Design Results for GBP3

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size200
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size0

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 9 To Exon 10 (Pair 1)
Forward (1669,23)TTTCAGTCCTCTAGAAGAAGAAGAmplicon SizecDNA: 167 bpgenomic: 1,576
Reverse (1835,23)ACTCCTTGGATTTCAAGTATGTCNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.425 kcal/mol
Forward Dimers-1.236 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.795 kcal/mol
Forward-Reverse Dimers-1.254 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceTTTCAGTCCTCTAGAAGAAGAAGTGAAGGCGGGAATTTATTCGAAACCAGGGGGCTATTG
TCTCTTTATTCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGG
GATACAGGCTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002053 (GBP1)1671462 - 1628
NM_018284 (GBP3)1671441 - 1607
Exon 9 To Exon 11 (Pair 1)
Forward (1741,22)GAAGCTACAAGACCTGGAGAAAAmplicon SizecDNA: 194 bpgenomic: 1,854
Reverse (1934,21)CTGAAGCCTGTGCAGATTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.363 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.801 kcal/mol
Reverse Dimers-2.595 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATACAGGCTGA
AGAGATTCTGCAGACATACTTGAAATCCAAGGAGTCTGTGACCGATGCAATTCTACAGAC
AGACCAGATTCTCACAGAAAAGGAAAAGGAGATTGAAGTGGAATGTGTAAAAGCTGAATC
TGCACAGGCTTCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_018284 (GBP3)1941513 - 1706
NM_002053 (GBP1)1941534 - 1727
Exon 9 To Exon 10 (Pair 2)
Forward (1644,22)GTTGCTCAGCTTTACTTCAGGTAmplicon SizecDNA: 192 bpgenomic: 1,601
Reverse (1835,23)ACTCCTTGGATTTCAAGTATGTCNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.836 kcal/mol
Forward Dimers-2.77 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.795 kcal/mol
Forward-Reverse Dimers-1.862 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceGTTGCTCAGCTTTACTTCAGGTCATTTTCAGTCCTCTAGAAGAAGAAGTGAAGGCGGGAA
TTTATTCGAAACCAGGGGGCTATTGTCTCTTTATTCAGAAGCTACAAGACCTGGAGAAAA
AGTACTATGAGGAACCAAGGAAGGGGATACAGGCTGAAGAGATTCTGCAGACATACTTGA
AATCCAAGGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)1921416 - 1607
NM_002053 (GBP1)1921437 - 1628
Exon 9 To Exon 11 (Pair 2)
Forward (1737,22)TTCAGAAGCTACAAGACCTGGAAmplicon SizecDNA: 197 bpgenomic: 1,857
Reverse (1933,21)TGAAGCCTGTGCAGATTCAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.701 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.801 kcal/mol
Reverse Dimers-2.595 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATACAGG
CTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAGTCTGTGACCGATGCAATTCTAC
AGACAGACCAGATTCTCACAGAAAAGGAAAAGGAGATTGAAGTGGAATGTGTAAAAGCTG
AATCTGCACAGGCTTCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002053 (GBP1)1971530 - 1726
NM_018284 (GBP3)1971509 - 1705
Exon 9 To Exon 10 (Pair 3)
Forward (1646,22)TGCTCAGCTTTACTTCAGGTCAAmplicon SizecDNA: 190 bpgenomic: 1,599
Reverse (1835,23)ACTCCTTGGATTTCAAGTATGTCNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.836 kcal/mol
Forward Dimers-2.77 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.795 kcal/mol
Forward-Reverse Dimers-1.862 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceTGCTCAGCTTTACTTCAGGTCATTTTCAGTCCTCTAGAAGAAGAAGTGAAGGCGGGAATT
TATTCGAAACCAGGGGGCTATTGTCTCTTTATTCAGAAGCTACAAGACCTGGAGAAAAAG
TACTATGAGGAACCAAGGAAGGGGATACAGGCTGAAGAGATTCTGCAGACATACTTGAAA
TCCAAGGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002053 (GBP1)1901439 - 1628
NM_018284 (GBP3)1901418 - 1607
Exon 9 To Exon 11 (Pair 3)
Forward (1736,22)ATTCAGAAGCTACAAGACCTGGAmplicon SizecDNA: 198 bpgenomic: 1,858
Reverse (1933,21)TGAAGCCTGTGCAGATTCAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.701 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.801 kcal/mol
Reverse Dimers-2.595 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceATTCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATACAG
GCTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAGTCTGTGACCGATGCAATTCTA
CAGACAGACCAGATTCTCACAGAAAAGGAAAAGGAGATTGAAGTGGAATGTGTAAAAGCT
GAATCTGCACAGGCTTCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_018284 (GBP3)1981508 - 1705
NM_002053 (GBP1)1971530 - 1726
Exon 9 To Exon 11 (Pair 4)
Forward (1740,22)AGAAGCTACAAGACCTGGAGAAAmplicon SizecDNA: 194 bpgenomic: 1,854
Reverse (1933,21)TGAAGCCTGTGCAGATTCAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.363 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.801 kcal/mol
Reverse Dimers-2.595 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATACAGGCTG
AAGAGATTCTGCAGACATACTTGAAATCCAAGGAGTCTGTGACCGATGCAATTCTACAGA
CAGACCAGATTCTCACAGAAAAGGAAAAGGAGATTGAAGTGGAATGTGTAAAAGCTGAAT
CTGCACAGGCTTCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_018284 (GBP3)1941512 - 1705
NM_002053 (GBP1)1941533 - 1726
Exon 9 To Exon 11 (Pair 5)
Forward (1739,21)CAGAAGCTACAAGACCTGGAGAmplicon SizecDNA: 195 bpgenomic: 1,855
Reverse (1933,21)TGAAGCCTGTGCAGATTCAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.174 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.801 kcal/mol
Reverse Dimers-2.595 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATACAGGCT
GAAGAGATTCTGCAGACATACTTGAAATCCAAGGAGTCTGTGACCGATGCAATTCTACAG
ACAGACCAGATTCTCACAGAAAAGGAAAAGGAGATTGAAGTGGAATGTGTAAAAGCTGAA
TCTGCACAGGCTTCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_018284 (GBP3)1951511 - 1705
NM_002053 (GBP1)1951532 - 1726
Exon 9 To Exon 10 (Pair 4)
Forward (1669,23)TTTCAGTCCTCTAGAAGAAGAAGAmplicon SizecDNA: 166 bpgenomic: 1,575
Reverse (1834,23)CTCCTTGGATTTCAAGTATGTCTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.425 kcal/mol
Forward Dimers-1.236 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.328 kcal/mol
Forward-Reverse Dimers-1.199 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceTTTCAGTCCTCTAGAAGAAGAAGTGAAGGCGGGAATTTATTCGAAACCAGGGGGCTATTG
TCTCTTTATTCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGG
GATACAGGCTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)1661441 - 1606
NM_002053 (GBP1)1661462 - 1627
Exon 9 To Exon 10 (Pair 5)
Forward (1673,23)AGTCCTCTAGAAGAAGAAGTGAAAmplicon SizecDNA: 162 bpgenomic: 1,571
Reverse (1834,23)CTCCTTGGATTTCAAGTATGTCTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.425 kcal/mol
Forward Dimers-1.236 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.328 kcal/mol
Forward-Reverse Dimers-1.199 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceAGTCCTCTAGAAGAAGAAGTGAAGGCGGGAATTTATTCGAAACCAGGGGGCTATTGTCTC
TTTATTCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATA
CAGGCTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)1621445 - 1606
NM_002053 (GBP1)1621466 - 1627
Exon 9 To Exon 11 (Pair 6)
Forward (1739,21)CAGAAGCTACAAGACCTGGAGAmplicon SizecDNA: 196 bpgenomic: 1,856
Reverse (1934,21)CTGAAGCCTGTGCAGATTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.174 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.801 kcal/mol
Reverse Dimers-2.595 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATACAGGCT
GAAGAGATTCTGCAGACATACTTGAAATCCAAGGAGTCTGTGACCGATGCAATTCTACAG
ACAGACCAGATTCTCACAGAAAAGGAAAAGGAGATTGAAGTGGAATGTGTAAAAGCTGAA
TCTGCACAGGCTTCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_018284 (GBP3)1961511 - 1706
NM_002053 (GBP1)1961532 - 1727
Exon 9 To Exon 10 (Pair 6)
Forward (1645,22)TTGCTCAGCTTTACTTCAGGTCAmplicon SizecDNA: 190 bpgenomic: 1,599
Reverse (1834,23)CTCCTTGGATTTCAAGTATGTCTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.836 kcal/mol
Forward Dimers-2.77 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.328 kcal/mol
Forward-Reverse Dimers-1.862 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceTTGCTCAGCTTTACTTCAGGTCATTTTCAGTCCTCTAGAAGAAGAAGTGAAGGCGGGAAT
TTATTCGAAACCAGGGGGCTATTGTCTCTTTATTCAGAAGCTACAAGACCTGGAGAAAAA
GTACTATGAGGAACCAAGGAAGGGGATACAGGCTGAAGAGATTCTGCAGACATACTTGAA
ATCCAAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002053 (GBP1)1901438 - 1627
NM_018284 (GBP3)1901417 - 1606
Exon 9 To Exon 10 (Pair 7)
Forward (1736,22)ATTCAGAAGCTACAAGACCTGGAmplicon SizecDNA: 99 bpgenomic: 1,508
Reverse (1834,23)CTCCTTGGATTTCAAGTATGTCTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.701 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.328 kcal/mol
Forward-Reverse Dimers-1.718 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceATTCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATACAG
GCTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002053 (GBP1)981530 - 1627
NM_018284 (GBP3)991508 - 1606
Exon 9 To Exon 10 (Pair 8)
Forward (1647,22)GCTCAGCTTTACTTCAGGTCATAmplicon SizecDNA: 188 bpgenomic: 1,597
Reverse (1834,23)CTCCTTGGATTTCAAGTATGTCTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.836 kcal/mol
Forward Dimers-2.77 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.328 kcal/mol
Forward-Reverse Dimers-1.862 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceGCTCAGCTTTACTTCAGGTCATTTTCAGTCCTCTAGAAGAAGAAGTGAAGGCGGGAATTT
ATTCGAAACCAGGGGGCTATTGTCTCTTTATTCAGAAGCTACAAGACCTGGAGAAAAAGT
ACTATGAGGAACCAAGGAAGGGGATACAGGCTGAAGAGATTCTGCAGACATACTTGAAAT
CCAAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002053 (GBP1)1881440 - 1627
NM_018284 (GBP3)1881419 - 1606
Exon 9 To Exon 10 (Pair 9)
Forward (1647,22)GCTCAGCTTTACTTCAGGTCATAmplicon SizecDNA: 189 bpgenomic: 1,598
Reverse (1835,23)ACTCCTTGGATTTCAAGTATGTCNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.836 kcal/mol
Forward Dimers-2.77 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.795 kcal/mol
Forward-Reverse Dimers-1.862 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceGCTCAGCTTTACTTCAGGTCATTTTCAGTCCTCTAGAAGAAGAAGTGAAGGCGGGAATTT
ATTCGAAACCAGGGGGCTATTGTCTCTTTATTCAGAAGCTACAAGACCTGGAGAAAAAGT
ACTATGAGGAACCAAGGAAGGGGATACAGGCTGAAGAGATTCTGCAGACATACTTGAAAT
CCAAGGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002053 (GBP1)1891440 - 1628
NM_018284 (GBP3)1891419 - 1607
Exon 9 To Exon 10 (Pair 10)
Forward (1739,21)CAGAAGCTACAAGACCTGGAGAmplicon SizecDNA: 96 bpgenomic: 1,505
Reverse (1834,23)CTCCTTGGATTTCAAGTATGTCTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.174 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.328 kcal/mol
Forward-Reverse Dimers-1.718 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATACAGGCT
GAAGAGATTCTGCAGACATACTTGAAATCCAAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002053 (GBP1)961532 - 1627
NM_018284 (GBP3)961511 - 1606
Exon 9 To Exon 10 (Pair 11)
Forward (1670,23)TTCAGTCCTCTAGAAGAAGAAGTAmplicon SizecDNA: 165 bpgenomic: 1,574
Reverse (1834,23)CTCCTTGGATTTCAAGTATGTCTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.425 kcal/mol
Forward Dimers-1.236 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.328 kcal/mol
Forward-Reverse Dimers-1.199 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceTTCAGTCCTCTAGAAGAAGAAGTGAAGGCGGGAATTTATTCGAAACCAGGGGGCTATTGT
CTCTTTATTCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGG
ATACAGGCTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)1651442 - 1606
NM_002053 (GBP1)1651463 - 1627
Exon 9 To Exon 10 (Pair 12)
Forward (1737,22)TTCAGAAGCTACAAGACCTGGAAmplicon SizecDNA: 99 bpgenomic: 1,508
Reverse (1835,23)ACTCCTTGGATTTCAAGTATGTCNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.701 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.795 kcal/mol
Forward-Reverse Dimers-1.718 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATACAGG
CTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002053 (GBP1)991530 - 1628
NM_018284 (GBP3)991509 - 1607
Exon 9 To Exon 10 (Pair 13)
Forward (1646,22)TGCTCAGCTTTACTTCAGGTCAAmplicon SizecDNA: 189 bpgenomic: 1,598
Reverse (1834,23)CTCCTTGGATTTCAAGTATGTCTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.836 kcal/mol
Forward Dimers-2.77 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.328 kcal/mol
