Design Results for EPHA2

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size1500

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 5 To Exon 7 (Pair 1)
Forward (1445,21)CAGTGTCAGCATCAACCAGACAmplicon SizecDNA: 165 bpgenomic: 2,712
Reverse (1609,21)CGCACATTGTAGCTGTTGGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.497 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.651 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceCAGTGTCAGCATCAACCAGACAGAGCCCCCCAAGGTGAGGCTGGAGGGCCGCAGCACCAC
CTCGCTTAGCGTCTCCTGGAGCATCCCCCCGCCGCAGCAGAGCCGAGTGTGGAAGTACGA
GGTCACTTACCGCAAGAAGGGAGACTCCAACAGCTACAATGTGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004431 (EPHA2)1651445 - 1609
Exon 5 To Exon 6 (Pair 1)
Forward (1445,21)CAGTGTCAGCATCAACCAGACAmplicon SizecDNA: 115 bpgenomic: 2,197
Reverse (1559,20)CTTCCACACTCGGCTCTGCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.497 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.682 kcal/mol in 3' area
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceCAGTGTCAGCATCAACCAGACAGAGCCCCCCAAGGTGAGGCTGGAGGGCCGCAGCACCAC
CTCGCTTAGCGTCTCCTGGAGCATCCCCCCGCCGCAGCAGAGCCGAGTGTGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004431 (EPHA2)1151445 - 1559
Exon 5 To Exon 7 (Pair 2)
Forward (1440,21)ACTGCCAGTGTCAGCATCAACAmplicon SizecDNA: 170 bpgenomic: 2,717
Reverse (1609,21)CGCACATTGTAGCTGTTGGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.309 kcal/mol
Forward Dimers-2.243 kcal/mol
Reverse Loops1.651 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceACTGCCAGTGTCAGCATCAACCAGACAGAGCCCCCCAAGGTGAGGCTGGAGGGCCGCAGC
ACCACCTCGCTTAGCGTCTCCTGGAGCATCCCCCCGCCGCAGCAGAGCCGAGTGTGGAAG
TACGAGGTCACTTACCGCAAGAAGGGAGACTCCAACAGCTACAATGTGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004431 (EPHA2)1701440 - 1609
Exon 5 To Exon 7 (Pair 3)
Forward (1440,21)ACTGCCAGTGTCAGCATCAACAmplicon SizecDNA: 168 bpgenomic: 2,715
Reverse (1607,22)CACATTGTAGCTGTTGGAGTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.309 kcal/mol
Forward Dimers-2.243 kcal/mol
Reverse Loops1.651 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceACTGCCAGTGTCAGCATCAACCAGACAGAGCCCCCCAAGGTGAGGCTGGAGGGCCGCAGC
ACCACCTCGCTTAGCGTCTCCTGGAGCATCCCCCCGCCGCAGCAGAGCCGAGTGTGGAAG
TACGAGGTCACTTACCGCAAGAAGGGAGACTCCAACAGCTACAATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004431 (EPHA2)1681440 - 1607
Exon 5 To Exon 6 (Pair 2)
Forward (1442,21)TGCCAGTGTCAGCATCAACCAAmplicon SizecDNA: 118 bpgenomic: 2,200
Reverse (1559,20)CTTCCACACTCGGCTCTGCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.309 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.682 kcal/mol in 3' area
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceTGCCAGTGTCAGCATCAACCAGACAGAGCCCCCCAAGGTGAGGCTGGAGGGCCGCAGCAC
CACCTCGCTTAGCGTCTCCTGGAGCATCCCCCCGCCGCAGCAGAGCCGAGTGTGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004431 (EPHA2)1181442 - 1559
Exon 5 To Exon 6 (Pair 3)
Forward (1440,21)ACTGCCAGTGTCAGCATCAACAmplicon SizecDNA: 120 bpgenomic: 2,202
