Design Results for FYN

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 3 To Exon 5 (Pair 1)
Forward (539,22)TAAAGTTTGTGATCGTTGGCGGAmplicon SizecDNA: 151 bpgenomic: 60,562
Reverse (689,22)ACATTGCACACAGCCCATTATCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.158 kcal/mol in 3' area
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGCCAAGG
AGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACGTGAA
GGGAATTTAGATAATGGGCTGTGTGCAATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 2)
Forward (531,24)GGTGTATATAAAGTTTGTGATCGTAmplicon SizecDNA: 163 bpgenomic: 60,574
Reverse (693,21)CCTTACATTGCACACAGCCCANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.293 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGGTGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATA
AGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCT
TACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002037 (FYN)71559 - 629
Exon 3 To Exon 5 (Pair 3)
Forward (535,24)TATATAAAGTTTGTGATCGTTGGCAmplicon SizecDNA: 153 bpgenomic: 60,564
Reverse (687,23)ATTGCACACAGCCCATTATCTAANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGCC
AAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACG
TGAAGGGAATTTAGATAATGGGCTGTGTGCAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 4)
Forward (534,24)GTATATAAAGTTTGTGATCGTTGGAmplicon SizecDNA: 152 bpgenomic: 60,563
Reverse (685,23)TGCACACAGCCCATTATCTAAATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.124 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGC
CAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTAC
GTGAAGGGAATTTAGATAATGGGCTGTGTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 5)
Forward (539,22)TAAAGTTTGTGATCGTTGGCGGAmplicon SizecDNA: 150 bpgenomic: 60,561
Reverse (688,22)CATTGCACACAGCCCATTATCTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.158 kcal/mol in 3' area
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGCCAAGG
AGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACGTGAA
GGGAATTTAGATAATGGGCTGTGTGCAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 6)
Forward (534,24)GTATATAAAGTTTGTGATCGTTGGAmplicon SizecDNA: 160 bpgenomic: 60,571
Reverse (693,21)CCTTACATTGCACACAGCCCANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGC
CAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTAC
GTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002037 (FYN)68562 - 629
Exon 3 To Exon 5 (Pair 7)
Forward (534,24)GTATATAAAGTTTGTGATCGTTGGAmplicon SizecDNA: 155 bpgenomic: 60,566
Reverse (688,22)CATTGCACACAGCCCATTATCTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGC
CAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTAC
GTGAAGGGAATTTAGATAATGGGCTGTGTGCAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 8)
Forward (539,22)TAAAGTTTGTGATCGTTGGCGGAmplicon SizecDNA: 148 bpgenomic: 60,559
Reverse (686,23)TTGCACACAGCCCATTATCTAAANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.158 kcal/mol in 3' area
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGCCAAGG
AGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACGTGAA
GGGAATTTAGATAATGGGCTGTGTGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 10)
Forward (530,24)TGGTGTATATAAAGTTTGTGATCGAmplicon SizecDNA: 163 bpgenomic: 60,574
Reverse (692,22)CTTACATTGCACACAGCCCATTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.293 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTGGTGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTAT
AAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGC
TTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002037 (FYN)71558 - 628
Exon 3 To Exon 5 (Pair 11)
Forward (537,23)TATAAAGTTTGTGATCGTTGGCGAmplicon SizecDNA: 152 bpgenomic: 60,563
Reverse (688,22)CATTGCACACAGCCCATTATCTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.32 kcal/mol in 3' area
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGCCAA
GGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACGTG
AAGGGAATTTAGATAATGGGCTGTGTGCAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 12)
Forward (535,24)TATATAAAGTTTGTGATCGTTGGCAmplicon SizecDNA: 151 bpgenomic: 60,562
Reverse (685,23)TGCACACAGCCCATTATCTAAATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.124 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGCC
AAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACG
TGAAGGGAATTTAGATAATGGGCTGTGTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 14)
Forward (531,24)GGTGTATATAAAGTTTGTGATCGTAmplicon SizecDNA: 158 bpgenomic: 60,569
Reverse (688,22)CATTGCACACAGCCCATTATCTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.293 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGGTGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATA
AGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCT
TACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002037 (FYN)66559 - 624
Exon 3 To Exon 5 (Pair 15)
Forward (539,22)TAAAGTTTGTGATCGTTGGCGGAmplicon SizecDNA: 147 bpgenomic: 60,558
Reverse (685,23)TGCACACAGCCCATTATCTAAATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.158 kcal/mol in 3' area
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.124 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGCCAAGG
AGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACGTGAA
GGGAATTTAGATAATGGGCTGTGTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 16)
Forward (531,24)GGTGTATATAAAGTTTGTGATCGTAmplicon SizecDNA: 159 bpgenomic: 60,570
Reverse (689,22)ACATTGCACACAGCCCATTATCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.293 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGGTGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATA
AGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCT
TACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002037 (FYN)67559 - 625
Exon 3 To Exon 5 (Pair 17)
Forward (539,22)TAAAGTTTGTGATCGTTGGCGGAmplicon SizecDNA: 154 bpgenomic: 60,565
Reverse (692,22)CTTACATTGCACACAGCCCATTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.158 kcal/mol in 3' area
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGCCAAGG
AGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACGTGAA
GGGAATTTAGATAATGGGCTGTGTGCAATGTAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 18)
Forward (537,23)TATAAAGTTTGTGATCGTTGGCGAmplicon SizecDNA: 149 bpgenomic: 60,560
Reverse (685,23)TGCACACAGCCCATTATCTAAATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.32 kcal/mol in 3' area
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.124 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGCCAA
GGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACGTG
AAGGGAATTTAGATAATGGGCTGTGTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 19)
Forward (535,24)TATATAAAGTTTGTGATCGTTGGCAmplicon SizecDNA: 152 bpgenomic: 60,563
Reverse (686,23)TTGCACACAGCCCATTATCTAAANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGCC
AAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACG
TGAAGGGAATTTAGATAATGGGCTGTGTGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 20)
Forward (535,24)TATATAAAGTTTGTGATCGTTGGCAmplicon SizecDNA: 159 bpgenomic: 60,570
Reverse (693,21)CCTTACATTGCACACAGCCCANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGCC
AAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACG
TGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002037 (FYN)67563 - 629
Exon 3 To Exon 5 (Pair 21)
Forward (529,24)GTGGTGTATATAAAGTTTGTGATCAmplicon SizecDNA: 165 bpgenomic: 60,576
Reverse (693,21)CCTTACATTGCACACAGCCCANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.293 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGTGGTGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTA
TAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGG
CTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002037 (FYN)73557 - 629
Exon 3 To Exon 5 (Pair 22)
Forward (531,24)GGTGTATATAAAGTTTGTGATCGTAmplicon SizecDNA: 164 bpgenomic: 60,575
Reverse (694,21)TCCTTACATTGCACACAGCCCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.293 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGGTGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATA
AGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCT
TACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002037 (FYN)72559 - 630
Exon 3 To Exon 5 (Pair 23)
Forward (529,24)GTGGTGTATATAAAGTTTGTGATCAmplicon SizecDNA: 161 bpgenomic: 60,572
Reverse (689,22)ACATTGCACACAGCCCATTATCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.293 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGTGGTGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTA
TAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGG
CTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002037 (FYN)69557 - 625
Exon 3 To Exon 5 (Pair 24)
Forward (529,24)GTGGTGTATATAAAGTTTGTGATCAmplicon SizecDNA: 166 bpgenomic: 60,577
Reverse (694,21)TCCTTACATTGCACACAGCCCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.293 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGTGGTGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTA
TAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGG
CTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002037 (FYN)74557 - 630
Exon 3 To Exon 5 (Pair 25)
Forward (537,23)TATAAAGTTTGTGATCGTTGGCGAmplicon SizecDNA: 157 bpgenomic: 60,568
Reverse (693,21)CCTTACATTGCACACAGCCCANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.32 kcal/mol in 3' area
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGCCAA
GGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACGTG
AAGGGAATTTAGATAATGGGCTGTGTGCAATGTAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002037 (FYN)65565 - 629
Exon 3 To Exon 4 (Pair 5)
Forward (539,22)TAAAGTTTGTGATCGTTGGCGGAmplicon SizecDNA: 120 bpgenomic: 21,554
Reverse (658,21)TTCACGTAAGCCTCCCTTCTCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.158 kcal/mol in 3' area
Forward Dimers-0.404 kcal/mol
Reverse Loops1.04 kcal/mol in 3' area
Reverse Dimers-2.764 kcal/mol
Forward-Reverse Dimers-1.713 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGCCAAGG
AGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACGTGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 26)
Forward (535,24)TATATAAAGTTTGTGATCGTTGGCAmplicon SizecDNA: 155 bpgenomic: 60,566
Reverse (689,22)ACATTGCACACAGCCCATTATCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGCC
AAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACG
TGAAGGGAATTTAGATAATGGGCTGTGTGCAATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 27)
Forward (529,24)GTGGTGTATATAAAGTTTGTGATCAmplicon SizecDNA: 164 bpgenomic: 60,575
Reverse (692,22)CTTACATTGCACACAGCCCATTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.293 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGTGGTGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTA
TAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGG
CTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002037 (FYN)72557 - 628
Exon 3 To Exon 5 (Pair 28)
Forward (531,24)GGTGTATATAAAGTTTGTGATCGTAmplicon SizecDNA: 155 bpgenomic: 60,566
Reverse (685,23)TGCACACAGCCCATTATCTAAATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.124 kcal/mol
Forward-Reverse Dimers-2.293 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGGTGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATA
AGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCT
TACGTGAAGGGAATTTAGATAATGGGCTGTGTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 29)
Forward (535,24)TATATAAAGTTTGTGATCGTTGGCAmplicon SizecDNA: 154 bpgenomic: 60,565
Reverse (688,22)CATTGCACACAGCCCATTATCTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGCC
AAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACG
TGAAGGGAATTTAGATAATGGGCTGTGTGCAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 30)
Forward (531,24)GGTGTATATAAAGTTTGTGATCGTAmplicon SizecDNA: 162 bpgenomic: 60,573
Reverse (692,22)CTTACATTGCACACAGCCCATTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.293 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGGTGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATA
AGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCT
TACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002037 (FYN)70559 - 628
Exon 3 To Exon 5 (Pair 31)
Forward (530,24)TGGTGTATATAAAGTTTGTGATCGAmplicon SizecDNA: 157 bpgenomic: 60,568
Reverse (686,23)TTGCACACAGCCCATTATCTAAANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.293 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTGGTGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTAT
AAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGC
TTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 32)
Forward (530,24)TGGTGTATATAAAGTTTGTGATCGAmplicon SizecDNA: 165 bpgenomic: 60,576
Reverse (694,21)TCCTTACATTGCACACAGCCCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.293 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTGGTGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTAT
AAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGC
TTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002037 (FYN)73558 - 630
Exon 3 To Exon 4 (Pair 15)
Forward (500,21)ACCAGTCCTGCCTCTGTTGTAAmplicon SizecDNA: 97 bpgenomic: 21,531
Reverse (596,23)TTGGCTTATACCCAACACTTGATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.825 kcal/mol
Forward Dimers0.136 kcal/mol
Reverse Loops1.043 kcal/mol in 3' area
Reverse Dimers-0.676 kcal/mol
Forward-Reverse Dimers-1.729 kcal/mol
Amplicon Folding0.22 kcal/mol outside primersite
Amplicon SequenceACCAGTCCTGCCTCTGTTGTAGAAGACATGTGGTGTATATAAAGTTTGTGATCGTTGGCG
GACATTTTGAAATGATCAAGTGTTGGGTATAAGCCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 33)
Forward (537,23)TATAAAGTTTGTGATCGTTGGCGAmplicon SizecDNA: 150 bpgenomic: 60,561
Reverse (686,23)TTGCACACAGCCCATTATCTAAANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.32 kcal/mol in 3' area
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGCCAA
GGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACGTG
AAGGGAATTTAGATAATGGGCTGTGTGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 34)
Forward (530,24)TGGTGTATATAAAGTTTGTGATCGAmplicon SizecDNA: 159 bpgenomic: 60,570
Reverse (688,22)CATTGCACACAGCCCATTATCTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.293 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTGGTGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTAT
AAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGC
TTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002037 (FYN)67558 - 624
Exon 3 To Exon 5 (Pair 35)
Forward (530,24)TGGTGTATATAAAGTTTGTGATCGAmplicon SizecDNA: 162 bpgenomic: 60,573
Reverse (691,23)TTACATTGCACACAGCCCATTATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.293 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTGGTGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTAT
AAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGC
TTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002037 (FYN)70558 - 627
Exon 3 To Exon 5 (Pair 36)
Forward (537,23)TATAAAGTTTGTGATCGTTGGCGAmplicon SizecDNA: 153 bpgenomic: 60,564
Reverse (689,22)ACATTGCACACAGCCCATTATCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.32 kcal/mol in 3' area
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGCCAA
GGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACGTG
AAGGGAATTTAGATAATGGGCTGTGTGCAATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 37)
Forward (539,22)TAAAGTTTGTGATCGTTGGCGGAmplicon SizecDNA: 155 bpgenomic: 60,566
Reverse (693,21)CCTTACATTGCACACAGCCCANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.158 kcal/mol in 3' area
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGCCAAGG
AGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACGTGAA
GGGAATTTAGATAATGGGCTGTGTGCAATGTAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002037 (FYN)63567 - 629
Exon 3 To Exon 5 (Pair 38)
Forward (539,22)TAAAGTTTGTGATCGTTGGCGGAmplicon SizecDNA: 149 bpgenomic: 60,560
Reverse (687,23)ATTGCACACAGCCCATTATCTAANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.158 kcal/mol in 3' area
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGCCAAGG
AGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACGTGAA
GGGAATTTAGATAATGGGCTGTGTGCAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 39)
Forward (530,24)TGGTGTATATAAAGTTTGTGATCGAmplicon SizecDNA: 158 bpgenomic: 60,569
Reverse (687,23)ATTGCACACAGCCCATTATCTAANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.293 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTGGTGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTAT
AAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGC
TTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 40)
Forward (537,23)TATAAAGTTTGTGATCGTTGGCGAmplicon SizecDNA: 155 bpgenomic: 60,566
Reverse (691,23)TTACATTGCACACAGCCCATTATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.32 kcal/mol in 3' area
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGCCAA
GGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACGTG
AAGGGAATTTAGATAATGGGCTGTGTGCAATGTAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 41)
Forward (539,22)TAAAGTTTGTGATCGTTGGCGGAmplicon SizecDNA: 153 bpgenomic: 60,564
Reverse (691,23)TTACATTGCACACAGCCCATTATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.158 kcal/mol in 3' area
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGCCAAGG
AGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACGTGAA
GGGAATTTAGATAATGGGCTGTGTGCAATGTAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 43)
Forward (535,24)TATATAAAGTTTGTGATCGTTGGCAmplicon SizecDNA: 158 bpgenomic: 60,569
Reverse (692,22)CTTACATTGCACACAGCCCATTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGCC
AAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACG
TGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002037 (FYN)66563 - 628
Exon 3 To Exon 5 (Pair 44)
Forward (534,24)GTATATAAAGTTTGTGATCGTTGGAmplicon SizecDNA: 156 bpgenomic: 60,567
Reverse (689,22)ACATTGCACACAGCCCATTATCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGC
CAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTAC
GTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 45)
Forward (537,23)TATAAAGTTTGTGATCGTTGGCGAmplicon SizecDNA: 156 bpgenomic: 60,567
Reverse (692,22)CTTACATTGCACACAGCCCATTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.32 kcal/mol in 3' area
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGCCAA
GGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACGTG
AAGGGAATTTAGATAATGGGCTGTGTGCAATGTAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 46)
Forward (530,24)TGGTGTATATAAAGTTTGTGATCGAmplicon SizecDNA: 156 bpgenomic: 60,567
Reverse (685,23)TGCACACAGCCCATTATCTAAATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.124 kcal/mol
Forward-Reverse Dimers-2.293 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTGGTGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTAT
AAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGC
TTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 47)
Forward (537,23)TATAAAGTTTGTGATCGTTGGCGAmplicon SizecDNA: 151 bpgenomic: 60,562
Reverse (687,23)ATTGCACACAGCCCATTATCTAANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.32 kcal/mol in 3' area
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGCCAA
GGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACGTG
AAGGGAATTTAGATAATGGGCTGTGTGCAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 21)
Forward (499,20)GACCAGTCCTGCCTCTGTTGAmplicon SizecDNA: 98 bpgenomic: 21,532
Reverse (596,23)TTGGCTTATACCCAACACTTGATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.825 kcal/mol
Forward Dimers0.042 kcal/mol
Reverse Loops1.043 kcal/mol in 3' area
Reverse Dimers-0.676 kcal/mol
Forward-Reverse Dimers-1.729 kcal/mol
Amplicon Folding0.22 kcal/mol outside primersite
Amplicon SequenceGACCAGTCCTGCCTCTGTTGTAGAAGACATGTGGTGTATATAAAGTTTGTGATCGTTGGC
GGACATTTTGAAATGATCAAGTGTTGGGTATAAGCCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 22)
Forward (539,22)TAAAGTTTGTGATCGTTGGCGGAmplicon SizecDNA: 121 bpgenomic: 21,555
Reverse (659,21)CTTCACGTAAGCCTCCCTTCTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.158 kcal/mol in 3' area
Forward Dimers-0.404 kcal/mol
Reverse Loops1.04 kcal/mol in 3' area
Reverse Dimers-2.764 kcal/mol
Forward-Reverse Dimers-1.713 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGCCAAGG
AGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACGTGAA
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 48)
Forward (529,24)GTGGTGTATATAAAGTTTGTGATCAmplicon SizecDNA: 160 bpgenomic: 60,571
Reverse (688,22)CATTGCACACAGCCCATTATCTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.293 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGTGGTGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTA
TAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGG
CTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002037 (FYN)68557 - 624
Exon 3 To Exon 5 (Pair 49)
Forward (529,24)GTGGTGTATATAAAGTTTGTGATCAmplicon SizecDNA: 163 bpgenomic: 60,574
Reverse (691,23)TTACATTGCACACAGCCCATTATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.293 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGTGGTGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTA
TAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGG
CTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002037 (FYN)71557 - 627
Exon 3 To Exon 5 (Pair 50)
Forward (531,24)GGTGTATATAAAGTTTGTGATCGTAmplicon SizecDNA: 157 bpgenomic: 60,568
Reverse (687,23)ATTGCACACAGCCCATTATCTAANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.293 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGGTGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATA
AGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCT
TACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 51)
Forward (531,24)GGTGTATATAAAGTTTGTGATCGTAmplicon SizecDNA: 161 bpgenomic: 60,572
Reverse (691,23)TTACATTGCACACAGCCCATTATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.293 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGGTGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATA
AGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCT
TACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002037 (FYN)69559 - 627
Exon 3 To Exon 5 (Pair 52)
Forward (534,24)GTATATAAAGTTTGTGATCGTTGGAmplicon SizecDNA: 159 bpgenomic: 60,570
Reverse (692,22)CTTACATTGCACACAGCCCATTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGC
CAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTAC
GTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002037 (FYN)67562 - 628
Exon 3 To Exon 5 (Pair 53)