Forward-Reverse Dimers-1.862 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceTGCTCAGCTTTACTTCAGGTCATTTTCAGTCCTCTAGAAGAAGAAGTGAAGGCGGGAATT
TATTCGAAACCAGGGGGCTATTGTCTCTTTATTCAGAAGCTACAAGACCTGGAGAAAAAG
TACTATGAGGAACCAAGGAAGGGGATACAGGCTGAAGAGATTCTGCAGACATACTTGAAA
TCCAAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)1891418 - 1606
NM_002053 (GBP1)1891439 - 1627
Exon 9 To Exon 11 (Pair 7)
Forward (1741,22)GAAGCTACAAGACCTGGAGAAAAmplicon SizecDNA: 193 bpgenomic: 1,853
Reverse (1933,21)TGAAGCCTGTGCAGATTCAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.363 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.801 kcal/mol
Reverse Dimers-2.595 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATACAGGCTGA
AGAGATTCTGCAGACATACTTGAAATCCAAGGAGTCTGTGACCGATGCAATTCTACAGAC
AGACCAGATTCTCACAGAAAAGGAAAAGGAGATTGAAGTGGAATGTGTAAAAGCTGAATC
TGCACAGGCTTCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_018284 (GBP3)1931513 - 1705
NM_002053 (GBP1)1931534 - 1726
Exon 9 To Exon 10 (Pair 14)
Forward (1734,23)TTATTCAGAAGCTACAAGACCTGAmplicon SizecDNA: 102 bpgenomic: 1,511
Reverse (1835,23)ACTCCTTGGATTTCAAGTATGTCNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.712 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.795 kcal/mol
Forward-Reverse Dimers-1.718 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceTTATTCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATAC
AGGCTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002053 (GBP1)1021527 - 1628
NM_018284 (GBP3)1021506 - 1607
Exon 9 To Exon 10 (Pair 15)
Forward (1672,22)CAGTCCTCTAGAAGAAGAAGTGAmplicon SizecDNA: 164 bpgenomic: 1,573
Reverse (1835,23)ACTCCTTGGATTTCAAGTATGTCNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.425 kcal/mol
Forward Dimers-1.236 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.795 kcal/mol
Forward-Reverse Dimers-1.254 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceCAGTCCTCTAGAAGAAGAAGTGAAGGCGGGAATTTATTCGAAACCAGGGGGCTATTGTCT
CTTTATTCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGAT
ACAGGCTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)1641444 - 1607
NM_002053 (GBP1)1641465 - 1628
Exon 9 To Exon 10 (Pair 16)
Forward (1644,22)GTTGCTCAGCTTTACTTCAGGTAmplicon SizecDNA: 191 bpgenomic: 1,600
Reverse (1834,23)CTCCTTGGATTTCAAGTATGTCTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.836 kcal/mol
Forward Dimers-2.77 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.328 kcal/mol
Forward-Reverse Dimers-1.862 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceGTTGCTCAGCTTTACTTCAGGTCATTTTCAGTCCTCTAGAAGAAGAAGTGAAGGCGGGAA
TTTATTCGAAACCAGGGGGCTATTGTCTCTTTATTCAGAAGCTACAAGACCTGGAGAAAA
AGTACTATGAGGAACCAAGGAAGGGGATACAGGCTGAAGAGATTCTGCAGACATACTTGA
AATCCAAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)1911416 - 1606
NM_002053 (GBP1)1911437 - 1627
Exon 9 To Exon 11 (Pair 8)
Forward (1736,22)ATTCAGAAGCTACAAGACCTGGAmplicon SizecDNA: 199 bpgenomic: 1,859
Reverse (1934,21)CTGAAGCCTGTGCAGATTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.701 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.801 kcal/mol
Reverse Dimers-2.595 kcal/mol
Forward-Reverse Dimers-1.958 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceATTCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATACAG
GCTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAGTCTGTGACCGATGCAATTCTA
CAGACAGACCAGATTCTCACAGAAAAGGAAAAGGAGATTGAAGTGGAATGTGTAAAAGCT
GAATCTGCACAGGCTTCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002053 (GBP1)1981530 - 1727
NM_018284 (GBP3)1991508 - 1706
Exon 9 To Exon 11 (Pair 9)
Forward (1740,22)AGAAGCTACAAGACCTGGAGAAAmplicon SizecDNA: 195 bpgenomic: 1,855
Reverse (1934,21)CTGAAGCCTGTGCAGATTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.363 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.801 kcal/mol
Reverse Dimers-2.595 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATACAGGCTG
