Design Results for FARP1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 7 To Exon 9 (Pair 1)
Forward (2827,22)ACCTCGTGGAAGGTGACTATTTAmplicon SizecDNA: 143 bpgenomic: 24,350
Reverse (2969,23)CGGAAAGAATTTCACCACAAACTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.036 kcal/mol in 3' area
Forward Dimers-2.392 kcal/mol
Reverse Loops0.303 kcal/mol
Reverse Dimers-1.062 kcal/mol
Forward-Reverse Dimers-2.879 kcal/mol
Amplicon Folding0.036 kcal/mol inside primersite
Amplicon SequenceACCTCGTGGAAGGTGACTATTTTGGCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGT
GGCTGGATCTCCTAAAACCCATTGTGAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTA
AGTTTGTGGTGAAATTCTTTCCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)143557 - 699
Exon 7 To Exon 9 (Pair 2)
Forward (2849,21)TGGCCTCGAGTTTCCTGATCAAmplicon SizecDNA: 155 bpgenomic: 24,362
Reverse (3003,23)TTGTGAGTTCTTCTTGGAGTTGTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.478 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops1.1 kcal/mol
Reverse Dimers0.286 kcal/mol
Forward-Reverse Dimers-0.856 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceTGGCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGTGGCTGGATCTCCTAAAACCCAT
TGTGAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTAAGTTTGTGGTGAAATTCTTTCC
GCCTGACCACACACAACTCCAAGAAGAACTCACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)155579 - 733
Exon 7 To Exon 9 (Pair 3)
Forward (2849,21)TGGCCTCGAGTTTCCTGATCAAmplicon SizecDNA: 123 bpgenomic: 24,330
Reverse (2971,22)GGCGGAAAGAATTTCACCACAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.478 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops0.303 kcal/mol
Reverse Dimers-1.062 kcal/mol
Forward-Reverse Dimers-1.327 kcal/mol
Amplicon Folding0.319 kcal/mol outside primersite
Amplicon SequenceTGGCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGTGGCTGGATCTCCTAAAACCCAT
TGTGAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTAAGTTTGTGGTGAAATTCTTTCC
GCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)123579 - 701
Exon 7 To Exon 9 (Pair 4)
Forward (2848,21)TTGGCCTCGAGTTTCCTGATCAmplicon SizecDNA: 124 bpgenomic: 24,331
Reverse (2971,22)GGCGGAAAGAATTTCACCACAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.478 kcal/mol in 3' area
Forward Dimers-2.61 kcal/mol
Reverse Loops0.303 kcal/mol
Reverse Dimers-1.062 kcal/mol
Forward-Reverse Dimers-1.327 kcal/mol
Amplicon Folding0.319 kcal/mol outside primersite
Amplicon SequenceTTGGCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGTGGCTGGATCTCCTAAAACCCA
TTGTGAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTAAGTTTGTGGTGAAATTCTTTC
CGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)124578 - 701
Exon 7 To Exon 9 (Pair 5)
Forward (2852,22)CCTCGAGTTTCCTGATCACAAAAmplicon SizecDNA: 120 bpgenomic: 24,327
Reverse (2971,22)GGCGGAAAGAATTTCACCACAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.478 kcal/mol
Forward Dimers-2.428 kcal/mol
Reverse Loops0.303 kcal/mol
Reverse Dimers-1.062 kcal/mol
Forward-Reverse Dimers-1.192 kcal/mol
Amplicon Folding0.319 kcal/mol outside primersite
Amplicon SequenceCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGTGGCTGGATCTCCTAAAACCCATTGT
GAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTAAGTTTGTGGTGAAATTCTTTCCGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)120582 - 701
Exon 7 To Exon 9 (Pair 6)
Forward (2849,21)TGGCCTCGAGTTTCCTGATCAAmplicon SizecDNA: 124 bpgenomic: 24,331
Reverse (2972,22)AGGCGGAAAGAATTTCACCACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.478 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops0.303 kcal/mol
Reverse Dimers-1.062 kcal/mol
Forward-Reverse Dimers-2.548 kcal/mol
Amplicon Folding0.319 kcal/mol outside primersite
Amplicon SequenceTGGCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGTGGCTGGATCTCCTAAAACCCAT
TGTGAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTAAGTTTGTGGTGAAATTCTTTCC
GCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)124579 - 702
Exon 7 To Exon 9 (Pair 7)
Forward (2849,21)TGGCCTCGAGTTTCCTGATCAAmplicon SizecDNA: 112 bpgenomic: 24,319
Reverse (2960,24)TTTCACCACAAACTTAACAACAACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.478 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops2.921 kcal/mol in 3' area
Reverse Dimers0.433 kcal/mol
Forward-Reverse Dimers-2.703 kcal/mol
Amplicon Folding0.319 kcal/mol outside primersite
Amplicon SequenceTGGCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGTGGCTGGATCTCCTAAAACCCAT
TGTGAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTAAGTTTGTGGTGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)112579 - 690
Exon 7 To Exon 9 (Pair 8)
Forward (2851,21)GCCTCGAGTTTCCTGATCACAAmplicon SizecDNA: 110 bpgenomic: 24,317
Reverse (2960,24)TTTCACCACAAACTTAACAACAACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.478 kcal/mol
Forward Dimers-2.428 kcal/mol
Reverse Loops2.921 kcal/mol in 3' area
Reverse Dimers0.433 kcal/mol
Forward-Reverse Dimers-2.703 kcal/mol
Amplicon Folding0.319 kcal/mol outside primersite
Amplicon SequenceGCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGTGGCTGGATCTCCTAAAACCCATTG
TGAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTAAGTTTGTGGTGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)110581 - 690
Exon 7 To Exon 9 (Pair 9)
Forward (2851,21)GCCTCGAGTTTCCTGATCACAAmplicon SizecDNA: 124 bpgenomic: 24,331
Reverse (2974,22)TCAGGCGGAAAGAATTTCACCANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.478 kcal/mol
Forward Dimers-2.428 kcal/mol
Reverse Loops0.303 kcal/mol in 3' area
Reverse Dimers-1.062 kcal/mol
Forward-Reverse Dimers-2.731 kcal/mol
Amplicon Folding0.319 kcal/mol outside primersite
Amplicon SequenceGCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGTGGCTGGATCTCCTAAAACCCATTG
TGAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTAAGTTTGTGGTGAAATTCTTTCCGC
CTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)124581 - 704
Exon 7 To Exon 9 (Pair 10)
Forward (2848,21)TTGGCCTCGAGTTTCCTGATCAmplicon SizecDNA: 125 bpgenomic: 24,332
Reverse (2972,22)AGGCGGAAAGAATTTCACCACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.478 kcal/mol in 3' area
Forward Dimers-2.61 kcal/mol
Reverse Loops0.303 kcal/mol
Reverse Dimers-1.062 kcal/mol
Forward-Reverse Dimers-2.548 kcal/mol
Amplicon Folding0.319 kcal/mol outside primersite
Amplicon SequenceTTGGCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGTGGCTGGATCTCCTAAAACCCA
TTGTGAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTAAGTTTGTGGTGAAATTCTTTC
CGCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)125578 - 702
Exon 7 To Exon 10 (Pair 1)
Forward (2849,21)TGGCCTCGAGTTTCCTGATCAAmplicon SizecDNA: 200 bpgenomic: 34,032
Reverse (3048,20)TGCCTTGAGCCAAGTCCTGCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.478 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops0.839 kcal/mol
Reverse Dimers-0.794 kcal/mol
Forward-Reverse Dimers-2.394 kcal/mol
Amplicon Folding-0.739 kcal/mol outside primersite
Amplicon SequenceTGGCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGTGGCTGGATCTCCTAAAACCCAT
TGTGAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTAAGTTTGTGGTGAAATTCTTTCC
GCCTGACCACACACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAA
GCAGGACTTGGCTCAAGGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)200579 - 778
Exon 7 To Exon 9 (Pair 11)
Forward (2852,22)CCTCGAGTTTCCTGATCACAAAAmplicon SizecDNA: 109 bpgenomic: 24,316
Reverse (2960,24)TTTCACCACAAACTTAACAACAACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.478 kcal/mol
Forward Dimers-2.428 kcal/mol
Reverse Loops2.921 kcal/mol in 3' area
Reverse Dimers0.433 kcal/mol
Forward-Reverse Dimers-2.703 kcal/mol
Amplicon Folding0.319 kcal/mol outside primersite
Amplicon SequenceCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGTGGCTGGATCTCCTAAAACCCATTGT
GAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTAAGTTTGTGGTGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)109582 - 690
Exon 7 To Exon 9 (Pair 12)
