Design Results for GLYAT

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 4 (Pair 1)
Forward (210,20)AGGAAGAGCCTCCCAGCATCAmplicon SizecDNA: 188 bpgenomic: 11,609
Reverse (397,24)TTGGAGTAGATTTGGTAAGTATTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.226 kcal/mol
Forward Dimers-1.347 kcal/mol
Reverse Loops1.471 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.376 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAGGAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGA
AATCCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTC
TGCCCTCAGGAGCAGGATATGACAGATGACCTTGATCACTATACCAATACTTACCAAATC
TACTCCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201648 (GLYAT)188210 - 397
NM_005838 (GLYAT)188210 - 397
Exon 2 To Exon 3 (Pair 1)
Forward (215,21)GAGCCTCCCAGCATCCTTAAAAmplicon SizecDNA: 124 bpgenomic: 9,116
Reverse (338,20)CTGAGGGCAGACAACCACTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.704 kcal/mol
Reverse Dimers-1.084 kcal/mol
Forward-Reverse Dimers-2.093 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAATCC
ATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGCCC
TCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201648 (GLYAT)124215 - 338
NM_005838 (GLYAT)124215 - 338
Exon 2 To Exon 3 (Pair 2)
Forward (212,20)GAAGAGCCTCCCAGCATCCTAmplicon SizecDNA: 127 bpgenomic: 9,119
Reverse (338,20)CTGAGGGCAGACAACCACTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.704 kcal/mol
Reverse Dimers-1.084 kcal/mol
Forward-Reverse Dimers-2.093 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceGAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAA
TCCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTG
CCCTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)127212 - 338
NM_201648 (GLYAT)127212 - 338
Exon 2 To Exon 3 (Pair 3)
Forward (214,21)AGAGCCTCCCAGCATCCTTAAAmplicon SizecDNA: 125 bpgenomic: 9,117
Reverse (338,20)CTGAGGGCAGACAACCACTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.704 kcal/mol
Reverse Dimers-1.084 kcal/mol
Forward-Reverse Dimers-2.093 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAATC
CATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGCC
CTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)125214 - 338
NM_201648 (GLYAT)125214 - 338
Exon 2 To Exon 4 (Pair 2)
Forward (214,21)AGAGCCTCCCAGCATCCTTAAAmplicon SizecDNA: 184 bpgenomic: 11,605
Reverse (397,24)TTGGAGTAGATTTGGTAAGTATTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.471 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.376 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAATC
CATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGCC
CTCAGGAGCAGGATATGACAGATGACCTTGATCACTATACCAATACTTACCAAATCTACT
CCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201648 (GLYAT)184214 - 397
NM_005838 (GLYAT)184214 - 397
Exon 2 To Exon 3 (Pair 4)
Forward (214,21)AGAGCCTCCCAGCATCCTTAAAmplicon SizecDNA: 130 bpgenomic: 9,122
Reverse (343,20)TGCTCCTGAGGGCAGACAACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.241 kcal/mol
Reverse Dimers-1.786 kcal/mol
Forward-Reverse Dimers-2.384 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAATC
CATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGCC
CTCAGGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201648 (GLYAT)130214 - 343
NM_005838 (GLYAT)130214 - 343
Exon 2 To Exon 4 (Pair 3)
Forward (213,21)AAGAGCCTCCCAGCATCCTTAAmplicon SizecDNA: 188 bpgenomic: 11,609
Reverse (400,24)TCTTTGGAGTAGATTTGGTAAGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.924 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.376 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAAT
CCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGC
CCTCAGGAGCAGGATATGACAGATGACCTTGATCACTATACCAATACTTACCAAATCTAC
TCCAAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201648 (GLYAT)188213 - 400
NM_005838 (GLYAT)188213 - 400
Exon 2 To Exon 3 (Pair 5)
Forward (214,21)AGAGCCTCCCAGCATCCTTAAAmplicon SizecDNA: 128 bpgenomic: 9,120
Reverse (341,20)CTCCTGAGGGCAGACAACCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.493 kcal/mol
Reverse Dimers-1.786 kcal/mol
Forward-Reverse Dimers-2.093 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAATC
CATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGCC
CTCAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201648 (GLYAT)128214 - 341
NM_005838 (GLYAT)128214 - 341
Exon 2 To Exon 3 (Pair 6)
Forward (213,21)AAGAGCCTCCCAGCATCCTTAAmplicon SizecDNA: 131 bpgenomic: 9,123
Reverse (343,20)TGCTCCTGAGGGCAGACAACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.241 kcal/mol
Reverse Dimers-1.786 kcal/mol
Forward-Reverse Dimers-2.384 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAAT
CCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGC
CCTCAGGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)131213 - 343
NM_201648 (GLYAT)131213 - 343
Exon 2 To Exon 4 (Pair 4)
Forward (212,20)GAAGAGCCTCCCAGCATCCTAmplicon SizecDNA: 190 bpgenomic: 11,611
Reverse (401,24)ATCTTTGGAGTAGATTTGGTAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.924 kcal/mol
Reverse Dimers-0.775 kcal/mol
Forward-Reverse Dimers-1.44 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceGAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAA
TCCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTG
CCCTCAGGAGCAGGATATGACAGATGACCTTGATCACTATACCAATACTTACCAAATCTA
CTCCAAAGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)190212 - 401
NM_201648 (GLYAT)190212 - 401
Exon 2 To Exon 4 (Pair 5)
Forward (214,21)AGAGCCTCCCAGCATCCTTAAAmplicon SizecDNA: 186 bpgenomic: 11,607
Reverse (399,24)CTTTGGAGTAGATTTGGTAAGTATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.924 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.376 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAATC
CATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGCC
CTCAGGAGCAGGATATGACAGATGACCTTGATCACTATACCAATACTTACCAAATCTACT
CCAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201648 (GLYAT)186214 - 399
NM_005838 (GLYAT)186214 - 399
Exon 2 To Exon 3 (Pair 7)
Forward (212,20)GAAGAGCCTCCCAGCATCCTAmplicon SizecDNA: 123 bpgenomic: 9,115
Reverse (334,22)GGGCAGACAACCACTGTATTAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.41 kcal/mol
Reverse Dimers-1.073 kcal/mol
Forward-Reverse Dimers-2.076 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceGAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAA
TCCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTG
CCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201648 (GLYAT)123212 - 334
NM_005838 (GLYAT)123212 - 334
Exon 2 To Exon 4 (Pair 6)
Forward (212,20)GAAGAGCCTCCCAGCATCCTAmplicon SizecDNA: 192 bpgenomic: 11,613
Reverse (403,23)GGATCTTTGGAGTAGATTTGGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.423 kcal/mol
Reverse Dimers-1.338 kcal/mol
Forward-Reverse Dimers-2.604 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceGAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAA
TCCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTG
CCCTCAGGAGCAGGATATGACAGATGACCTTGATCACTATACCAATACTTACCAAATCTA
CTCCAAAGATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)192212 - 403
NM_201648 (GLYAT)192212 - 403
Exon 2 To Exon 4 (Pair 7)
Forward (215,21)GAGCCTCCCAGCATCCTTAAAAmplicon SizecDNA: 185 bpgenomic: 11,606
Reverse (399,24)CTTTGGAGTAGATTTGGTAAGTATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.924 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.376 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAATCC
ATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGCCC
TCAGGAGCAGGATATGACAGATGACCTTGATCACTATACCAATACTTACCAAATCTACTC
CAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201648 (GLYAT)185215 - 399
NM_005838 (GLYAT)185215 - 399
Exon 2 To Exon 3 (Pair 8)
Forward (210,20)AGGAAGAGCCTCCCAGCATCAmplicon SizecDNA: 129 bpgenomic: 9,121
Reverse (338,20)CTGAGGGCAGACAACCACTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.226 kcal/mol
Forward Dimers-1.347 kcal/mol
Reverse Loops0.704 kcal/mol
Reverse Dimers-1.084 kcal/mol
Forward-Reverse Dimers-2.093 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAGGAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGA
AATCCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTC
TGCCCTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)129210 - 338
NM_201648 (GLYAT)129210 - 338
Exon 2 To Exon 3 (Pair 9)
Forward (212,20)GAAGAGCCTCCCAGCATCCTAmplicon SizecDNA: 129 bpgenomic: 9,121