AAGAGATTCTGCAGACATACTTGAAATCCAAGGAGTCTGTGACCGATGCAATTCTACAGA
CAGACCAGATTCTCACAGAAAAGGAAAAGGAGATTGAAGTGGAATGTGTAAAAGCTGAAT
CTGCACAGGCTTCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_018284 (GBP3)1951512 - 1706
NM_002053 (GBP1)1951533 - 1727
Exon 9 To Exon 11 (Pair 10)
Forward (1734,23)TTATTCAGAAGCTACAAGACCTGAmplicon SizecDNA: 201 bpgenomic: 1,861
Reverse (1934,21)CTGAAGCCTGTGCAGATTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.712 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops0.801 kcal/mol
Reverse Dimers-2.595 kcal/mol
Forward-Reverse Dimers-1.958 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceTTATTCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATAC
AGGCTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAGTCTGTGACCGATGCAATTC
TACAGACAGACCAGATTCTCACAGAAAAGGAAAAGGAGATTGAAGTGGAATGTGTAAAAG
CTGAATCTGCACAGGCTTCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002053 (GBP1)2011527 - 1727
NM_018284 (GBP3)2011506 - 1706
Exon 9 To Exon 10 (Pair 17)
Forward (1672,22)CAGTCCTCTAGAAGAAGAAGTGAmplicon SizecDNA: 163 bpgenomic: 1,572
Reverse (1834,23)CTCCTTGGATTTCAAGTATGTCTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.425 kcal/mol
Forward Dimers-1.236 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.328 kcal/mol
Forward-Reverse Dimers-1.199 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceCAGTCCTCTAGAAGAAGAAGTGAAGGCGGGAATTTATTCGAAACCAGGGGGCTATTGTCT
CTTTATTCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGAT
ACAGGCTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)1631444 - 1606
NM_002053 (GBP1)1631465 - 1627
Exon 9 To Exon 10 (Pair 18)
Forward (1734,23)TTATTCAGAAGCTACAAGACCTGAmplicon SizecDNA: 101 bpgenomic: 1,510
Reverse (1834,23)CTCCTTGGATTTCAAGTATGTCTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.712 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.328 kcal/mol
Forward-Reverse Dimers-1.718 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceTTATTCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATAC
AGGCTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)1011506 - 1606
NM_002053 (GBP1)1011527 - 1627
Exon 9 To Exon 11 (Pair 11)
Forward (1734,23)TTATTCAGAAGCTACAAGACCTGAmplicon SizecDNA: 200 bpgenomic: 1,860
Reverse (1933,21)TGAAGCCTGTGCAGATTCAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.712 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops0.801 kcal/mol
Reverse Dimers-2.595 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceTTATTCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATAC
AGGCTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAGTCTGTGACCGATGCAATTC
TACAGACAGACCAGATTCTCACAGAAAAGGAAAAGGAGATTGAAGTGGAATGTGTAAAAG
CTGAATCTGCACAGGCTTCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002053 (GBP1)2001527 - 1726
NM_018284 (GBP3)2001506 - 1705
Exon 9 To Exon 10 (Pair 19)
Forward (1648,23)CTCAGCTTTACTTCAGGTCATTTAmplicon SizecDNA: 188 bpgenomic: 1,597
Reverse (1835,23)ACTCCTTGGATTTCAAGTATGTCNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.836 kcal/mol
Forward Dimers-2.77 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.795 kcal/mol
Forward-Reverse Dimers-1.862 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceCTCAGCTTTACTTCAGGTCATTTTCAGTCCTCTAGAAGAAGAAGTGAAGGCGGGAATTTA
TTCGAAACCAGGGGGCTATTGTCTCTTTATTCAGAAGCTACAAGACCTGGAGAAAAAGTA
CTATGAGGAACCAAGGAAGGGGATACAGGCTGAAGAGATTCTGCAGACATACTTGAAATC
CAAGGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002053 (GBP1)1881441 - 1628
NM_018284 (GBP3)1881420 - 1607
Exon 9 To Exon 10 (Pair 20)
Forward (1645,22)TTGCTCAGCTTTACTTCAGGTCAmplicon SizecDNA: 191 bpgenomic: 1,600
Reverse (1835,23)ACTCCTTGGATTTCAAGTATGTCNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.836 kcal/mol
Forward Dimers-2.77 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.795 kcal/mol