Forward (2852,22)CCTCGAGTTTCCTGATCACAAAAmplicon SizecDNA: 121 bpgenomic: 24,328
Reverse (2972,22)AGGCGGAAAGAATTTCACCACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.478 kcal/mol
Forward Dimers-2.428 kcal/mol
Reverse Loops0.303 kcal/mol
Reverse Dimers-1.062 kcal/mol
Forward-Reverse Dimers-1.192 kcal/mol
Amplicon Folding0.319 kcal/mol outside primersite
Amplicon SequenceCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGTGGCTGGATCTCCTAAAACCCATTGT
GAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTAAGTTTGTGGTGAAATTCTTTCCGCC
T
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)121582 - 702
Exon 7 To Exon 9 (Pair 13)
Forward (2849,21)TGGCCTCGAGTTTCCTGATCAAmplicon SizecDNA: 153 bpgenomic: 24,360
Reverse (3001,22)GTGAGTTCTTCTTGGAGTTGTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.478 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops1.1 kcal/mol
Reverse Dimers0.286 kcal/mol
Forward-Reverse Dimers-0.856 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceTGGCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGTGGCTGGATCTCCTAAAACCCAT
TGTGAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTAAGTTTGTGGTGAAATTCTTTCC
GCCTGACCACACACAACTCCAAGAAGAACTCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)153579 - 731
Exon 7 To Exon 9 (Pair 14)
Forward (2852,22)CCTCGAGTTTCCTGATCACAAAAmplicon SizecDNA: 112 bpgenomic: 24,319
Reverse (2963,24)GAATTTCACCACAAACTTAACAACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.478 kcal/mol
Forward Dimers-2.428 kcal/mol
Reverse Loops2.47 kcal/mol
Reverse Dimers-1.062 kcal/mol
Forward-Reverse Dimers-2.703 kcal/mol
Amplicon Folding0.319 kcal/mol outside primersite
Amplicon SequenceCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGTGGCTGGATCTCCTAAAACCCATTGT
GAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTAAGTTTGTGGTGAAATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)112582 - 693
Exon 7 To Exon 9 (Pair 15)
Forward (2849,21)TGGCCTCGAGTTTCCTGATCAAmplicon SizecDNA: 115 bpgenomic: 24,322
Reverse (2963,24)GAATTTCACCACAAACTTAACAACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.478 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops2.47 kcal/mol
Reverse Dimers-1.062 kcal/mol
Forward-Reverse Dimers-2.703 kcal/mol
Amplicon Folding0.319 kcal/mol outside primersite
Amplicon SequenceTGGCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGTGGCTGGATCTCCTAAAACCCAT
TGTGAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTAAGTTTGTGGTGAAATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)115579 - 693
Exon 7 To Exon 9 (Pair 16)
Forward (2827,22)ACCTCGTGGAAGGTGACTATTTAmplicon SizecDNA: 134 bpgenomic: 24,341
Reverse (2960,24)TTTCACCACAAACTTAACAACAACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.036 kcal/mol in 3' area
Forward Dimers-2.392 kcal/mol
Reverse Loops2.921 kcal/mol in 3' area
Reverse Dimers0.433 kcal/mol
Forward-Reverse Dimers-2.879 kcal/mol
Amplicon Folding0.036 kcal/mol inside primersite
Amplicon SequenceACCTCGTGGAAGGTGACTATTTTGGCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGT
GGCTGGATCTCCTAAAACCCATTGTGAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTA
AGTTTGTGGTGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)134557 - 690
Exon 7 To Exon 9 (Pair 17)
Forward (2827,22)ACCTCGTGGAAGGTGACTATTTAmplicon SizecDNA: 137 bpgenomic: 24,344
Reverse (2963,24)GAATTTCACCACAAACTTAACAACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.036 kcal/mol in 3' area
Forward Dimers-2.392 kcal/mol
Reverse Loops2.47 kcal/mol
Reverse Dimers-1.062 kcal/mol
Forward-Reverse Dimers-2.879 kcal/mol
Amplicon Folding0.036 kcal/mol inside primersite
Amplicon SequenceACCTCGTGGAAGGTGACTATTTTGGCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGT
GGCTGGATCTCCTAAAACCCATTGTGAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTA
AGTTTGTGGTGAAATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)137557 - 693
Exon 7 To Exon 9 (Pair 18)
Forward (2851,21)GCCTCGAGTTTCCTGATCACAAmplicon SizecDNA: 113 bpgenomic: 24,320
Reverse (2963,24)GAATTTCACCACAAACTTAACAACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.478 kcal/mol
Forward Dimers-2.428 kcal/mol
Reverse Loops2.47 kcal/mol
Reverse Dimers-1.062 kcal/mol
Forward-Reverse Dimers-2.703 kcal/mol
Amplicon Folding0.319 kcal/mol outside primersite
Amplicon SequenceGCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGTGGCTGGATCTCCTAAAACCCATTG
TGAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTAAGTTTGTGGTGAAATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)113581 - 693
Exon 7 To Exon 9 (Pair 19)
Forward (2848,21)TTGGCCTCGAGTTTCCTGATCAmplicon SizecDNA: 113 bpgenomic: 24,320
Reverse (2960,24)TTTCACCACAAACTTAACAACAACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.478 kcal/mol in 3' area
Forward Dimers-2.61 kcal/mol
Reverse Loops2.921 kcal/mol in 3' area
Reverse Dimers0.433 kcal/mol
Forward-Reverse Dimers-2.703 kcal/mol
Amplicon Folding0.319 kcal/mol outside primersite
Amplicon SequenceTTGGCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGTGGCTGGATCTCCTAAAACCCA
TTGTGAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTAAGTTTGTGGTGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)113578 - 690
Exon 7 To Exon 9 (Pair 20)
Forward (2852,22)CCTCGAGTTTCCTGATCACAAAAmplicon SizecDNA: 123 bpgenomic: 24,330
Reverse (2974,22)TCAGGCGGAAAGAATTTCACCANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.478 kcal/mol
Forward Dimers-2.428 kcal/mol
Reverse Loops0.303 kcal/mol in 3' area
Reverse Dimers-1.062 kcal/mol
Forward-Reverse Dimers-2.519 kcal/mol
Amplicon Folding0.319 kcal/mol outside primersite
Amplicon SequenceCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGTGGCTGGATCTCCTAAAACCCATTGT
GAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTAAGTTTGTGGTGAAATTCTTTCCGCC
TGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)123582 - 704
Exon 7 To Exon 10 (Pair 2)
Forward (2827,22)ACCTCGTGGAAGGTGACTATTTAmplicon SizecDNA: 222 bpgenomic: 34,054
Reverse (3048,20)TGCCTTGAGCCAAGTCCTGCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.036 kcal/mol in 3' area
Forward Dimers-2.392 kcal/mol
Reverse Loops0.839 kcal/mol
Reverse Dimers-0.794 kcal/mol
Forward-Reverse Dimers-2.148 kcal/mol
Amplicon Folding-0.739 kcal/mol outside primersite
Amplicon SequenceACCTCGTGGAAGGTGACTATTTTGGCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGT
GGCTGGATCTCCTAAAACCCATTGTGAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTA
AGTTTGTGGTGAAATTCTTTCCGCCTGACCACACACAACTCCAAGAAGAACTCACAAGGT
ACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGGCTCAAGGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)222557 - 778
Exon 7 To Exon 9 (Pair 21)
Forward (2851,21)GCCTCGAGTTTCCTGATCACAAmplicon SizecDNA: 122 bpgenomic: 24,329
Reverse (2972,22)AGGCGGAAAGAATTTCACCACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.478 kcal/mol
Forward Dimers-2.428 kcal/mol
Reverse Loops0.303 kcal/mol
Reverse Dimers-1.062 kcal/mol
Forward-Reverse Dimers-2.257 kcal/mol
Amplicon Folding0.319 kcal/mol outside primersite
Amplicon SequenceGCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGTGGCTGGATCTCCTAAAACCCATTG
TGAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTAAGTTTGTGGTGAAATTCTTTCCGC
CT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)122581 - 702
Exon 7 To Exon 9 (Pair 22)
Forward (2851,21)GCCTCGAGTTTCCTGATCACAAmplicon SizecDNA: 121 bpgenomic: 24,328
Reverse (2971,22)GGCGGAAAGAATTTCACCACAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.478 kcal/mol
Forward Dimers-2.428 kcal/mol
Reverse Loops0.303 kcal/mol
Reverse Dimers-1.062 kcal/mol
Forward-Reverse Dimers-1.192 kcal/mol
Amplicon Folding0.319 kcal/mol outside primersite
Amplicon SequenceGCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGTGGCTGGATCTCCTAAAACCCATTG
TGAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTAAGTTTGTGGTGAAATTCTTTCCGC
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)121581 - 701
Exon 7 To Exon 9 (Pair 23)
Forward (2848,21)TTGGCCTCGAGTTTCCTGATCAmplicon SizecDNA: 156 bpgenomic: 24,363