Reverse (1559,20)CTTCCACACTCGGCTCTGCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.309 kcal/mol
Forward Dimers-2.243 kcal/mol
Reverse Loops1.682 kcal/mol in 3' area
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceACTGCCAGTGTCAGCATCAACCAGACAGAGCCCCCCAAGGTGAGGCTGGAGGGCCGCAGC
ACCACCTCGCTTAGCGTCTCCTGGAGCATCCCCCCGCCGCAGCAGAGCCGAGTGTGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004431 (EPHA2)1201440 - 1559
Exon 5 To Exon 7 (Pair 4)
Forward (1442,21)TGCCAGTGTCAGCATCAACCAAmplicon SizecDNA: 166 bpgenomic: 2,713
Reverse (1607,22)CACATTGTAGCTGTTGGAGTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.309 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.651 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceTGCCAGTGTCAGCATCAACCAGACAGAGCCCCCCAAGGTGAGGCTGGAGGGCCGCAGCAC
CACCTCGCTTAGCGTCTCCTGGAGCATCCCCCCGCCGCAGCAGAGCCGAGTGTGGAAGTA
CGAGGTCACTTACCGCAAGAAGGGAGACTCCAACAGCTACAATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004431 (EPHA2)1661442 - 1607
Exon 5 To Exon 7 (Pair 5)
Forward (1444,21)CCAGTGTCAGCATCAACCAGAAmplicon SizecDNA: 163 bpgenomic: 2,710
Reverse (1606,22)ACATTGTAGCTGTTGGAGTCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.831 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceCCAGTGTCAGCATCAACCAGACAGAGCCCCCCAAGGTGAGGCTGGAGGGCCGCAGCACCA
CCTCGCTTAGCGTCTCCTGGAGCATCCCCCCGCCGCAGCAGAGCCGAGTGTGGAAGTACG
AGGTCACTTACCGCAAGAAGGGAGACTCCAACAGCTACAATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004431 (EPHA2)1631444 - 1606
Exon 5 To Exon 7 (Pair 6)
Forward (1440,21)ACTGCCAGTGTCAGCATCAACAmplicon SizecDNA: 167 bpgenomic: 2,714
Reverse (1606,22)ACATTGTAGCTGTTGGAGTCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.309 kcal/mol
Forward Dimers-2.243 kcal/mol
Reverse Loops1.831 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceACTGCCAGTGTCAGCATCAACCAGACAGAGCCCCCCAAGGTGAGGCTGGAGGGCCGCAGC
ACCACCTCGCTTAGCGTCTCCTGGAGCATCCCCCCGCCGCAGCAGAGCCGAGTGTGGAAG
TACGAGGTCACTTACCGCAAGAAGGGAGACTCCAACAGCTACAATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004431 (EPHA2)1671440 - 1606
Exon 5 To Exon 7 (Pair 7)
Forward (1444,21)CCAGTGTCAGCATCAACCAGAAmplicon SizecDNA: 166 bpgenomic: 2,713
Reverse (1609,21)CGCACATTGTAGCTGTTGGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.651 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceCCAGTGTCAGCATCAACCAGACAGAGCCCCCCAAGGTGAGGCTGGAGGGCCGCAGCACCA
CCTCGCTTAGCGTCTCCTGGAGCATCCCCCCGCCGCAGCAGAGCCGAGTGTGGAAGTACG
AGGTCACTTACCGCAAGAAGGGAGACTCCAACAGCTACAATGTGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004431 (EPHA2)1661444 - 1609
Exon 5 To Exon 7 (Pair 8)
Forward (1445,21)CAGTGTCAGCATCAACCAGACAmplicon SizecDNA: 163 bpgenomic: 2,710
Reverse (1607,22)CACATTGTAGCTGTTGGAGTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.497 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.651 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceCAGTGTCAGCATCAACCAGACAGAGCCCCCCAAGGTGAGGCTGGAGGGCCGCAGCACCAC