Forward-Reverse Dimers-1.862 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceTTGCTCAGCTTTACTTCAGGTCATTTTCAGTCCTCTAGAAGAAGAAGTGAAGGCGGGAAT
TTATTCGAAACCAGGGGGCTATTGTCTCTTTATTCAGAAGCTACAAGACCTGGAGAAAAA
GTACTATGAGGAACCAAGGAAGGGGATACAGGCTGAAGAGATTCTGCAGACATACTTGAA
ATCCAAGGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)1911417 - 1607
NM_002053 (GBP1)1911438 - 1628
Exon 9 To Exon 10 (Pair 21)
Forward (1736,22)ATTCAGAAGCTACAAGACCTGGAmplicon SizecDNA: 100 bpgenomic: 1,509
Reverse (1835,23)ACTCCTTGGATTTCAAGTATGTCNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.701 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.795 kcal/mol
Forward-Reverse Dimers-1.718 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceATTCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATACAG
GCTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)1001508 - 1607
NM_002053 (GBP1)991530 - 1628
Exon 9 To Exon 10 (Pair 22)
Forward (1670,23)TTCAGTCCTCTAGAAGAAGAAGTAmplicon SizecDNA: 166 bpgenomic: 1,575
Reverse (1835,23)ACTCCTTGGATTTCAAGTATGTCNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.425 kcal/mol
Forward Dimers-1.236 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.795 kcal/mol
Forward-Reverse Dimers-1.254 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceTTCAGTCCTCTAGAAGAAGAAGTGAAGGCGGGAATTTATTCGAAACCAGGGGGCTATTGT
CTCTTTATTCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGG
ATACAGGCTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002053 (GBP1)1661463 - 1628
NM_018284 (GBP3)1661442 - 1607
Exon 9 To Exon 10 (Pair 23)
Forward (1737,22)TTCAGAAGCTACAAGACCTGGAAmplicon SizecDNA: 98 bpgenomic: 1,507
Reverse (1834,23)CTCCTTGGATTTCAAGTATGTCTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.701 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.328 kcal/mol
Forward-Reverse Dimers-1.718 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATACAGG
CTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002053 (GBP1)981530 - 1627
NM_018284 (GBP3)981509 - 1606
Exon 9 To Exon 10 (Pair 24)
Forward (1648,23)CTCAGCTTTACTTCAGGTCATTTAmplicon SizecDNA: 187 bpgenomic: 1,596
Reverse (1834,23)CTCCTTGGATTTCAAGTATGTCTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.836 kcal/mol
Forward Dimers-2.77 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.328 kcal/mol
Forward-Reverse Dimers-1.862 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceCTCAGCTTTACTTCAGGTCATTTTCAGTCCTCTAGAAGAAGAAGTGAAGGCGGGAATTTA
TTCGAAACCAGGGGGCTATTGTCTCTTTATTCAGAAGCTACAAGACCTGGAGAAAAAGTA
CTATGAGGAACCAAGGAAGGGGATACAGGCTGAAGAGATTCTGCAGACATACTTGAAATC
CAAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)1871420 - 1606
NM_002053 (GBP1)1871441 - 1627
Exon 9 To Exon 11 (Pair 12)
Forward (1737,22)TTCAGAAGCTACAAGACCTGGAAmplicon SizecDNA: 198 bpgenomic: 1,858
Reverse (1934,21)CTGAAGCCTGTGCAGATTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.701 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.801 kcal/mol
Reverse Dimers-2.595 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATACAGG
CTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAGTCTGTGACCGATGCAATTCTAC
AGACAGACCAGATTCTCACAGAAAAGGAAAAGGAGATTGAAGTGGAATGTGTAAAAGCTG
AATCTGCACAGGCTTCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002053 (GBP1)1981530 - 1727
NM_018284 (GBP3)1981509 - 1706
Exon 10 To Exon 11 (Pair 1)
Forward (1850,23)ATTCTACAGACAGACCAGATTCTAmplicon SizecDNA: 85 bpgenomic: 336
Reverse (1934,21)CTGAAGCCTGTGCAGATTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.887 kcal/mol in 3' area
Forward Dimers-0.345 kcal/mol
Reverse Loops0.801 kcal/mol
Reverse Dimers-2.595 kcal/mol
Forward-Reverse Dimers-2.519 kcal/mol
Amplicon Folding0.102 kcal/mol inside primersite
Amplicon SequenceATTCTACAGACAGACCAGATTCTCACAGAAAAGGAAAAGGAGATTGAAGTGGAATGTGTA
AAAGCTGAATCTGCACAGGCTTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)851622 - 1706
Exon 10 To Exon 11 (Pair 2)
Forward (1850,23)ATTCTACAGACAGACCAGATTCTAmplicon SizecDNA: 112 bpgenomic: 363