Reverse (340,20)TCCTGAGGGCAGACAACCACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.493 kcal/mol
Reverse Dimers-1.756 kcal/mol
Forward-Reverse Dimers-2.093 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceGAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAA
TCCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTG
CCCTCAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201648 (GLYAT)129212 - 340
NM_005838 (GLYAT)129212 - 340
Exon 2 To Exon 4 (Pair 8)
Forward (215,21)GAGCCTCCCAGCATCCTTAAAAmplicon SizecDNA: 187 bpgenomic: 11,608
Reverse (401,24)ATCTTTGGAGTAGATTTGGTAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.924 kcal/mol
Reverse Dimers-0.775 kcal/mol
Forward-Reverse Dimers-1.376 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAATCC
ATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGCCC
TCAGGAGCAGGATATGACAGATGACCTTGATCACTATACCAATACTTACCAAATCTACTC
CAAAGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)187215 - 401
NM_201648 (GLYAT)187215 - 401
Exon 2 To Exon 4 (Pair 9)
Forward (212,20)GAAGAGCCTCCCAGCATCCTAmplicon SizecDNA: 188 bpgenomic: 11,609
Reverse (399,24)CTTTGGAGTAGATTTGGTAAGTATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.924 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.376 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceGAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAA
TCCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTG
CCCTCAGGAGCAGGATATGACAGATGACCTTGATCACTATACCAATACTTACCAAATCTA
CTCCAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201648 (GLYAT)188212 - 399
NM_005838 (GLYAT)188212 - 399
Exon 2 To Exon 4 (Pair 10)
Forward (213,21)AAGAGCCTCCCAGCATCCTTAAmplicon SizecDNA: 187 bpgenomic: 11,608
Reverse (399,24)CTTTGGAGTAGATTTGGTAAGTATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.924 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.376 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAAT
CCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGC
CCTCAGGAGCAGGATATGACAGATGACCTTGATCACTATACCAATACTTACCAAATCTAC
TCCAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)187213 - 399
NM_201648 (GLYAT)187213 - 399
Exon 2 To Exon 4 (Pair 11)
Forward (215,21)GAGCCTCCCAGCATCCTTAAAAmplicon SizecDNA: 186 bpgenomic: 11,607
Reverse (400,24)TCTTTGGAGTAGATTTGGTAAGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.924 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.376 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAATCC
ATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGCCC
TCAGGAGCAGGATATGACAGATGACCTTGATCACTATACCAATACTTACCAAATCTACTC
CAAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201648 (GLYAT)186215 - 400
NM_005838 (GLYAT)186215 - 400
Exon 2 To Exon 3 (Pair 10)
Forward (213,21)AAGAGCCTCCCAGCATCCTTAAmplicon SizecDNA: 127 bpgenomic: 9,119
Reverse (339,20)CCTGAGGGCAGACAACCACTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.493 kcal/mol
Reverse Dimers-1.295 kcal/mol
Forward-Reverse Dimers-2.093 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAAT
CCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGC
CCTCAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)127213 - 339
NM_201648 (GLYAT)127213 - 339
Exon 2 To Exon 4 (Pair 12)
Forward (210,20)AGGAAGAGCCTCCCAGCATCAmplicon SizecDNA: 194 bpgenomic: 11,615
Reverse (403,23)GGATCTTTGGAGTAGATTTGGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.226 kcal/mol
Forward Dimers-1.347 kcal/mol
Reverse Loops1.423 kcal/mol
Reverse Dimers-1.338 kcal/mol
Forward-Reverse Dimers-2.604 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAGGAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGA
AATCCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTC
TGCCCTCAGGAGCAGGATATGACAGATGACCTTGATCACTATACCAATACTTACCAAATC
TACTCCAAAGATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201648 (GLYAT)194210 - 403
NM_005838 (GLYAT)194210 - 403
Exon 2 To Exon 4 (Pair 13)
Forward (215,21)GAGCCTCCCAGCATCCTTAAAAmplicon SizecDNA: 189 bpgenomic: 11,610
Reverse (403,23)GGATCTTTGGAGTAGATTTGGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.423 kcal/mol
Reverse Dimers-1.338 kcal/mol
Forward-Reverse Dimers-1.605 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAATCC
ATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGCCC
TCAGGAGCAGGATATGACAGATGACCTTGATCACTATACCAATACTTACCAAATCTACTC
CAAAGATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)189215 - 403
NM_201648 (GLYAT)189215 - 403
Exon 2 To Exon 4 (Pair 14)
Forward (214,21)AGAGCCTCCCAGCATCCTTAAAmplicon SizecDNA: 188 bpgenomic: 11,609
Reverse (401,24)ATCTTTGGAGTAGATTTGGTAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.924 kcal/mol
Reverse Dimers-0.775 kcal/mol
Forward-Reverse Dimers-1.376 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAATC
CATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGCC
CTCAGGAGCAGGATATGACAGATGACCTTGATCACTATACCAATACTTACCAAATCTACT
CCAAAGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)188214 - 401
NM_201648 (GLYAT)188214 - 401
Exon 2 To Exon 3 (Pair 11)
Forward (210,20)AGGAAGAGCCTCCCAGCATCAmplicon SizecDNA: 130 bpgenomic: 9,122
Reverse (339,20)CCTGAGGGCAGACAACCACTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.226 kcal/mol
Forward Dimers-1.347 kcal/mol
Reverse Loops0.493 kcal/mol
Reverse Dimers-1.295 kcal/mol
Forward-Reverse Dimers-2.093 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAGGAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGA
AATCCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTC
TGCCCTCAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201648 (GLYAT)130210 - 339
NM_005838 (GLYAT)130210 - 339
Exon 2 To Exon 3 (Pair 12)
Forward (214,21)AGAGCCTCCCAGCATCCTTAAAmplicon SizecDNA: 121 bpgenomic: 9,113
Reverse (334,22)GGGCAGACAACCACTGTATTAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.41 kcal/mol
Reverse Dimers-1.073 kcal/mol
Forward-Reverse Dimers-2.076 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAATC
CATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGCC
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)121214 - 334
NM_201648 (GLYAT)121214 - 334
Exon 2 To Exon 4 (Pair 15)
Forward (213,21)AAGAGCCTCCCAGCATCCTTAAmplicon SizecDNA: 189 bpgenomic: 11,610
Reverse (401,24)ATCTTTGGAGTAGATTTGGTAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.924 kcal/mol
Reverse Dimers-0.775 kcal/mol
Forward-Reverse Dimers-1.376 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAAT
CCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGC
CCTCAGGAGCAGGATATGACAGATGACCTTGATCACTATACCAATACTTACCAAATCTAC
TCCAAAGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201648 (GLYAT)189213 - 401
NM_005838 (GLYAT)189213 - 401
Exon 2 To Exon 3 (Pair 13)
Forward (214,21)AGAGCCTCCCAGCATCCTTAAAmplicon SizecDNA: 127 bpgenomic: 9,119
Reverse (340,20)TCCTGAGGGCAGACAACCACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.493 kcal/mol
Reverse Dimers-1.756 kcal/mol
Forward-Reverse Dimers-2.093 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAATC
CATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGCC
CTCAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)127214 - 340
NM_201648 (GLYAT)127214 - 340
Exon 2 To Exon 4 (Pair 16)
Forward (213,21)AAGAGCCTCCCAGCATCCTTAAmplicon SizecDNA: 191 bpgenomic: 11,612
Reverse (403,23)GGATCTTTGGAGTAGATTTGGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.423 kcal/mol
Reverse Dimers-1.338 kcal/mol
Forward-Reverse Dimers-2.137 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAAT
CCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGC
CCTCAGGAGCAGGATATGACAGATGACCTTGATCACTATACCAATACTTACCAAATCTAC
TCCAAAGATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)191213 - 403
NM_201648 (GLYAT)191213 - 403
Exon 2 To Exon 3 (Pair 14)
Forward (215,21)GAGCCTCCCAGCATCCTTAAAAmplicon SizecDNA: 127 bpgenomic: 9,119
Reverse (341,20)CTCCTGAGGGCAGACAACCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.493 kcal/mol
Reverse Dimers-1.786 kcal/mol
Forward-Reverse Dimers-2.093 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAATCC
ATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGCCC
TCAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201648 (GLYAT)127215 - 341
NM_005838 (GLYAT)127215 - 341
Exon 2 To Exon 4 (Pair 17)
Forward (212,20)GAAGAGCCTCCCAGCATCCTAmplicon SizecDNA: 186 bpgenomic: 11,607
Reverse (397,24)TTGGAGTAGATTTGGTAAGTATTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.471 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.376 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceGAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAA
TCCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTG
CCCTCAGGAGCAGGATATGACAGATGACCTTGATCACTATACCAATACTTACCAAATCTA
CTCCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)186212 - 397
NM_201648 (GLYAT)186212 - 397
Exon 2 To Exon 4 (Pair 18)
Forward (210,20)AGGAAGAGCCTCCCAGCATCAmplicon SizecDNA: 190 bpgenomic: 11,611
Reverse (399,24)CTTTGGAGTAGATTTGGTAAGTATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.226 kcal/mol
Forward Dimers-1.347 kcal/mol
Reverse Loops1.924 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.376 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAGGAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGA
AATCCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTC
TGCCCTCAGGAGCAGGATATGACAGATGACCTTGATCACTATACCAATACTTACCAAATC
TACTCCAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201648 (GLYAT)190210 - 399
NM_005838 (GLYAT)190210 - 399
Exon 2 To Exon 3 (Pair 15)
Forward (214,21)AGAGCCTCCCAGCATCCTTAAAmplicon SizecDNA: 126 bpgenomic: 9,118
Reverse (339,20)CCTGAGGGCAGACAACCACTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.493 kcal/mol
Reverse Dimers-1.295 kcal/mol
Forward-Reverse Dimers-2.093 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAATC
CATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGCC
CTCAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201648 (GLYAT)126214 - 339
NM_005838 (GLYAT)126214 - 339
Exon 2 To Exon 3 (Pair 16)
Forward (213,21)AAGAGCCTCCCAGCATCCTTAAmplicon SizecDNA: 126 bpgenomic: 9,118
Reverse (338,20)CTGAGGGCAGACAACCACTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.704 kcal/mol
Reverse Dimers-1.084 kcal/mol
Forward-Reverse Dimers-2.093 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAAT
CCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGC
CCTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)126213 - 338
NM_201648 (GLYAT)126213 - 338
Exon 2 To Exon 3 (Pair 17)
Forward (210,20)AGGAAGAGCCTCCCAGCATCAmplicon SizecDNA: 131 bpgenomic: 9,123
Reverse (340,20)TCCTGAGGGCAGACAACCACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.226 kcal/mol
Forward Dimers-1.347 kcal/mol
Reverse Loops0.493 kcal/mol
Reverse Dimers-1.756 kcal/mol
Forward-Reverse Dimers-2.093 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAGGAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGA
AATCCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTC
TGCCCTCAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)131210 - 340
NM_201648 (GLYAT)131210 - 340
Exon 2 To Exon 3 (Pair 18)
Forward (210,20)AGGAAGAGCCTCCCAGCATCAmplicon SizecDNA: 83 bpgenomic: 9,075
Reverse (292,23)ACAGCCTTCAGATTGAATGGATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.226 kcal/mol
Forward Dimers-1.347 kcal/mol
Reverse Loops1.468 kcal/mol
Reverse Dimers-0.401 kcal/mol
Forward-Reverse Dimers-1.802 kcal/mol
Amplicon Folding-0.995 kcal/mol outside primersite
Amplicon SequenceAGGAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGA
AATCCATTCAATCTGAAGGCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)83210 - 292
NM_201648 (GLYAT)83210 - 292
Exon 2 To Exon 4 (Pair 19)
Forward (214,21)AGAGCCTCCCAGCATCCTTAAAmplicon SizecDNA: 187 bpgenomic: 11,608
Reverse (400,24)TCTTTGGAGTAGATTTGGTAAGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.924 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.376 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAATC
CATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGCC
CTCAGGAGCAGGATATGACAGATGACCTTGATCACTATACCAATACTTACCAAATCTACT
CCAAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201648 (GLYAT)187214 - 400
NM_005838 (GLYAT)187214 - 400
Exon 2 To Exon 4 (Pair 20)
Forward (212,20)GAAGAGCCTCCCAGCATCCTAmplicon SizecDNA: 189 bpgenomic: 11,610
Reverse (400,24)TCTTTGGAGTAGATTTGGTAAGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.924 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.401 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceGAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAA
TCCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTG
CCCTCAGGAGCAGGATATGACAGATGACCTTGATCACTATACCAATACTTACCAAATCTA
CTCCAAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201648 (GLYAT)189212 - 400
