Design Results for GBP3

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size80Maximal Amplicon Size150
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size1000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 9 To Exon 10 (Pair 1)
Forward (1737,22)TTCAGAAGCTACAAGACCTGGAAmplicon SizecDNA: 98 bpgenomic: 1,507
Reverse (1834,23)CTCCTTGGATTTCAAGTATGTCTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.701 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.328 kcal/mol
Forward-Reverse Dimers-1.718 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATACAGG
CTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002053 (GBP1)981530 - 1627
NM_018284 (GBP3)981509 - 1606
Exon 9 To Exon 10 (Pair 2)
Forward (1739,21)CAGAAGCTACAAGACCTGGAGAmplicon SizecDNA: 96 bpgenomic: 1,505
Reverse (1834,23)CTCCTTGGATTTCAAGTATGTCTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.174 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.328 kcal/mol
Forward-Reverse Dimers-1.718 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATACAGGCT
GAAGAGATTCTGCAGACATACTTGAAATCCAAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)961511 - 1606
NM_002053 (GBP1)961532 - 1627
Exon 9 To Exon 10 (Pair 3)
Forward (1734,23)TTATTCAGAAGCTACAAGACCTGAmplicon SizecDNA: 102 bpgenomic: 1,511
Reverse (1835,23)ACTCCTTGGATTTCAAGTATGTCNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.712 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.795 kcal/mol
Forward-Reverse Dimers-1.718 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceTTATTCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATAC
AGGCTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002053 (GBP1)1021527 - 1628
NM_018284 (GBP3)1021506 - 1607
Exon 9 To Exon 10 (Pair 4)
Forward (1736,22)ATTCAGAAGCTACAAGACCTGGAmplicon SizecDNA: 100 bpgenomic: 1,509
Reverse (1835,23)ACTCCTTGGATTTCAAGTATGTCNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.701 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.795 kcal/mol
Forward-Reverse Dimers-1.718 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceATTCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATACAG
GCTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)1001508 - 1607
NM_002053 (GBP1)991530 - 1628
Exon 9 To Exon 10 (Pair 5)
Forward (1736,22)ATTCAGAAGCTACAAGACCTGGAmplicon SizecDNA: 99 bpgenomic: 1,508
Reverse (1834,23)CTCCTTGGATTTCAAGTATGTCTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.701 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.328 kcal/mol
Forward-Reverse Dimers-1.718 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceATTCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATACAG
GCTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)991508 - 1606
NM_002053 (GBP1)981530 - 1627
Exon 9 To Exon 10 (Pair 6)
Forward (1734,23)TTATTCAGAAGCTACAAGACCTGAmplicon SizecDNA: 101 bpgenomic: 1,510
Reverse (1834,23)CTCCTTGGATTTCAAGTATGTCTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.712 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.328 kcal/mol
Forward-Reverse Dimers-1.718 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceTTATTCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATAC
AGGCTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002053 (GBP1)1011527 - 1627
NM_018284 (GBP3)1011506 - 1606
Exon 9 To Exon 10 (Pair 7)
Forward (1737,22)TTCAGAAGCTACAAGACCTGGAAmplicon SizecDNA: 99 bpgenomic: 1,508
Reverse (1835,23)ACTCCTTGGATTTCAAGTATGTCNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.701 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.638 kcal/mol
Reverse Dimers-0.795 kcal/mol
Forward-Reverse Dimers-1.718 kcal/mol
Amplicon Folding-0.753 kcal/mol outside primersite
Amplicon SequenceTTCAGAAGCTACAAGACCTGGAGAAAAAGTACTATGAGGAACCAAGGAAGGGGATACAGG
CTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018284 (GBP3)991509 - 1607
NM_002053 (GBP1)991530 - 1628
 

See below for some more details.

Program Output:

Loading ...