Reverse (3003,23)TTGTGAGTTCTTCTTGGAGTTGTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.478 kcal/mol in 3' area
Forward Dimers-2.61 kcal/mol
Reverse Loops1.1 kcal/mol
Reverse Dimers0.286 kcal/mol
Forward-Reverse Dimers-0.856 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceTTGGCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGTGGCTGGATCTCCTAAAACCCA
TTGTGAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTAAGTTTGTGGTGAAATTCTTTC
CGCCTGACCACACACAACTCCAAGAAGAACTCACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)156578 - 733
Exon 7 To Exon 10 (Pair 3)
Forward (2848,21)TTGGCCTCGAGTTTCCTGATCAmplicon SizecDNA: 201 bpgenomic: 34,033
Reverse (3048,20)TGCCTTGAGCCAAGTCCTGCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.478 kcal/mol in 3' area
Forward Dimers-2.61 kcal/mol
Reverse Loops0.839 kcal/mol
Reverse Dimers-0.794 kcal/mol
Forward-Reverse Dimers-2.769 kcal/mol
Amplicon Folding-0.739 kcal/mol outside primersite
Amplicon SequenceTTGGCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGTGGCTGGATCTCCTAAAACCCA
TTGTGAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTAAGTTTGTGGTGAAATTCTTTC
CGCCTGACCACACACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGA
AGCAGGACTTGGCTCAAGGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)201578 - 778
Exon 7 To Exon 9 (Pair 24)
Forward (2848,21)TTGGCCTCGAGTTTCCTGATCAmplicon SizecDNA: 116 bpgenomic: 24,323
Reverse (2963,24)GAATTTCACCACAAACTTAACAACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.478 kcal/mol in 3' area
Forward Dimers-2.61 kcal/mol
Reverse Loops2.47 kcal/mol
Reverse Dimers-1.062 kcal/mol
Forward-Reverse Dimers-2.703 kcal/mol
Amplicon Folding0.319 kcal/mol outside primersite
Amplicon SequenceTTGGCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGTGGCTGGATCTCCTAAAACCCA
TTGTGAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTAAGTTTGTGGTGAAATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)116578 - 693
Exon 7 To Exon 9 (Pair 25)
Forward (2848,21)TTGGCCTCGAGTTTCCTGATCAmplicon SizecDNA: 154 bpgenomic: 24,361
Reverse (3001,22)GTGAGTTCTTCTTGGAGTTGTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.478 kcal/mol in 3' area
Forward Dimers-2.61 kcal/mol
Reverse Loops1.1 kcal/mol
Reverse Dimers0.286 kcal/mol
Forward-Reverse Dimers-0.856 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceTTGGCCTCGAGTTTCCTGATCACAAAAAGATCACGGTGTGGCTGGATCTCCTAAAACCCA
TTGTGAAACAGATTAGAAGGCCAAAGCACGTTGTTGTTAAGTTTGTGGTGAAATTCTTTC
CGCCTGACCACACACAACTCCAAGAAGAACTCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)154578 - 731
Exon 9 To Exon 11 (Pair 1)
Forward (2981,23)ACAACTCCAAGAAGAACTCACAAAmplicon SizecDNA: 200 bpgenomic: 16,636
Reverse (3180,21)GTGCGTCTTGCTGAGGTATGTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops0.628 kcal/mol
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-1.53 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGGC
TCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGCA
ATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAATA
CATACCTCAGCAAGACGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)200711 - 910
Exon 9 To Exon 11 (Pair 2)
Forward (2980,22)CACAACTCCAAGAAGAACTCACAmplicon SizecDNA: 198 bpgenomic: 16,634
Reverse (3177,23)CGTCTTGCTGAGGTATGTATTTANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops1.855 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.53 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceCACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGG
CTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGC
AATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAAT
ACATACCTCAGCAAGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)198710 - 907
Exon 9 To Exon 11 (Pair 3)
Forward (2981,23)ACAACTCCAAGAAGAACTCACAAAmplicon SizecDNA: 198 bpgenomic: 16,634
Reverse (3178,22)GCGTCTTGCTGAGGTATGTATTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops0.899 kcal/mol
Reverse Dimers-0.058 kcal/mol
Forward-Reverse Dimers-1.53 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGGC
TCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGCA
ATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAATA
CATACCTCAGCAAGACGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)198711 - 908
Exon 9 To Exon 12 (Pair 1)
Forward (2981,23)ACAACTCCAAGAAGAACTCACAAAmplicon SizecDNA: 281 bpgenomic: 17,539
Reverse (3261,22)CAATCTCTAGGAGCTGGAAATCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops1.646 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.364 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGGC
TCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGCA
ATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAATA
CATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACATTGG
ACAAACACCAGCAGAATCAGATTTCCAGCTCCTAGAGATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)281711 - 991
Exon 9 To Exon 11 (Pair 4)
Forward (2981,23)ACAACTCCAAGAAGAACTCACAAAmplicon SizecDNA: 167 bpgenomic: 16,603
Reverse (3147,21)CTAAGTGCTCTCTGTCCAAGGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops1.333 kcal/mol
Reverse Dimers-1.101 kcal/mol
Forward-Reverse Dimers-2.189 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGGC
TCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGCA
ATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)167711 - 877
Exon 9 To Exon 12 (Pair 2)
Forward (2978,22)CACACAACTCCAAGAAGAACTCAmplicon SizecDNA: 278 bpgenomic: 17,536
Reverse (3255,22)CTAGGAGCTGGAAATCTGATTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops1.474 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.25 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceCACACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTT
GGCTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGT
GCAATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAA
ATACATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACAT
TGGACAAACACCAGCAGAATCAGATTTCCAGCTCCTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)278708 - 985
Exon 9 To Exon 11 (Pair 5)
Forward (2978,22)CACACAACTCCAAGAAGAACTCAmplicon SizecDNA: 202 bpgenomic: 16,638
Reverse (3179,22)TGCGTCTTGCTGAGGTATGTATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops0.628 kcal/mol
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-1.53 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceCACACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTT
GGCTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGT
GCAATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAA
ATACATACCTCAGCAAGACGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)202708 - 909
Exon 9 To Exon 12 (Pair 3)
Forward (2953,22)TGGTGAAATTCTTTCCGCCTGAAmplicon SizecDNA: 295 bpgenomic: 17,553
Reverse (3247,22)TGGAAATCTGATTCTGCTGGTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.323 kcal/mol
Forward Dimers-1.026 kcal/mol
Reverse Loops1.474 kcal/mol
Reverse Dimers-2.314 kcal/mol
Forward-Reverse Dimers-1.439 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceTGGTGAAATTCTTTCCGCCTGACCACACACAACTCCAAGAAGAACTCACAAGGTACCTGT
TCGCGCTGCAGGTGAAGCAGGACTTGGCTCAAGGCAGGTTGACGTGTAATGACACCAGCG
CAGCTCTCTTGATTTCACACATTGTGCAATCTGAGATTGGGGATTTTGATGAAGCCTTGG
ACAGAGAGCACTTAGCAAAAAATAAATACATACCTCAGCAAGACGCACTAGAGGACAAAA
TCGTGGAATTTCACCATAACCACATTGGACAAACACCAGCAGAATCAGATTTCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)295683 - 977
Exon 9 To Exon 12 (Pair 4)
Forward (2953,22)TGGTGAAATTCTTTCCGCCTGAAmplicon SizecDNA: 287 bpgenomic: 17,545
Reverse (3239,22)TGATTCTGCTGGTGTTTGTCCANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.323 kcal/mol
Forward Dimers-1.026 kcal/mol
Reverse Loops1.704 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.058 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceTGGTGAAATTCTTTCCGCCTGACCACACACAACTCCAAGAAGAACTCACAAGGTACCTGT
TCGCGCTGCAGGTGAAGCAGGACTTGGCTCAAGGCAGGTTGACGTGTAATGACACCAGCG
CAGCTCTCTTGATTTCACACATTGTGCAATCTGAGATTGGGGATTTTGATGAAGCCTTGG
ACAGAGAGCACTTAGCAAAAAATAAATACATACCTCAGCAAGACGCACTAGAGGACAAAA