NM_005838 (GLYAT)189212 - 400
Exon 2 To Exon 3 (Pair 19)
Forward (213,21)AAGAGCCTCCCAGCATCCTTAAmplicon SizecDNA: 129 bpgenomic: 9,121
Reverse (341,20)CTCCTGAGGGCAGACAACCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.493 kcal/mol
Reverse Dimers-1.786 kcal/mol
Forward-Reverse Dimers-2.093 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAAT
CCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGC
CCTCAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)129213 - 341
NM_201648 (GLYAT)129213 - 341
Exon 2 To Exon 3 (Pair 20)
Forward (210,20)AGGAAGAGCCTCCCAGCATCAmplicon SizecDNA: 125 bpgenomic: 9,117
Reverse (334,22)GGGCAGACAACCACTGTATTAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.226 kcal/mol
Forward Dimers-1.347 kcal/mol
Reverse Loops0.41 kcal/mol
Reverse Dimers-1.073 kcal/mol
Forward-Reverse Dimers-2.076 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAGGAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGA
AATCCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTC
TGCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)125210 - 334
NM_201648 (GLYAT)125210 - 334
Exon 2 To Exon 3 (Pair 21)
Forward (213,21)AAGAGCCTCCCAGCATCCTTAAmplicon SizecDNA: 128 bpgenomic: 9,120
Reverse (340,20)TCCTGAGGGCAGACAACCACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.493 kcal/mol
Reverse Dimers-1.756 kcal/mol
Forward-Reverse Dimers-2.093 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAAT
CCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGC
CCTCAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201648 (GLYAT)128213 - 340
NM_005838 (GLYAT)128213 - 340
Exon 2 To Exon 3 (Pair 22)
Forward (215,21)GAGCCTCCCAGCATCCTTAAAAmplicon SizecDNA: 129 bpgenomic: 9,121
Reverse (343,20)TGCTCCTGAGGGCAGACAACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.241 kcal/mol
Reverse Dimers-1.786 kcal/mol
Forward-Reverse Dimers-2.384 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAATCC
ATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGCCC
TCAGGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)129215 - 343
NM_201648 (GLYAT)129215 - 343
Exon 2 To Exon 4 (Pair 21)
Forward (213,21)AAGAGCCTCCCAGCATCCTTAAmplicon SizecDNA: 185 bpgenomic: 11,606
Reverse (397,24)TTGGAGTAGATTTGGTAAGTATTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.471 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.376 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAAT
CCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGC
CCTCAGGAGCAGGATATGACAGATGACCTTGATCACTATACCAATACTTACCAAATCTAC
TCCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)185213 - 397
NM_201648 (GLYAT)185213 - 397
Exon 2 To Exon 4 (Pair 22)
Forward (210,20)AGGAAGAGCCTCCCAGCATCAmplicon SizecDNA: 192 bpgenomic: 11,613
Reverse (401,24)ATCTTTGGAGTAGATTTGGTAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.226 kcal/mol
Forward Dimers-1.347 kcal/mol
Reverse Loops1.924 kcal/mol
Reverse Dimers-0.775 kcal/mol
Forward-Reverse Dimers-1.44 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAGGAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGA
AATCCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTC
TGCCCTCAGGAGCAGGATATGACAGATGACCTTGATCACTATACCAATACTTACCAAATC
TACTCCAAAGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)192210 - 401
NM_201648 (GLYAT)192210 - 401
Exon 2 To Exon 3 (Pair 23)
Forward (212,20)GAAGAGCCTCCCAGCATCCTAmplicon SizecDNA: 130 bpgenomic: 9,122
Reverse (341,20)CTCCTGAGGGCAGACAACCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.493 kcal/mol
Reverse Dimers-1.786 kcal/mol
Forward-Reverse Dimers-2.093 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceGAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAA
TCCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTG
CCCTCAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)130212 - 341
NM_201648 (GLYAT)130212 - 341
Exon 2 To Exon 3 (Pair 24)
Forward (210,20)AGGAAGAGCCTCCCAGCATCAmplicon SizecDNA: 132 bpgenomic: 9,124
Reverse (341,20)CTCCTGAGGGCAGACAACCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.226 kcal/mol
Forward Dimers-1.347 kcal/mol
Reverse Loops0.493 kcal/mol
Reverse Dimers-1.786 kcal/mol