Forward (530,24)TGGTGTATATAAAGTTTGTGATCGAmplicon SizecDNA: 164 bpgenomic: 60,575
Reverse (693,21)CCTTACATTGCACACAGCCCANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.293 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTGGTGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTAT
AAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGC
TTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002037 (FYN)72558 - 629
Exon 3 To Exon 5 (Pair 54)
Forward (534,24)GTATATAAAGTTTGTGATCGTTGGAmplicon SizecDNA: 154 bpgenomic: 60,565
Reverse (687,23)ATTGCACACAGCCCATTATCTAANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGC
CAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTAC
GTGAAGGGAATTTAGATAATGGGCTGTGTGCAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 55)
Forward (535,24)TATATAAAGTTTGTGATCGTTGGCAmplicon SizecDNA: 157 bpgenomic: 60,568
Reverse (691,23)TTACATTGCACACAGCCCATTATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGCC
AAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTACG
TGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 56)
Forward (531,24)GGTGTATATAAAGTTTGTGATCGTAmplicon SizecDNA: 156 bpgenomic: 60,567
Reverse (686,23)TTGCACACAGCCCATTATCTAAANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.293 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGGTGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATA
AGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCT
TACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 57)
Forward (534,24)GTATATAAAGTTTGTGATCGTTGGAmplicon SizecDNA: 158 bpgenomic: 60,569
Reverse (691,23)TTACATTGCACACAGCCCATTATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGC
CAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTAC
GTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 5 (Pair 58)
Forward (530,24)TGGTGTATATAAAGTTTGTGATCGAmplicon SizecDNA: 160 bpgenomic: 60,571
Reverse (689,22)ACATTGCACACAGCCCATTATCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.293 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTGGTGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTAT
AAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGC
TTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002037 (FYN)68558 - 625
Exon 3 To Exon 5 (Pair 59)
Forward (534,24)GTATATAAAGTTTGTGATCGTTGGAmplicon SizecDNA: 153 bpgenomic: 60,564
Reverse (686,23)TTGCACACAGCCCATTATCTAAANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.214 kcal/mol
Forward Dimers-0.404 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.092 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGTATATAAAGTTTGTGATCGTTGGCGGACATTTTGAAATGATCAAGTGTTGGGTATAAGC
CAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCTTAC
GTGAAGGGAATTTAGATAATGGGCTGTGTGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 4 To Exon 5 (Pair 1)
Forward (587,22)TATAAGCCAAGGAGCTGAGAGAAmplicon SizecDNA: 106 bpgenomic: 39,083
Reverse (692,22)CTTACATTGCACACAGCCCATTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.179 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.983 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTATAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGA
GGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)10619 - 124
Exon 4 To Exon 5 (Pair 2)
Forward (573,22)GATCAAGTGTTGGGTATAAGCCAmplicon SizecDNA: 120 bpgenomic: 39,097
Reverse (692,22)CTTACATTGCACACAGCCCATTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.327 kcal/mol in 3' area
Forward Dimers-0.18 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.392 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGATCAAGTGTTGGGTATAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAG
GAGCTGAGAAGGGAGGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)1205 - 124
Exon 4 To Exon 5 (Pair 3)
Forward (581,21)GTTGGGTATAAGCCAAGGAGCAmplicon SizecDNA: 109 bpgenomic: 39,086
Reverse (689,22)ACATTGCACACAGCCCATTATCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.905 kcal/mol
Forward Dimers-0.764 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.284 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGTTGGGTATAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAG
AAGGGAGGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)10913 - 121
Exon 4 To Exon 5 (Pair 4)
Forward (573,22)GATCAAGTGTTGGGTATAAGCCAmplicon SizecDNA: 116 bpgenomic: 39,093
Reverse (688,22)CATTGCACACAGCCCATTATCTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.327 kcal/mol in 3' area
Forward Dimers-0.18 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.392 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGATCAAGTGTTGGGTATAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAG
GAGCTGAGAAGGGAGGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)1165 - 120
Exon 4 To Exon 5 (Pair 5)
Forward (587,22)TATAAGCCAAGGAGCTGAGAGAAmplicon SizecDNA: 100 bpgenomic: 39,077
Reverse (686,23)TTGCACACAGCCCATTATCTAAANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.179 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.983 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTATAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGA
GGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)10019 - 118
Exon 4 To Exon 5 (Pair 6)
Forward (571,23)ATGATCAAGTGTTGGGTATAAGCAmplicon SizecDNA: 123 bpgenomic: 39,100
Reverse (693,21)CCTTACATTGCACACAGCCCANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.583 kcal/mol
Forward Dimers-2.036 kcal/mol
Reverse Loops0.653 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.392 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceATGATCAAGTGTTGGGTATAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTG
AGGAGCTGAGAAGGGAGGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTA
AGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)1233 - 125
Exon 4 To Exon 5 (Pair 7)
Forward (571,23)ATGATCAAGTGTTGGGTATAAGCAmplicon SizecDNA: 122 bpgenomic: 39,099
Reverse (692,22)CTTACATTGCACACAGCCCATTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.583 kcal/mol
Forward Dimers-2.036 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.392 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceATGATCAAGTGTTGGGTATAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTG
AGGAGCTGAGAAGGGAGGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTA
AG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)1223 - 124
Exon 4 To Exon 5 (Pair 8)
Forward (573,22)GATCAAGTGTTGGGTATAAGCCAmplicon SizecDNA: 122 bpgenomic: 39,099
Reverse (694,21)TCCTTACATTGCACACAGCCCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.327 kcal/mol in 3' area
Forward Dimers-0.18 kcal/mol
Reverse Loops0.653 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.392 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGATCAAGTGTTGGGTATAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAG
GAGCTGAGAAGGGAGGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAAG
GA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)1225 - 126
Exon 4 To Exon 5 (Pair 9)
Forward (589,21)TAAGCCAAGGAGCTGAGAGAGAmplicon SizecDNA: 103 bpgenomic: 39,080
Reverse (691,23)TTACATTGCACACAGCCCATTATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.179 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.983 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGG
CTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)10321 - 123
Exon 4 To Exon 5 (Pair 10)
Forward (591,20)AGCCAAGGAGCTGAGAGAGGAmplicon SizecDNA: 95 bpgenomic: 39,072
Reverse (685,23)TGCACACAGCCCATTATCTAAATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.72 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.124 kcal/mol
Forward-Reverse Dimers-2.983 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCT
TACGTGAAGGGAATTTAGATAATGGGCTGTGTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)9523 - 117
Exon 4 To Exon 5 (Pair 11)
Forward (587,22)TATAAGCCAAGGAGCTGAGAGAAmplicon SizecDNA: 113 bpgenomic: 39,090
Reverse (699,23)CTTTATCCTTACATTGCACACAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.179 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.829 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.628 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTATAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGA
GGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAAGGATAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)11319 - 131
Exon 4 To Exon 5 (Pair 12)
Forward (628,20)CTGAGGAGCTGAGAAGGGAGAmplicon SizecDNA: 72 bpgenomic: 39,049
Reverse (699,23)CTTTATCCTTACATTGCACACAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.866 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.829 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.335 kcal/mol
Amplicon Folding0.422 kcal/mol inside primersite
Amplicon SequenceCTGAGGAGCTGAGAAGGGAGGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAAT
GTAAGGATAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)7260 - 131
Exon 4 To Exon 5 (Pair 13)
Forward (591,20)AGCCAAGGAGCTGAGAGAGGAmplicon SizecDNA: 97 bpgenomic: 39,074
Reverse (687,23)ATTGCACACAGCCCATTATCTAANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.72 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.983 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCT
TACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)9723 - 119
Exon 4 To Exon 5 (Pair 14)
Forward (589,21)TAAGCCAAGGAGCTGAGAGAGAmplicon SizecDNA: 111 bpgenomic: 39,088
Reverse (699,23)CTTTATCCTTACATTGCACACAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.179 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.829 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.628 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGG
CTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAAGGATAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)11121 - 131
Exon 4 To Exon 5 (Pair 15)
Forward (571,23)ATGATCAAGTGTTGGGTATAAGCAmplicon SizecDNA: 124 bpgenomic: 39,101
Reverse (694,21)TCCTTACATTGCACACAGCCCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.583 kcal/mol
Forward Dimers-2.036 kcal/mol
Reverse Loops0.653 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.392 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceATGATCAAGTGTTGGGTATAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTG
AGGAGCTGAGAAGGGAGGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTA
AGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)1243 - 126
Exon 4 To Exon 5 (Pair 16)
Forward (587,22)TATAAGCCAAGGAGCTGAGAGAAmplicon SizecDNA: 99 bpgenomic: 39,076
Reverse (685,23)TGCACACAGCCCATTATCTAAATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.179 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.124 kcal/mol
Forward-Reverse Dimers-2.983 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTATAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGA
GGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)9919 - 117
Exon 4 To Exon 5 (Pair 17)
Forward (573,22)GATCAAGTGTTGGGTATAAGCCAmplicon SizecDNA: 121 bpgenomic: 39,098
Reverse (693,21)CCTTACATTGCACACAGCCCANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.327 kcal/mol in 3' area
Forward Dimers-0.18 kcal/mol
Reverse Loops0.653 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.392 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGATCAAGTGTTGGGTATAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAG
GAGCTGAGAAGGGAGGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAAG
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)1215 - 125
Exon 4 To Exon 5 (Pair 18)
Forward (591,20)AGCCAAGGAGCTGAGAGAGGAmplicon SizecDNA: 109 bpgenomic: 39,086
Reverse (699,23)CTTTATCCTTACATTGCACACAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.72 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.829 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.628 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCT
TACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAAGGATAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)10923 - 131
Exon 4 To Exon 5 (Pair 19)
Forward (573,22)GATCAAGTGTTGGGTATAAGCCAmplicon SizecDNA: 117 bpgenomic: 39,094
Reverse (689,22)ACATTGCACACAGCCCATTATCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.327 kcal/mol in 3' area
Forward Dimers-0.18 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.392 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGATCAAGTGTTGGGTATAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAG
GAGCTGAGAAGGGAGGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)1175 - 121
Exon 4 To Exon 5 (Pair 20)
Forward (581,21)GTTGGGTATAAGCCAAGGAGCAmplicon SizecDNA: 108 bpgenomic: 39,085
Reverse (688,22)CATTGCACACAGCCCATTATCTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.905 kcal/mol
Forward Dimers-0.764 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.284 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGTTGGGTATAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAG
AAGGGAGGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)10813 - 120
Exon 4 To Exon 5 (Pair 21)
Forward (589,21)TAAGCCAAGGAGCTGAGAGAGAmplicon SizecDNA: 100 bpgenomic: 39,077
Reverse (688,22)CATTGCACACAGCCCATTATCTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.179 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.983 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGG
CTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)10021 - 120
Exon 4 To Exon 5 (Pair 22)
Forward (591,20)AGCCAAGGAGCTGAGAGAGGAmplicon SizecDNA: 102 bpgenomic: 39,079
Reverse (692,22)CTTACATTGCACACAGCCCATTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.72 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.983 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCT
TACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)10223 - 124
Exon 4 To Exon 5 (Pair 23)
Forward (571,23)ATGATCAAGTGTTGGGTATAAGCAmplicon SizecDNA: 121 bpgenomic: 39,098
Reverse (691,23)TTACATTGCACACAGCCCATTATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.583 kcal/mol
Forward Dimers-2.036 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.392 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceATGATCAAGTGTTGGGTATAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTG
AGGAGCTGAGAAGGGAGGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTA
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)1213 - 123
Exon 4 To Exon 5 (Pair 24)
Forward (587,22)TATAAGCCAAGGAGCTGAGAGAAmplicon SizecDNA: 103 bpgenomic: 39,080
Reverse (689,22)ACATTGCACACAGCCCATTATCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.179 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.983 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTATAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGA
GGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)10319 - 121
Exon 4 To Exon 5 (Pair 25)
Forward (573,22)GATCAAGTGTTGGGTATAAGCCAmplicon SizecDNA: 119 bpgenomic: 39,096
Reverse (691,23)TTACATTGCACACAGCCCATTATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.327 kcal/mol in 3' area
Forward Dimers-0.18 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.392 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGATCAAGTGTTGGGTATAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAG
GAGCTGAGAAGGGAGGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)1195 - 123
Exon 4 To Exon 5 (Pair 26)
Forward (587,22)TATAAGCCAAGGAGCTGAGAGAAmplicon SizecDNA: 101 bpgenomic: 39,078
Reverse (687,23)ATTGCACACAGCCCATTATCTAANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.179 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.983 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTATAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGA
GGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)10119 - 119
Exon 4 To Exon 5 (Pair 27)
Forward (589,21)TAAGCCAAGGAGCTGAGAGAGAmplicon SizecDNA: 101 bpgenomic: 39,078
Reverse (689,22)ACATTGCACACAGCCCATTATCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.179 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.983 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGG
CTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)10121 - 121
Exon 4 To Exon 5 (Pair 28)
Forward (589,21)TAAGCCAAGGAGCTGAGAGAGAmplicon SizecDNA: 104 bpgenomic: 39,081
Reverse (692,22)CTTACATTGCACACAGCCCATTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.179 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.983 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGG
CTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGTAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)10421 - 124
Exon 4 To Exon 5 (Pair 29)
Forward (581,21)GTTGGGTATAAGCCAAGGAGCAmplicon SizecDNA: 105 bpgenomic: 39,082
Reverse (685,23)TGCACACAGCCCATTATCTAAATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.905 kcal/mol
Forward Dimers-0.764 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.124 kcal/mol