TCGTGGAATTTCACCATAACCACATTGGACAAACACCAGCAGAATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)287683 - 969
Exon 9 To Exon 11 (Pair 6)
Forward (2980,22)CACAACTCCAAGAAGAACTCACAmplicon SizecDNA: 200 bpgenomic: 16,636
Reverse (3179,22)TGCGTCTTGCTGAGGTATGTATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops0.628 kcal/mol
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-1.53 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceCACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGG
CTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGC
AATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAAT
ACATACCTCAGCAAGACGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)200710 - 909
Exon 9 To Exon 11 (Pair 7)
Forward (2980,22)CACAACTCCAAGAAGAACTCACAmplicon SizecDNA: 201 bpgenomic: 16,637
Reverse (3180,21)GTGCGTCTTGCTGAGGTATGTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops0.628 kcal/mol
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-1.53 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceCACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGG
CTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGC
AATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAAT
ACATACCTCAGCAAGACGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)201710 - 910
Exon 9 To Exon 12 (Pair 5)
Forward (2978,22)CACACAACTCCAAGAAGAACTCAmplicon SizecDNA: 274 bpgenomic: 17,532
Reverse (3251,22)GAGCTGGAAATCTGATTCTGCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops1.413 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.428 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceCACACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTT
GGCTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGT
GCAATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAA
ATACATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACAT
TGGACAAACACCAGCAGAATCAGATTTCCAGCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)274708 - 981
Exon 9 To Exon 11 (Pair 8)
Forward (2978,22)CACACAACTCCAAGAAGAACTCAmplicon SizecDNA: 204 bpgenomic: 16,640
Reverse (3181,21)AGTGCGTCTTGCTGAGGTATGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops0.628 kcal/mol
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-1.53 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceCACACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTT
GGCTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGT
GCAATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAA
ATACATACCTCAGCAAGACGCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)204708 - 911
Exon 9 To Exon 12 (Pair 6)
Forward (2980,22)CACAACTCCAAGAAGAACTCACAmplicon SizecDNA: 280 bpgenomic: 17,538
Reverse (3259,22)ATCTCTAGGAGCTGGAAATCTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops1.646 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.364 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceCACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGG
CTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGC
AATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAAT
ACATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACATTG
GACAAACACCAGCAGAATCAGATTTCCAGCTCCTAGAGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)280710 - 989
Exon 9 To Exon 11 (Pair 9)
Forward (2981,23)ACAACTCCAAGAAGAACTCACAAAmplicon SizecDNA: 170 bpgenomic: 16,606
Reverse (3150,22)TTGCTAAGTGCTCTCTGTCCAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops0.913 kcal/mol
Reverse Dimers-1.101 kcal/mol
Forward-Reverse Dimers-2.189 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGGC
TCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGCA
ATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)170711 - 880
Exon 9 To Exon 11 (Pair 10)
Forward (2981,23)ACAACTCCAAGAAGAACTCACAAAmplicon SizecDNA: 171 bpgenomic: 16,607
Reverse (3151,22)TTTGCTAAGTGCTCTCTGTCCANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops0.913 kcal/mol
Reverse Dimers-1.101 kcal/mol
Forward-Reverse Dimers-2.189 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGGC
TCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGCA
ATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)171711 - 881
Exon 9 To Exon 12 (Pair 7)
Forward (2980,22)CACAACTCCAAGAAGAACTCACAmplicon SizecDNA: 274 bpgenomic: 17,532
Reverse (3253,22)AGGAGCTGGAAATCTGATTCTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops1.474 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.25 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceCACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGG
CTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGC
AATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAAT
ACATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACATTG
GACAAACACCAGCAGAATCAGATTTCCAGCTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)274710 - 983
Exon 9 To Exon 10 (Pair 1)
Forward (2953,22)TGGTGAAATTCTTTCCGCCTGAAmplicon SizecDNA: 96 bpgenomic: 9,721
Reverse (3048,20)TGCCTTGAGCCAAGTCCTGCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.323 kcal/mol
Forward Dimers-1.026 kcal/mol
Reverse Loops0.839 kcal/mol
Reverse Dimers-0.794 kcal/mol
Forward-Reverse Dimers-0.943 kcal/mol
Amplicon Folding-0.608 kcal/mol outside primersite
Amplicon SequenceTGGTGAAATTCTTTCCGCCTGACCACACACAACTCCAAGAAGAACTCACAAGGTACCTGT
TCGCGCTGCAGGTGAAGCAGGACTTGGCTCAAGGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)96683 - 778
Exon 9 To Exon 12 (Pair 8)
Forward (2981,23)ACAACTCCAAGAAGAACTCACAAAmplicon SizecDNA: 278 bpgenomic: 17,536
Reverse (3258,22)TCTCTAGGAGCTGGAAATCTGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops1.646 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.364 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGGC
TCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGCA
ATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAATA
CATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACATTGG
ACAAACACCAGCAGAATCAGATTTCCAGCTCCTAGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)278711 - 988
Exon 9 To Exon 12 (Pair 9)
Forward (2980,22)CACAACTCCAAGAAGAACTCACAmplicon SizecDNA: 282 bpgenomic: 17,540
Reverse (3261,22)CAATCTCTAGGAGCTGGAAATCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops1.646 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.364 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceCACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGG
CTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGC
AATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAAT
ACATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACATTG
GACAAACACCAGCAGAATCAGATTTCCAGCTCCTAGAGATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)282710 - 991
Exon 9 To Exon 12 (Pair 10)
Forward (2980,22)CACAACTCCAAGAAGAACTCACAmplicon SizecDNA: 276 bpgenomic: 17,534
Reverse (3255,22)CTAGGAGCTGGAAATCTGATTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops1.474 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.25 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceCACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGG
CTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGC
AATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAAT
ACATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACATTG
GACAAACACCAGCAGAATCAGATTTCCAGCTCCTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)276710 - 985
Exon 9 To Exon 12 (Pair 11)
Forward (2981,23)ACAACTCCAAGAAGAACTCACAAAmplicon SizecDNA: 259 bpgenomic: 17,517
Reverse (3239,22)TGATTCTGCTGGTGTTTGTCCANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops1.704 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.752 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGGC
TCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGCA
ATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAATA
CATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACATTGG
ACAAACACCAGCAGAATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)259711 - 969
Exon 9 To Exon 12 (Pair 12)
Forward (2980,22)CACAACTCCAAGAAGAACTCACAmplicon SizecDNA: 279 bpgenomic: 17,537