Forward-Reverse Dimers-2.093 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAGGAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGA
AATCCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTC
TGCCCTCAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201648 (GLYAT)132210 - 341
NM_005838 (GLYAT)132210 - 341
Exon 2 To Exon 3 (Pair 25)
Forward (212,20)GAAGAGCCTCCCAGCATCCTAmplicon SizecDNA: 128 bpgenomic: 9,120
Reverse (339,20)CCTGAGGGCAGACAACCACTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.493 kcal/mol
Reverse Dimers-1.295 kcal/mol
Forward-Reverse Dimers-2.093 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceGAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAA
TCCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTG
CCCTCAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201648 (GLYAT)128212 - 339
NM_005838 (GLYAT)128212 - 339
Exon 2 To Exon 3 (Pair 26)
Forward (215,21)GAGCCTCCCAGCATCCTTAAAAmplicon SizecDNA: 126 bpgenomic: 9,118
Reverse (340,20)TCCTGAGGGCAGACAACCACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.493 kcal/mol
Reverse Dimers-1.756 kcal/mol
Forward-Reverse Dimers-2.093 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAATCC
ATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGCCC
TCAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)126215 - 340
NM_201648 (GLYAT)126215 - 340
Exon 2 To Exon 4 (Pair 23)
Forward (210,20)AGGAAGAGCCTCCCAGCATCAmplicon SizecDNA: 191 bpgenomic: 11,612
Reverse (400,24)TCTTTGGAGTAGATTTGGTAAGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.226 kcal/mol
Forward Dimers-1.347 kcal/mol
Reverse Loops1.924 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.401 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAGGAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGA
AATCCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTC
TGCCCTCAGGAGCAGGATATGACAGATGACCTTGATCACTATACCAATACTTACCAAATC
TACTCCAAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201648 (GLYAT)191210 - 400
NM_005838 (GLYAT)191210 - 400
Exon 2 To Exon 3 (Pair 27)
Forward (215,21)GAGCCTCCCAGCATCCTTAAAAmplicon SizecDNA: 120 bpgenomic: 9,112
Reverse (334,22)GGGCAGACAACCACTGTATTAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.41 kcal/mol
Reverse Dimers-1.073 kcal/mol
Forward-Reverse Dimers-2.076 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAATCC
ATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201648 (GLYAT)120215 - 334
NM_005838 (GLYAT)120215 - 334
Exon 2 To Exon 3 (Pair 28)
Forward (213,21)AAGAGCCTCCCAGCATCCTTAAmplicon SizecDNA: 122 bpgenomic: 9,114
Reverse (334,22)GGGCAGACAACCACTGTATTAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.41 kcal/mol
Reverse Dimers-1.073 kcal/mol
Forward-Reverse Dimers-2.076 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceAAGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAAT
CCATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGC
CC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)122213 - 334
NM_201648 (GLYAT)122213 - 334
Exon 2 To Exon 4 (Pair 24)
Forward (215,21)GAGCCTCCCAGCATCCTTAAAAmplicon SizecDNA: 183 bpgenomic: 11,604
Reverse (397,24)TTGGAGTAGATTTGGTAAGTATTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.471 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.376 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAATCC
ATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGCCC
TCAGGAGCAGGATATGACAGATGACCTTGATCACTATACCAATACTTACCAAATCTACTC
CAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201648 (GLYAT)183215 - 397
NM_005838 (GLYAT)183215 - 397
Exon 2 To Exon 3 (Pair 29)
Forward (215,21)GAGCCTCCCAGCATCCTTAAAAmplicon SizecDNA: 125 bpgenomic: 9,117
Reverse (339,20)CCTGAGGGCAGACAACCACTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.231 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.493 kcal/mol
Reverse Dimers-1.295 kcal/mol
Forward-Reverse Dimers-2.093 kcal/mol
Amplicon Folding-1.313 kcal/mol outside primersite
Amplicon SequenceGAGCCTCCCAGCATCCTTAAAGGTTTATGGAACTGTCTTTCACATAAACCATGGAAATCC
ATTCAATCTGAAGGCTGTGGTGGACAAGTGGCCTGATTTTAATACAGTGGTTGTCTGCCC
TCAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005838 (GLYAT)125215 - 339
NM_201648 (GLYAT)125215 - 339
 

See below for some more details.

Program Output:

Loading ...