Forward-Reverse Dimers-2.284 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGTTGGGTATAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAG
AAGGGAGGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)10513 - 117
Exon 4 To Exon 5 (Pair 30)
Forward (589,21)TAAGCCAAGGAGCTGAGAGAGAmplicon SizecDNA: 99 bpgenomic: 39,076
Reverse (687,23)ATTGCACACAGCCCATTATCTAANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.179 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.983 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGG
CTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)9921 - 119
Exon 4 To Exon 5 (Pair 31)
Forward (591,20)AGCCAAGGAGCTGAGAGAGGAmplicon SizecDNA: 98 bpgenomic: 39,075
Reverse (688,22)CATTGCACACAGCCCATTATCTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.72 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.983 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGGCT
TACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)9823 - 120
Exon 4 To Exon 5 (Pair 32)
Forward (571,23)ATGATCAAGTGTTGGGTATAAGCAmplicon SizecDNA: 116 bpgenomic: 39,093
Reverse (686,23)TTGCACACAGCCCATTATCTAAANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.583 kcal/mol
Forward Dimers-2.036 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.392 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceATGATCAAGTGTTGGGTATAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTG
AGGAGCTGAGAAGGGAGGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)1163 - 118
Exon 4 To Exon 5 (Pair 33)
Forward (571,23)ATGATCAAGTGTTGGGTATAAGCAmplicon SizecDNA: 118 bpgenomic: 39,095
Reverse (688,22)CATTGCACACAGCCCATTATCTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.583 kcal/mol
Forward Dimers-2.036 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.392 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceATGATCAAGTGTTGGGTATAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTG
AGGAGCTGAGAAGGGAGGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)1183 - 120
Exon 4 To Exon 5 (Pair 34)
Forward (571,23)ATGATCAAGTGTTGGGTATAAGCAmplicon SizecDNA: 119 bpgenomic: 39,096
Reverse (689,22)ACATTGCACACAGCCCATTATCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.583 kcal/mol
Forward Dimers-2.036 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.392 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceATGATCAAGTGTTGGGTATAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTG
AGGAGCTGAGAAGGGAGGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)1193 - 121
Exon 4 To Exon 5 (Pair 35)
Forward (569,24)AAATGATCAAGTGTTGGGTATAAGAmplicon SizecDNA: 117 bpgenomic: 39,094
Reverse (685,23)TGCACACAGCCCATTATCTAAATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.583 kcal/mol
Forward Dimers-2.036 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.124 kcal/mol
Forward-Reverse Dimers-2.392 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceAAATGATCAAGTGTTGGGTATAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTC
TGAGGAGCTGAGAAGGGAGGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)1171 - 117
Exon 4 To Exon 5 (Pair 36)
Forward (589,21)TAAGCCAAGGAGCTGAGAGAGAmplicon SizecDNA: 97 bpgenomic: 39,074
Reverse (685,23)TGCACACAGCCCATTATCTAAATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.179 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.124 kcal/mol
Forward-Reverse Dimers-2.983 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGAGG
CTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)9721 - 117
Exon 4 To Exon 5 (Pair 37)
Forward (587,22)TATAAGCCAAGGAGCTGAGAGAAmplicon SizecDNA: 102 bpgenomic: 39,079
Reverse (688,22)CATTGCACACAGCCCATTATCTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.179 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.983 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceTATAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAGGAGCTGAGAAGGGA
GGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)10219 - 120
Exon 4 To Exon 5 (Pair 38)
Forward (569,24)AAATGATCAAGTGTTGGGTATAAGAmplicon SizecDNA: 120 bpgenomic: 39,097
Reverse (688,22)CATTGCACACAGCCCATTATCTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.583 kcal/mol
Forward Dimers-2.036 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.392 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceAAATGATCAAGTGTTGGGTATAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTC
TGAGGAGCTGAGAAGGGAGGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)1201 - 120
Exon 4 To Exon 5 (Pair 39)
Forward (626,20)GTCTGAGGAGCTGAGAAGGGAmplicon SizecDNA: 74 bpgenomic: 39,051
Reverse (699,23)CTTTATCCTTACATTGCACACAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.866 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.829 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.335 kcal/mol
Amplicon Folding0.422 kcal/mol inside primersite
Amplicon SequenceGTCTGAGGAGCTGAGAAGGGAGGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCA
ATGTAAGGATAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)7458 - 131
Exon 4 To Exon 5 (Pair 40)
Forward (573,22)GATCAAGTGTTGGGTATAAGCCAmplicon SizecDNA: 113 bpgenomic: 39,090
Reverse (685,23)TGCACACAGCCCATTATCTAAATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.327 kcal/mol in 3' area
Forward Dimers-0.18 kcal/mol
Reverse Loops0.653 kcal/mol
Reverse Dimers-1.124 kcal/mol
Forward-Reverse Dimers-2.392 kcal/mol
Amplicon Folding-1.359 kcal/mol outside primersite
Amplicon SequenceGATCAAGTGTTGGGTATAAGCCAAGGAGCTGAGAGAGGGGGAGACCAGCGCAGGTCTGAG
GAGCTGAGAAGGGAGGCTTACGTGAAGGGAATTTAGATAATGGGCTGTGTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153048 (FYN)1135 - 117
 

See below for some more details.

Program Output:

Loading ...