Reverse (1961,24)TTATTTGCATTTCCTCCACCATTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.887 kcal/mol in 3' area
Forward Dimers-0.345 kcal/mol
Reverse Loops2.33 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-0.777 kcal/mol
Amplicon Folding-0.844 kcal/mol outside primersite
Amplicon SequenceATTCTACAGACAGACCAGATTCTCACAGAAAAGGAAAAGGAGATTGAAGTGGAATGTGTA
AAAGCTGAATCTGCACAGGCTTCAGCAAAAATGGTGGAGGAAATGCAAATAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)1121622 - 1733
Exon 10 To Exon 11 (Pair 3)
Forward (1850,23)ATTCTACAGACAGACCAGATTCTAmplicon SizecDNA: 117 bpgenomic: 368
Reverse (1966,24)ATACTTTATTTGCATTTCCTCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.887 kcal/mol in 3' area
Forward Dimers-0.345 kcal/mol
Reverse Loops2.289 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-1.105 kcal/mol
Amplicon Folding-0.844 kcal/mol outside primersite
Amplicon SequenceATTCTACAGACAGACCAGATTCTCACAGAAAAGGAAAAGGAGATTGAAGTGGAATGTGTA
AAAGCTGAATCTGCACAGGCTTCAGCAAAAATGGTGGAGGAAATGCAAATAAAGTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)1171622 - 1738
Exon 10 To Exon 11 (Pair 4)
Forward (1850,23)ATTCTACAGACAGACCAGATTCTAmplicon SizecDNA: 120 bpgenomic: 371
Reverse (1969,24)CTGATACTTTATTTGCATTTCCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.887 kcal/mol in 3' area
Forward Dimers-0.345 kcal/mol
Reverse Loops1.726 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-1.712 kcal/mol
Amplicon Folding-0.844 kcal/mol outside primersite
Amplicon SequenceATTCTACAGACAGACCAGATTCTCACAGAAAAGGAAAAGGAGATTGAAGTGGAATGTGTA
AAAGCTGAATCTGCACAGGCTTCAGCAAAAATGGTGGAGGAAATGCAAATAAAGTATCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)1201622 - 1741
Exon 10 To Exon 11 (Pair 5)
Forward (1850,23)ATTCTACAGACAGACCAGATTCTAmplicon SizecDNA: 118 bpgenomic: 369
Reverse (1967,24)GATACTTTATTTGCATTTCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.887 kcal/mol in 3' area
Forward Dimers-0.345 kcal/mol
Reverse Loops1.726 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-1.105 kcal/mol
Amplicon Folding-0.844 kcal/mol outside primersite
Amplicon SequenceATTCTACAGACAGACCAGATTCTCACAGAAAAGGAAAAGGAGATTGAAGTGGAATGTGTA
AAAGCTGAATCTGCACAGGCTTCAGCAAAAATGGTGGAGGAAATGCAAATAAAGTATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)1181622 - 1739
Exon 10 To Exon 11 (Pair 6)
Forward (1850,23)ATTCTACAGACAGACCAGATTCTAmplicon SizecDNA: 113 bpgenomic: 364
Reverse (1962,24)TTTATTTGCATTTCCTCCACCATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.887 kcal/mol in 3' area
Forward Dimers-0.345 kcal/mol
Reverse Loops2.33 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-0.777 kcal/mol
Amplicon Folding-0.844 kcal/mol outside primersite
Amplicon SequenceATTCTACAGACAGACCAGATTCTCACAGAAAAGGAAAAGGAGATTGAAGTGGAATGTGTA
AAAGCTGAATCTGCACAGGCTTCAGCAAAAATGGTGGAGGAAATGCAAATAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)1131622 - 1734
Exon 10 To Exon 11 (Pair 7)
Forward (1850,23)ATTCTACAGACAGACCAGATTCTAmplicon SizecDNA: 181 bpgenomic: 432
Reverse (2030,24)TCTTCTCAGTCAATTGTTTCACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.887 kcal/mol in 3' area
Forward Dimers-0.345 kcal/mol
Reverse Loops1.706 kcal/mol in 3' area
Reverse Dimers-1.142 kcal/mol
Forward-Reverse Dimers-1.033 kcal/mol
Amplicon Folding-0.844 kcal/mol outside primersite
Amplicon SequenceATTCTACAGACAGACCAGATTCTCACAGAAAAGGAAAAGGAGATTGAAGTGGAATGTGTA
AAAGCTGAATCTGCACAGGCTTCAGCAAAAATGGTGGAGGAAATGCAAATAAAGTATCAG
CAGATGATGGAAGAGAAAGAGAAGAGTTATCAAGAACATGTGAAACAATTGACTGAGAAG
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)1811622 - 1802
Exon 10 To Exon 11 (Pair 8)
Forward (1850,23)ATTCTACAGACAGACCAGATTCTAmplicon SizecDNA: 122 bpgenomic: 373
Reverse (1971,24)TGCTGATACTTTATTTGCATTTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.887 kcal/mol in 3' area
Forward Dimers-0.345 kcal/mol
Reverse Loops1.681 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-2.086 kcal/mol