Reverse (3258,22)TCTCTAGGAGCTGGAAATCTGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops1.646 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.364 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceCACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGG
CTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGC
AATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAAT
ACATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACATTG
GACAAACACCAGCAGAATCAGATTTCCAGCTCCTAGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)279710 - 988
Exon 9 To Exon 11 (Pair 11)
Forward (2980,22)CACAACTCCAAGAAGAACTCACAmplicon SizecDNA: 204 bpgenomic: 16,640
Reverse (3183,21)CTAGTGCGTCTTGCTGAGGTANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops0.628 kcal/mol
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-1.53 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceCACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGG
CTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGC
AATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAAT
ACATACCTCAGCAAGACGCACTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)204710 - 913
Exon 9 To Exon 12 (Pair 13)
Forward (2980,22)CACAACTCCAAGAAGAACTCACAmplicon SizecDNA: 272 bpgenomic: 17,530
Reverse (3251,22)GAGCTGGAAATCTGATTCTGCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops1.413 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.428 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceCACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGG
CTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGC
AATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAAT
ACATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACATTG
GACAAACACCAGCAGAATCAGATTTCCAGCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)272710 - 981
Exon 9 To Exon 12 (Pair 14)
Forward (2978,22)CACACAACTCCAAGAAGAACTCAmplicon SizecDNA: 281 bpgenomic: 17,539
Reverse (3258,22)TCTCTAGGAGCTGGAAATCTGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops1.646 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.364 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceCACACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTT
GGCTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGT
GCAATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAA
ATACATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACAT
TGGACAAACACCAGCAGAATCAGATTTCCAGCTCCTAGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)281708 - 988
Exon 9 To Exon 12 (Pair 15)
Forward (2981,23)ACAACTCCAAGAAGAACTCACAAAmplicon SizecDNA: 271 bpgenomic: 17,529
Reverse (3251,22)GAGCTGGAAATCTGATTCTGCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops1.413 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.428 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGGC
TCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGCA
ATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAATA
CATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACATTGG
ACAAACACCAGCAGAATCAGATTTCCAGCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)271711 - 981
Exon 9 To Exon 12 (Pair 16)
Forward (2953,22)TGGTGAAATTCTTTCCGCCTGAAmplicon SizecDNA: 294 bpgenomic: 17,552
Reverse (3246,22)GGAAATCTGATTCTGCTGGTGTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.323 kcal/mol
Forward Dimers-1.026 kcal/mol
Reverse Loops1.474 kcal/mol
Reverse Dimers-2.314 kcal/mol
Forward-Reverse Dimers-1.058 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceTGGTGAAATTCTTTCCGCCTGACCACACACAACTCCAAGAAGAACTCACAAGGTACCTGT
TCGCGCTGCAGGTGAAGCAGGACTTGGCTCAAGGCAGGTTGACGTGTAATGACACCAGCG
CAGCTCTCTTGATTTCACACATTGTGCAATCTGAGATTGGGGATTTTGATGAAGCCTTGG
ACAGAGAGCACTTAGCAAAAAATAAATACATACCTCAGCAAGACGCACTAGAGGACAAAA
TCGTGGAATTTCACCATAACCACATTGGACAAACACCAGCAGAATCAGATTTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)294683 - 976
Exon 9 To Exon 12 (Pair 17)
Forward (2953,22)TGGTGAAATTCTTTCCGCCTGAAmplicon SizecDNA: 291 bpgenomic: 17,549
Reverse (3243,23)AATCTGATTCTGCTGGTGTTTGTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.323 kcal/mol
Forward Dimers-1.026 kcal/mol
Reverse Loops1.704 kcal/mol
Reverse Dimers-1.416 kcal/mol
Forward-Reverse Dimers-1.058 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceTGGTGAAATTCTTTCCGCCTGACCACACACAACTCCAAGAAGAACTCACAAGGTACCTGT
TCGCGCTGCAGGTGAAGCAGGACTTGGCTCAAGGCAGGTTGACGTGTAATGACACCAGCG
CAGCTCTCTTGATTTCACACATTGTGCAATCTGAGATTGGGGATTTTGATGAAGCCTTGG
ACAGAGAGCACTTAGCAAAAAATAAATACATACCTCAGCAAGACGCACTAGAGGACAAAA
TCGTGGAATTTCACCATAACCACATTGGACAAACACCAGCAGAATCAGATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)291683 - 973
Exon 9 To Exon 12 (Pair 18)
Forward (2953,22)TGGTGAAATTCTTTCCGCCTGAAmplicon SizecDNA: 293 bpgenomic: 17,551
Reverse (3245,23)GAAATCTGATTCTGCTGGTGTTTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.323 kcal/mol
Forward Dimers-1.026 kcal/mol
Reverse Loops1.474 kcal/mol
Reverse Dimers-2.314 kcal/mol
Forward-Reverse Dimers-1.058 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceTGGTGAAATTCTTTCCGCCTGACCACACACAACTCCAAGAAGAACTCACAAGGTACCTGT
TCGCGCTGCAGGTGAAGCAGGACTTGGCTCAAGGCAGGTTGACGTGTAATGACACCAGCG
CAGCTCTCTTGATTTCACACATTGTGCAATCTGAGATTGGGGATTTTGATGAAGCCTTGG
ACAGAGAGCACTTAGCAAAAAATAAATACATACCTCAGCAAGACGCACTAGAGGACAAAA
TCGTGGAATTTCACCATAACCACATTGGACAAACACCAGCAGAATCAGATTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)293683 - 975
Exon 9 To Exon 12 (Pair 19)
Forward (2978,22)CACACAACTCCAAGAAGAACTCAmplicon SizecDNA: 284 bpgenomic: 17,542
Reverse (3261,22)CAATCTCTAGGAGCTGGAAATCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops1.646 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.364 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceCACACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTT
GGCTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGT
GCAATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAA
ATACATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACAT
TGGACAAACACCAGCAGAATCAGATTTCCAGCTCCTAGAGATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)284708 - 991
Exon 9 To Exon 12 (Pair 20)
Forward (2953,22)TGGTGAAATTCTTTCCGCCTGAAmplicon SizecDNA: 292 bpgenomic: 17,550
Reverse (3244,23)AAATCTGATTCTGCTGGTGTTTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.323 kcal/mol
Forward Dimers-1.026 kcal/mol
Reverse Loops1.474 kcal/mol
Reverse Dimers-2.314 kcal/mol
Forward-Reverse Dimers-1.058 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceTGGTGAAATTCTTTCCGCCTGACCACACACAACTCCAAGAAGAACTCACAAGGTACCTGT
TCGCGCTGCAGGTGAAGCAGGACTTGGCTCAAGGCAGGTTGACGTGTAATGACACCAGCG
CAGCTCTCTTGATTTCACACATTGTGCAATCTGAGATTGGGGATTTTGATGAAGCCTTGG
ACAGAGAGCACTTAGCAAAAAATAAATACATACCTCAGCAAGACGCACTAGAGGACAAAA
TCGTGGAATTTCACCATAACCACATTGGACAAACACCAGCAGAATCAGATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)292683 - 974
Exon 9 To Exon 12 (Pair 21)
Forward (2953,22)TGGTGAAATTCTTTCCGCCTGAAmplicon SizecDNA: 298 bpgenomic: 17,556
Reverse (3250,22)AGCTGGAAATCTGATTCTGCTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.323 kcal/mol
Forward Dimers-1.026 kcal/mol
Reverse Loops1.474 kcal/mol
Reverse Dimers-2.314 kcal/mol
Forward-Reverse Dimers-1.517 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceTGGTGAAATTCTTTCCGCCTGACCACACACAACTCCAAGAAGAACTCACAAGGTACCTGT
TCGCGCTGCAGGTGAAGCAGGACTTGGCTCAAGGCAGGTTGACGTGTAATGACACCAGCG
CAGCTCTCTTGATTTCACACATTGTGCAATCTGAGATTGGGGATTTTGATGAAGCCTTGG
ACAGAGAGCACTTAGCAAAAAATAAATACATACCTCAGCAAGACGCACTAGAGGACAAAA
TCGTGGAATTTCACCATAACCACATTGGACAAACACCAGCAGAATCAGATTTCCAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)298683 - 980
Exon 9 To Exon 12 (Pair 22)
Forward (2980,22)CACAACTCCAAGAAGAACTCACAmplicon SizecDNA: 278 bpgenomic: 17,536
Reverse (3257,22)CTCTAGGAGCTGGAAATCTGATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops1.951 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.364 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceCACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGG
CTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGC
AATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAAT
ACATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACATTG
GACAAACACCAGCAGAATCAGATTTCCAGCTCCTAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)278710 - 987
Exon 9 To Exon 12 (Pair 23)
Forward (2981,23)ACAACTCCAAGAAGAACTCACAAAmplicon SizecDNA: 279 bpgenomic: 17,537
Reverse (3259,22)ATCTCTAGGAGCTGGAAATCTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops1.646 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.364 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGGC
TCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGCA
ATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAATA
CATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACATTGG
ACAAACACCAGCAGAATCAGATTTCCAGCTCCTAGAGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)279711 - 989
Exon 9 To Exon 11 (Pair 12)
Forward (2978,22)CACACAACTCCAAGAAGAACTCAmplicon SizecDNA: 206 bpgenomic: 16,642
Reverse (3183,21)CTAGTGCGTCTTGCTGAGGTANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops0.628 kcal/mol
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-1.53 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceCACACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTT
GGCTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGT
GCAATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAA
ATACATACCTCAGCAAGACGCACTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)206708 - 913
Exon 9 To Exon 11 (Pair 13)
Forward (2978,22)CACACAACTCCAAGAAGAACTCAmplicon SizecDNA: 203 bpgenomic: 16,639
Reverse (3180,21)GTGCGTCTTGCTGAGGTATGTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops0.628 kcal/mol
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-1.53 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceCACACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTT
GGCTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGT
GCAATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAA
ATACATACCTCAGCAAGACGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)203708 - 910
Exon 9 To Exon 11 (Pair 14)
Forward (2980,22)CACAACTCCAAGAAGAACTCACAmplicon SizecDNA: 202 bpgenomic: 16,638
Reverse (3181,21)AGTGCGTCTTGCTGAGGTATGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops0.628 kcal/mol
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-1.53 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceCACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGG
CTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGC
AATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAAT
ACATACCTCAGCAAGACGCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)202710 - 911
Exon 9 To Exon 11 (Pair 15)
Forward (2981,23)ACAACTCCAAGAAGAACTCACAAAmplicon SizecDNA: 168 bpgenomic: 16,604
Reverse (3148,21)GCTAAGTGCTCTCTGTCCAAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops1.184 kcal/mol
Reverse Dimers-1.101 kcal/mol
Forward-Reverse Dimers-2.189 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGGC
TCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGCA
ATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)168711 - 878
Exon 9 To Exon 11 (Pair 16)
Forward (2981,23)ACAACTCCAAGAAGAACTCACAAAmplicon SizecDNA: 199 bpgenomic: 16,635
Reverse (3179,22)TGCGTCTTGCTGAGGTATGTATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops0.628 kcal/mol
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-1.53 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGGC
TCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGCA
ATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAATA
CATACCTCAGCAAGACGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)199711 - 909
Exon 9 To Exon 11 (Pair 17)
Forward (2980,22)CACAACTCCAAGAAGAACTCACAmplicon SizecDNA: 205 bpgenomic: 16,641
Reverse (3184,21)TCTAGTGCGTCTTGCTGAGGTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops0.628 kcal/mol
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-1.53 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceCACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGG
CTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGC
AATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAAT
ACATACCTCAGCAAGACGCACTAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)205710 - 914
Exon 9 To Exon 11 (Pair 18)
Forward (2981,23)ACAACTCCAAGAAGAACTCACAAAmplicon SizecDNA: 196 bpgenomic: 16,632
Reverse (3176,24)GTCTTGCTGAGGTATGTATTTATTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops1.855 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.53 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGGC
TCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGCA
ATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAATA
CATACCTCAGCAAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)196711 - 906
Exon 9 To Exon 11 (Pair 19)
Forward (2981,23)ACAACTCCAAGAAGAACTCACAAAmplicon SizecDNA: 203 bpgenomic: 16,639
Reverse (3183,21)CTAGTGCGTCTTGCTGAGGTANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops0.628 kcal/mol
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-1.53 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGGC
TCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGCA
ATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAATA
CATACCTCAGCAAGACGCACTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)203711 - 913
Exon 9 To Exon 11 (Pair 20)
Forward (2978,22)CACACAACTCCAAGAAGAACTCAmplicon SizecDNA: 207 bpgenomic: 16,643
Reverse (3184,21)TCTAGTGCGTCTTGCTGAGGTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops0.628 kcal/mol
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-1.53 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceCACACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTT
GGCTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGT
GCAATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAA
ATACATACCTCAGCAAGACGCACTAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)207708 - 914
Exon 9 To Exon 12 (Pair 24)
Forward (2953,22)TGGTGAAATTCTTTCCGCCTGAAmplicon SizecDNA: 296 bpgenomic: 17,554
Reverse (3248,22)CTGGAAATCTGATTCTGCTGGTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.323 kcal/mol
Forward Dimers-1.026 kcal/mol
Reverse Loops1.474 kcal/mol
Reverse Dimers-2.314 kcal/mol
Forward-Reverse Dimers-1.517 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceTGGTGAAATTCTTTCCGCCTGACCACACACAACTCCAAGAAGAACTCACAAGGTACCTGT
TCGCGCTGCAGGTGAAGCAGGACTTGGCTCAAGGCAGGTTGACGTGTAATGACACCAGCG
CAGCTCTCTTGATTTCACACATTGTGCAATCTGAGATTGGGGATTTTGATGAAGCCTTGG
ACAGAGAGCACTTAGCAAAAAATAAATACATACCTCAGCAAGACGCACTAGAGGACAAAA
TCGTGGAATTTCACCATAACCACATTGGACAAACACCAGCAGAATCAGATTTCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)296683 - 978
Exon 9 To Exon 11 (Pair 21)
Forward (2981,23)ACAACTCCAAGAAGAACTCACAAAmplicon SizecDNA: 166 bpgenomic: 16,602
Reverse (3146,21)TAAGTGCTCTCTGTCCAAGGCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops1.333 kcal/mol
Reverse Dimers-1.101 kcal/mol
Forward-Reverse Dimers-2.189 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGGC
TCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGCA
ATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)166711 - 876
Exon 9 To Exon 12 (Pair 25)
Forward (2981,23)ACAACTCCAAGAAGAACTCACAAAmplicon SizecDNA: 277 bpgenomic: 17,535
Reverse (3257,22)CTCTAGGAGCTGGAAATCTGATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops1.951 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.364 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGGC
TCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGCA
ATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAATA
CATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACATTGG
ACAAACACCAGCAGAATCAGATTTCCAGCTCCTAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)277711 - 987
Exon 9 To Exon 11 (Pair 22)
Forward (2978,22)CACACAACTCCAAGAAGAACTCAmplicon SizecDNA: 199 bpgenomic: 16,635
