicon SizecDNA: 122 bpgenomic: 2,147
Reverse (918,23)GAAACTTTCTGCAACCACATAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTCATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCA
ACCAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTT
TC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)122797 - 918
Exon 7 To Exon 8 (Pair 33)
Forward (798,22)CATAGTTGGTGCTGAAGGAGTTAmplicon SizecDNA: 116 bpgenomic: 2,141
Reverse (913,23)TTTCTGCAACCACATAGAAAGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops0.881 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceCATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAA
CCAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)116798 - 913
Exon 7 To Exon 8 (Pair 34)
Forward (800,22)TAGTTGGTGCTGAAGGAGTTGTAmplicon SizecDNA: 114 bpgenomic: 2,139
Reverse (913,23)TTTCTGCAACCACATAGAAAGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops0.881 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACC
AGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)114800 - 913
Exon 7 To Exon 8 (Pair 35)
Forward (801,22)AGTTGGTGCTGAAGGAGTTGTTAmplicon SizecDNA: 119 bpgenomic: 2,144
Reverse (919,23)TGAAACTTTCTGCAACCACATAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.831 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACCA
GATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)119801 - 919
Exon 7 To Exon 8 (Pair 36)
Forward (795,22)TGTCATAGTTGGTGCTGAAGGAAmplicon SizecDNA: 123 bpgenomic: 2,148
Reverse (917,24)AAACTTTCTGCAACCACATAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.754 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTGTCATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAAC
CAACCAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAG
TTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)123795 - 917
Exon 7 To Exon 8 (Pair 37)
Forward (803,22)TTGGTGCTGAAGGAGTTGTTGAAmplicon SizecDNA: 116 bpgenomic: 2,141
Reverse (918,23)GAAACTTTCTGCAACCACATAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.831 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACCAGA
TGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)116803 - 918
Exon 7 To Exon 8 (Pair 38)
Forward (805,22)GGTGCTGAAGGAGTTGTTGAAAAmplicon SizecDNA: 117 bpgenomic: 2,142
Reverse (921,23)CTTGAAACTTTCTGCAACCACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.831 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.213 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACCAGATG
GCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTTCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)117805 - 921
Exon 7 To Exon 8 (Pair 39)
Forward (805,22)GGTGCTGAAGGAGTTGTTGAAAAmplicon SizecDNA: 113 bpgenomic: 2,138
Reverse (917,24)AAACTTTCTGCAACCACATAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.831 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.754 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.213 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACCAGATG
GCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)113805 - 917
Exon 7 To Exon 8 (Pair 40)
Forward (800,22)TAGTTGGTGCTGAAGGAGTTGTAmplicon SizecDNA: 120 bpgenomic: 2,145
Reverse (919,23)TGAAACTTTCTGCAACCACATAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACC
AGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)120800 - 919
Exon 7 To Exon 8 (Pair 41)
Forward (799,22)ATAGTTGGTGCTGAAGGAGTTGAmplicon SizecDNA: 120 bpgenomic: 2,145
Reverse (918,23)GAAACTTTCTGCAACCACATAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAAC
CAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)120799 - 918
Exon 7 To Exon 8 (Pair 42)
Forward (793,22)CTTGTCATAGTTGGTGCTGAAGAmplicon SizecDNA: 121 bpgenomic: 2,146
Reverse (913,23)TTTCTGCAACCACATAGAAAGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops0.881 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceCTTGTCATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGA
ACCAACCAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAA
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)121793 - 913
Exon 7 To Exon 8 (Pair 43)
Forward (794,22)TTGTCATAGTTGGTGCTGAAGGAmplicon SizecDNA: 126 bpgenomic: 2,151
Reverse (919,23)TGAAACTTTCTGCAACCACATAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTTGTCATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAA
CCAACCAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAA
GTTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)126794 - 919
Exon 7 To Exon 8 (Pair 44)
Forward (804,22)TGGTGCTGAAGGAGTTGTTGAAAmplicon SizecDNA: 110 bpgenomic: 2,135
Reverse (913,23)TTTCTGCAACCACATAGAAAGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.831 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops0.881 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.196 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACCAGAT
GGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)110804 - 913
Exon 7 To Exon 8 (Pair 45)
Forward (791,23)ATCTTGTCATAGTTGGTGCTGAAAmplicon SizecDNA: 127 bpgenomic: 2,152
Reverse (917,24)AAACTTTCTGCAACCACATAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol in 3' area
Reverse Loops1.754 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceATCTTGTCATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTG
GAACCAACCAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAG
AAAGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)127791 - 917
Exon 7 To Exon 8 (Pair 46)
Forward (797,22)TCATAGTTGGTGCTGAAGGAGTAmplicon SizecDNA: 121 bpgenomic: 2,146
Reverse (917,24)AAACTTTCTGCAACCACATAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.754 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTCATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCA
ACCAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTT
T
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)121797 - 917
Exon 7 To Exon 8 (Pair 47)
Forward (804,22)TGGTGCTGAAGGAGTTGTTGAAAmplicon SizecDNA: 115 bpgenomic: 2,140
Reverse (918,23)GAAACTTTCTGCAACCACATAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.831 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.213 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACCAGAT
GGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)115804 - 918
Exon 7 To Exon 8 (Pair 48)
Forward (795,22)TGTCATAGTTGGTGCTGAAGGAAmplicon SizecDNA: 125 bpgenomic: 2,150
Reverse (919,23)TGAAACTTTCTGCAACCACATAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTGTCATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAAC
CAACCAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAG
TTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)125795 - 919
Exon 7 To Exon 8 (Pair 49)
Forward (801,22)AGTTGGTGCTGAAGGAGTTGTTAmplicon SizecDNA: 117 bpgenomic: 2,142
Reverse (917,24)AAACTTTCTGCAACCACATAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.831 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.754 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACCA
GATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)117801 - 917
Exon 7 To Exon 8 (Pair 50)
Forward (800,22)TAGTTGGTGCTGAAGGAGTTGTAmplicon SizecDNA: 118 bpgenomic: 2,143
Reverse (917,24)AAACTTTCTGCAACCACATAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.754 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACC
AGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)118800 - 917
Exon 7 To Exon 8 (Pair 51)
Forward (794,22)TTGTCATAGTTGGTGCTGAAGGAmplicon SizecDNA: 124 bpgenomic: 2,149
Reverse (917,24)AAACTTTCTGCAACCACATAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.754 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceTTGTCATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAA
CCAACCAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAA
GTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)124794 - 917
Exon 7 To Exon 8 (Pair 52)
Forward (801,22)AGTTGGTGCTGAAGGAGTTGTTAmplicon SizecDNA: 118 bpgenomic: 2,143
Reverse (918,23)GAAACTTTCTGCAACCACATAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.831 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.768 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACCA
GATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)118801 - 918
Exon 7 To Exon 8 (Pair 53)
Forward (793,22)CTTGTCATAGTTGGTGCTGAAGAmplicon SizecDNA: 125 bpgenomic: 2,150
Reverse (917,24)AAACTTTCTGCAACCACATAGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops1.754 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.267 kcal/mol
Amplicon Folding-1.315 kcal/mol outside primersite
Amplicon SequenceCTTGTCATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGA
ACCAACCAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAA
AGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001414 (EIF2B1)125793 - 917
 

See below for some more details.

Program Output:

Loading ...