Amplicon Folding-0.844 kcal/mol outside primersite
Amplicon SequenceATTCTACAGACAGACCAGATTCTCACAGAAAAGGAAAAGGAGATTGAAGTGGAATGTGTA
AAAGCTGAATCTGCACAGGCTTCAGCAAAAATGGTGGAGGAAATGCAAATAAAGTATCAG
CA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)1221622 - 1743
Exon 10 To Exon 11 (Pair 9)
Forward (1850,23)ATTCTACAGACAGACCAGATTCTAmplicon SizecDNA: 119 bpgenomic: 370
Reverse (1968,24)TGATACTTTATTTGCATTTCCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.887 kcal/mol in 3' area
Forward Dimers-0.345 kcal/mol
Reverse Loops1.726 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-1.105 kcal/mol
Amplicon Folding-0.844 kcal/mol outside primersite
Amplicon SequenceATTCTACAGACAGACCAGATTCTCACAGAAAAGGAAAAGGAGATTGAAGTGGAATGTGTA
AAAGCTGAATCTGCACAGGCTTCAGCAAAAATGGTGGAGGAAATGCAAATAAAGTATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)1191622 - 1740
Exon 10 To Exon 11 (Pair 10)
Forward (1850,23)ATTCTACAGACAGACCAGATTCTAmplicon SizecDNA: 83 bpgenomic: 334
Reverse (1932,21)GAAGCCTGTGCAGATTCAGCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.887 kcal/mol in 3' area
Forward Dimers-0.345 kcal/mol
Reverse Loops0.801 kcal/mol
Reverse Dimers-2.595 kcal/mol
Forward-Reverse Dimers-2.519 kcal/mol
Amplicon Folding0.102 kcal/mol inside primersite
Amplicon SequenceATTCTACAGACAGACCAGATTCTCACAGAAAAGGAAAAGGAGATTGAAGTGGAATGTGTA
AAAGCTGAATCTGCACAGGCTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)831622 - 1704
Exon 10 To Exon 11 (Pair 11)
Forward (1850,23)ATTCTACAGACAGACCAGATTCTAmplicon SizecDNA: 115 bpgenomic: 366
Reverse (1964,23)ACTTTATTTGCATTTCCTCCACCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.887 kcal/mol in 3' area
Forward Dimers-0.345 kcal/mol
Reverse Loops2.33 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-1.105 kcal/mol
Amplicon Folding-0.844 kcal/mol outside primersite
Amplicon SequenceATTCTACAGACAGACCAGATTCTCACAGAAAAGGAAAAGGAGATTGAAGTGGAATGTGTA
AAAGCTGAATCTGCACAGGCTTCAGCAAAAATGGTGGAGGAAATGCAAATAAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)1151622 - 1736
Exon 10 To Exon 11 (Pair 12)
Forward (1850,23)ATTCTACAGACAGACCAGATTCTAmplicon SizecDNA: 84 bpgenomic: 335
Reverse (1933,21)TGAAGCCTGTGCAGATTCAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.887 kcal/mol in 3' area
Forward Dimers-0.345 kcal/mol
Reverse Loops0.801 kcal/mol
Reverse Dimers-2.595 kcal/mol
Forward-Reverse Dimers-2.519 kcal/mol
Amplicon Folding0.102 kcal/mol inside primersite
Amplicon SequenceATTCTACAGACAGACCAGATTCTCACAGAAAAGGAAAAGGAGATTGAAGTGGAATGTGTA
AAAGCTGAATCTGCACAGGCTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)841622 - 1705
Exon 10 To Exon 11 (Pair 13)
Forward (1850,23)ATTCTACAGACAGACCAGATTCTAmplicon SizecDNA: 114 bpgenomic: 365
Reverse (1963,23)CTTTATTTGCATTTCCTCCACCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.887 kcal/mol in 3' area
Forward Dimers-0.345 kcal/mol
Reverse Loops2.33 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-0.777 kcal/mol
Amplicon Folding-0.844 kcal/mol outside primersite
Amplicon SequenceATTCTACAGACAGACCAGATTCTCACAGAAAAGGAAAAGGAGATTGAAGTGGAATGTGTA
AAAGCTGAATCTGCACAGGCTTCAGCAAAAATGGTGGAGGAAATGCAAATAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)1141622 - 1735
Exon 10 To Exon 11 (Pair 14)
Forward (1850,23)ATTCTACAGACAGACCAGATTCTAmplicon SizecDNA: 121 bpgenomic: 372
Reverse (1970,24)GCTGATACTTTATTTGCATTTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.887 kcal/mol in 3' area
Forward Dimers-0.345 kcal/mol
Reverse Loops1.726 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-2.086 kcal/mol
Amplicon Folding-0.844 kcal/mol outside primersite
Amplicon SequenceATTCTACAGACAGACCAGATTCTCACAGAAAAGGAAAAGGAGATTGAAGTGGAATGTGTA
AAAGCTGAATCTGCACAGGCTTCAGCAAAAATGGTGGAGGAAATGCAAATAAAGTATCAG
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)1211622 - 1742
 

See below for some more details.

Program Output:

Loading ...