Reverse (3176,24)GTCTTGCTGAGGTATGTATTTATTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops1.855 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.53 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceCACACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTT
GGCTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGT
GCAATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAA
ATACATACCTCAGCAAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)199708 - 906
Exon 9 To Exon 11 (Pair 23)
Forward (2981,23)ACAACTCCAAGAAGAACTCACAAAmplicon SizecDNA: 204 bpgenomic: 16,640
Reverse (3184,21)TCTAGTGCGTCTTGCTGAGGTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops0.628 kcal/mol
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-1.53 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGGC
TCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGCA
ATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAATA
CATACCTCAGCAAGACGCACTAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)204711 - 914
Exon 9 To Exon 12 (Pair 26)
Forward (2978,22)CACACAACTCCAAGAAGAACTCAmplicon SizecDNA: 282 bpgenomic: 17,540
Reverse (3259,22)ATCTCTAGGAGCTGGAAATCTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops1.646 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.364 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceCACACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTT
GGCTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGT
GCAATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAA
ATACATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACAT
TGGACAAACACCAGCAGAATCAGATTTCCAGCTCCTAGAGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)282708 - 989
Exon 9 To Exon 11 (Pair 24)
Forward (2981,23)ACAACTCCAAGAAGAACTCACAAAmplicon SizecDNA: 197 bpgenomic: 16,633
Reverse (3177,23)CGTCTTGCTGAGGTATGTATTTANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops1.855 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.53 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGGC
TCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGCA
ATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAATA
CATACCTCAGCAAGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)197711 - 907
Exon 9 To Exon 12 (Pair 27)
Forward (2981,23)ACAACTCCAAGAAGAACTCACAAAmplicon SizecDNA: 266 bpgenomic: 17,524
Reverse (3246,22)GGAAATCTGATTCTGCTGGTGTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops1.474 kcal/mol
Reverse Dimers-2.314 kcal/mol
Forward-Reverse Dimers-1.663 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGGC
TCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGCA
ATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAATA
CATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACATTGG
ACAAACACCAGCAGAATCAGATTTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)266711 - 976
Exon 9 To Exon 12 (Pair 28)
Forward (2978,22)CACACAACTCCAAGAAGAACTCAmplicon SizecDNA: 280 bpgenomic: 17,538
Reverse (3257,22)CTCTAGGAGCTGGAAATCTGATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops1.951 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.364 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceCACACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTT
GGCTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGT
GCAATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAA
ATACATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACAT
TGGACAAACACCAGCAGAATCAGATTTCCAGCTCCTAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)280708 - 987
Exon 9 To Exon 12 (Pair 29)
Forward (2980,22)CACAACTCCAAGAAGAACTCACAmplicon SizecDNA: 260 bpgenomic: 17,518
Reverse (3239,22)TGATTCTGCTGGTGTTTGTCCANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops1.704 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.752 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceCACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGG
CTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGC
AATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAAT
ACATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACATTG
GACAAACACCAGCAGAATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)260710 - 969
Exon 9 To Exon 12 (Pair 30)
Forward (2978,22)CACACAACTCCAAGAAGAACTCAmplicon SizecDNA: 262 bpgenomic: 17,520
Reverse (3239,22)TGATTCTGCTGGTGTTTGTCCANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops1.704 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-2.356 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceCACACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTT
GGCTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGT
GCAATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAA
ATACATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACAT
TGGACAAACACCAGCAGAATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)262708 - 969
Exon 9 To Exon 12 (Pair 31)
Forward (2953,22)TGGTGAAATTCTTTCCGCCTGAAmplicon SizecDNA: 299 bpgenomic: 17,557
Reverse (3251,22)GAGCTGGAAATCTGATTCTGCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.323 kcal/mol
Forward Dimers-1.026 kcal/mol
Reverse Loops1.413 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.517 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceTGGTGAAATTCTTTCCGCCTGACCACACACAACTCCAAGAAGAACTCACAAGGTACCTGT
TCGCGCTGCAGGTGAAGCAGGACTTGGCTCAAGGCAGGTTGACGTGTAATGACACCAGCG
CAGCTCTCTTGATTTCACACATTGTGCAATCTGAGATTGGGGATTTTGATGAAGCCTTGG
ACAGAGAGCACTTAGCAAAAAATAAATACATACCTCAGCAAGACGCACTAGAGGACAAAA
TCGTGGAATTTCACCATAACCACATTGGACAAACACCAGCAGAATCAGATTTCCAGCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)299683 - 981
Exon 9 To Exon 11 (Pair 25)
Forward (2981,23)ACAACTCCAAGAAGAACTCACAAAmplicon SizecDNA: 201 bpgenomic: 16,637
Reverse (3181,21)AGTGCGTCTTGCTGAGGTATGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops0.628 kcal/mol
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-1.53 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGGC
TCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGCA
ATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAATA
CATACCTCAGCAAGACGCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)201711 - 911
Exon 9 To Exon 11 (Pair 26)
Forward (2980,22)CACAACTCCAAGAAGAACTCACAmplicon SizecDNA: 197 bpgenomic: 16,633
Reverse (3176,24)GTCTTGCTGAGGTATGTATTTATTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops1.855 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.53 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceCACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGG
CTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGC
AATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAAT
ACATACCTCAGCAAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)197710 - 906
Exon 9 To Exon 11 (Pair 27)
Forward (2980,22)CACAACTCCAAGAAGAACTCACAmplicon SizecDNA: 199 bpgenomic: 16,635
Reverse (3178,22)GCGTCTTGCTGAGGTATGTATTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops0.899 kcal/mol
Reverse Dimers-0.058 kcal/mol
Forward-Reverse Dimers-1.53 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceCACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGG
CTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGC
AATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAAT
ACATACCTCAGCAAGACGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)199710 - 908
Exon 9 To Exon 12 (Pair 32)
Forward (2978,22)CACACAACTCCAAGAAGAACTCAmplicon SizecDNA: 276 bpgenomic: 17,534
Reverse (3253,22)AGGAGCTGGAAATCTGATTCTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops1.474 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.25 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceCACACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTT
GGCTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGT
GCAATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAA
ATACATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACAT
TGGACAAACACCAGCAGAATCAGATTTCCAGCTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)276708 - 983
Exon 9 To Exon 12 (Pair 33)
Forward (2980,22)CACAACTCCAAGAAGAACTCACAmplicon SizecDNA: 267 bpgenomic: 17,525