CTCGCTTAGCGTCTCCTGGAGCATCCCCCCGCCGCAGCAGAGCCGAGTGTGGAAGTACGA
GGTCACTTACCGCAAGAAGGGAGACTCCAACAGCTACAATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004431 (EPHA2)1631445 - 1607
Exon 5 To Exon 7 (Pair 9)
Forward (1442,21)TGCCAGTGTCAGCATCAACCAAmplicon SizecDNA: 165 bpgenomic: 2,712
Reverse (1606,22)ACATTGTAGCTGTTGGAGTCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.309 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.831 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceTGCCAGTGTCAGCATCAACCAGACAGAGCCCCCCAAGGTGAGGCTGGAGGGCCGCAGCAC
CACCTCGCTTAGCGTCTCCTGGAGCATCCCCCCGCCGCAGCAGAGCCGAGTGTGGAAGTA
CGAGGTCACTTACCGCAAGAAGGGAGACTCCAACAGCTACAATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004431 (EPHA2)1651442 - 1606
Exon 5 To Exon 7 (Pair 10)
Forward (1445,21)CAGTGTCAGCATCAACCAGACAmplicon SizecDNA: 162 bpgenomic: 2,709
Reverse (1606,22)ACATTGTAGCTGTTGGAGTCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.497 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.831 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceCAGTGTCAGCATCAACCAGACAGAGCCCCCCAAGGTGAGGCTGGAGGGCCGCAGCACCAC
CTCGCTTAGCGTCTCCTGGAGCATCCCCCCGCCGCAGCAGAGCCGAGTGTGGAAGTACGA
GGTCACTTACCGCAAGAAGGGAGACTCCAACAGCTACAATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004431 (EPHA2)1621445 - 1606
Exon 5 To Exon 6 (Pair 4)
Forward (1444,21)CCAGTGTCAGCATCAACCAGAAmplicon SizecDNA: 116 bpgenomic: 2,198
Reverse (1559,20)CTTCCACACTCGGCTCTGCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.682 kcal/mol in 3' area
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceCCAGTGTCAGCATCAACCAGACAGAGCCCCCCAAGGTGAGGCTGGAGGGCCGCAGCACCA
CCTCGCTTAGCGTCTCCTGGAGCATCCCCCCGCCGCAGCAGAGCCGAGTGTGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004431 (EPHA2)1161444 - 1559
Exon 5 To Exon 7 (Pair 11)
Forward (1444,21)CCAGTGTCAGCATCAACCAGAAmplicon SizecDNA: 164 bpgenomic: 2,711
Reverse (1607,22)CACATTGTAGCTGTTGGAGTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.651 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceCCAGTGTCAGCATCAACCAGACAGAGCCCCCCAAGGTGAGGCTGGAGGGCCGCAGCACCA
CCTCGCTTAGCGTCTCCTGGAGCATCCCCCCGCCGCAGCAGAGCCGAGTGTGGAAGTACG
AGGTCACTTACCGCAAGAAGGGAGACTCCAACAGCTACAATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004431 (EPHA2)1641444 - 1607
Exon 5 To Exon 7 (Pair 12)
Forward (1442,21)TGCCAGTGTCAGCATCAACCAAmplicon SizecDNA: 168 bpgenomic: 2,715
Reverse (1609,21)CGCACATTGTAGCTGTTGGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.309 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.651 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.128 kcal/mol outside primersite
Amplicon SequenceTGCCAGTGTCAGCATCAACCAGACAGAGCCCCCCAAGGTGAGGCTGGAGGGCCGCAGCAC
CACCTCGCTTAGCGTCTCCTGGAGCATCCCCCCGCCGCAGCAGAGCCGAGTGTGGAAGTA
CGAGGTCACTTACCGCAAGAAGGGAGACTCCAACAGCTACAATGTGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004431 (EPHA2)1681442 - 1609
 

See below for some more details.

Program Output:

Loading ...