Reverse (3246,22)GGAAATCTGATTCTGCTGGTGTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops1.474 kcal/mol
Reverse Dimers-2.314 kcal/mol
Forward-Reverse Dimers-1.663 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceCACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGG
CTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGC
AATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAAT
ACATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACATTG
GACAAACACCAGCAGAATCAGATTTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)267710 - 976
Exon 9 To Exon 11 (Pair 28)
Forward (2978,22)CACACAACTCCAAGAAGAACTCAmplicon SizecDNA: 200 bpgenomic: 16,636
Reverse (3177,23)CGTCTTGCTGAGGTATGTATTTANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops1.855 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.53 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceCACACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTT
GGCTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGT
GCAATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAA
ATACATACCTCAGCAAGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)200708 - 907
Exon 9 To Exon 12 (Pair 34)
Forward (2953,22)TGGTGAAATTCTTTCCGCCTGAAmplicon SizecDNA: 289 bpgenomic: 17,547
Reverse (3241,22)TCTGATTCTGCTGGTGTTTGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.323 kcal/mol
Forward Dimers-1.026 kcal/mol
Reverse Loops1.704 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.058 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceTGGTGAAATTCTTTCCGCCTGACCACACACAACTCCAAGAAGAACTCACAAGGTACCTGT
TCGCGCTGCAGGTGAAGCAGGACTTGGCTCAAGGCAGGTTGACGTGTAATGACACCAGCG
CAGCTCTCTTGATTTCACACATTGTGCAATCTGAGATTGGGGATTTTGATGAAGCCTTGG
ACAGAGAGCACTTAGCAAAAAATAAATACATACCTCAGCAAGACGCACTAGAGGACAAAA
TCGTGGAATTTCACCATAACCACATTGGACAAACACCAGCAGAATCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)289683 - 971
Exon 9 To Exon 12 (Pair 35)
Forward (2981,23)ACAACTCCAAGAAGAACTCACAAAmplicon SizecDNA: 273 bpgenomic: 17,531
Reverse (3253,22)AGGAGCTGGAAATCTGATTCTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops1.474 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.25 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGGC
TCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGCA
ATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAATA
CATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACATTGG
ACAAACACCAGCAGAATCAGATTTCCAGCTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)273711 - 983
Exon 9 To Exon 11 (Pair 29)
Forward (2978,22)CACACAACTCCAAGAAGAACTCAmplicon SizecDNA: 201 bpgenomic: 16,637
Reverse (3178,22)GCGTCTTGCTGAGGTATGTATTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops0.899 kcal/mol
Reverse Dimers-0.058 kcal/mol
Forward-Reverse Dimers-1.53 kcal/mol
Amplicon Folding-2.33 kcal/mol outside primersite
Amplicon SequenceCACACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTT
GGCTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGT
GCAATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAA
ATACATACCTCAGCAAGACGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)201708 - 908
Exon 9 To Exon 12 (Pair 36)
Forward (2981,23)ACAACTCCAAGAAGAACTCACAAAmplicon SizecDNA: 275 bpgenomic: 17,533
Reverse (3255,22)CTAGGAGCTGGAAATCTGATTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops1.474 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.25 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTTGGC
TCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGTGCA
ATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAAATA
CATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACATTGG
ACAAACACCAGCAGAATCAGATTTCCAGCTCCTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)275711 - 985
Exon 9 To Exon 12 (Pair 37)
Forward (2978,22)CACACAACTCCAAGAAGAACTCAmplicon SizecDNA: 264 bpgenomic: 17,522
Reverse (3241,22)TCTGATTCTGCTGGTGTTTGTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.003 kcal/mol in 3' area
Forward Dimers-0.717 kcal/mol
Reverse Loops1.704 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-2.356 kcal/mol
Amplicon Folding-2.449 kcal/mol outside primersite
Amplicon SequenceCACACAACTCCAAGAAGAACTCACAAGGTACCTGTTCGCGCTGCAGGTGAAGCAGGACTT
GGCTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTTCACACATTGT
GCAATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAGCAAAAAATAA
ATACATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACCATAACCACAT
TGGACAAACACCAGCAGAATCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)264708 - 971
Exon 10 To Exon 12 (Pair 1)
Forward (3028,20)AGCAGGACTTGGCTCAAGGCAmplicon SizecDNA: 232 bpgenomic: 7,865
Reverse (3259,22)ATCTCTAGGAGCTGGAAATCTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.867 kcal/mol
Forward Dimers-1.171 kcal/mol
Reverse Loops1.646 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.216 kcal/mol
Amplicon Folding-1.841 kcal/mol outside primersite
Amplicon SequenceAGCAGGACTTGGCTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTT
CACACATTGTGCAATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAG
CAAAAAATAAATACATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGAATTTCACC
ATAACCACATTGGACAAACACCAGCAGAATCAGATTTCCAGCTCCTAGAGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)232758 - 989
Exon 10 To Exon 11 (Pair 1)
Forward (3028,20)AGCAGGACTTGGCTCAAGGCAmplicon SizecDNA: 150 bpgenomic: 6,961
Reverse (3177,23)CGTCTTGCTGAGGTATGTATTTANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.867 kcal/mol
Forward Dimers-1.171 kcal/mol
Reverse Loops1.855 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.876 kcal/mol
Amplicon Folding-1.722 kcal/mol outside primersite
Amplicon SequenceAGCAGGACTTGGCTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTT
CACACATTGTGCAATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAG
CAAAAAATAAATACATACCTCAGCAAGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)150758 - 907
Exon 10 To Exon 11 (Pair 2)
Forward (3028,20)AGCAGGACTTGGCTCAAGGCAmplicon SizecDNA: 154 bpgenomic: 6,965
Reverse (3181,21)AGTGCGTCTTGCTGAGGTATGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.867 kcal/mol
Forward Dimers-1.171 kcal/mol
Reverse Loops0.628 kcal/mol
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-2.876 kcal/mol
Amplicon Folding-1.722 kcal/mol outside primersite
Amplicon SequenceAGCAGGACTTGGCTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTT
CACACATTGTGCAATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAG
CAAAAAATAAATACATACCTCAGCAAGACGCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)154758 - 911
Exon 10 To Exon 11 (Pair 3)
Forward (3028,20)AGCAGGACTTGGCTCAAGGCAmplicon SizecDNA: 156 bpgenomic: 6,967
Reverse (3183,21)CTAGTGCGTCTTGCTGAGGTANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.867 kcal/mol
Forward Dimers-1.171 kcal/mol
Reverse Loops0.628 kcal/mol
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-2.876 kcal/mol
Amplicon Folding-1.722 kcal/mol outside primersite
Amplicon SequenceAGCAGGACTTGGCTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCTCTTGATTT
CACACATTGTGCAATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGAGCACTTAG
CAAAAAATAAATACATACCTCAGCAAGACGCACTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)156758 - 913
Exon 10 To Exon 12 (Pair 2)
Forward (3020,20)GCAGGTGAAGCAGGACTTGGAmplicon SizecDNA: 234 bpgenomic: 7,867
Reverse (3253,22)AGGAGCTGGAAATCTGATTCTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.41 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.474 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding-1.841 kcal/mol outside primersite
Amplicon SequenceGCAGGTGAAGCAGGACTTGGCTCAAGGCAGGTTGACGTGTAATGACACCAGCGCAGCTCT
CTTGATTTCACACATTGTGCAATCTGAGATTGGGGATTTTGATGAAGCCTTGGACAGAGA
GCACTTAGCAAAAAATAAATACATACCTCAGCAAGACGCACTAGAGGACAAAATCGTGGA
ATTTCACCATAACCACATTGGACAAACACCAGCAGAATCAGATTTCCAGCTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005766 (FARP1)234750 - 983
 

See below for some more details.

Program Output:

Loading ...