Design Results for GRB10

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 7 To Exon 8 (Pair 1)
Forward (974,21)GGAGGAAGACCAGCAGTTTAGAmplicon SizecDNA: 176 bpgenomic: 42,919
Reverse (1149,21)CCACCACTTTGCTTGTCCCATNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol in 3' area
Forward Dimers-0.893 kcal/mol
Reverse Loops2.072 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGGAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGA
ACTCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGC
CGCCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001555 (GRB10)176730 - 905
NM_001001549 (GRB10)176403 - 578
NM_001001550 (GRB10)176483 - 658
NM_005311 (GRB10)176403 - 578
Exon 7 To Exon 8 (Pair 2)
Forward (975,22)GAGGAAGACCAGCAGTTTAGAAAmplicon SizecDNA: 169 bpgenomic: 42,912
Reverse (1143,22)CTTTGCTTGTCCCATCTTCACTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.893 kcal/mol
Reverse Loops2.696 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAA
CTCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCC
GCCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001555 (GRB10)169731 - 899
NM_001001549 (GRB10)169404 - 572
NM_001001550 (GRB10)169484 - 652
NM_005311 (GRB10)169404 - 572
Exon 7 To Exon 8 (Pair 3)
Forward (975,22)GAGGAAGACCAGCAGTTTAGAAAmplicon SizecDNA: 257 bpgenomic: 43,000
Reverse (1231,21)GTCCAGCTGTTGTCATCCACANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.893 kcal/mol
Reverse Loops1.422 kcal/mol in 3' area
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAA
CTCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCC
GCCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATT
CTAGCAGACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTG
GATGACAACAGCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001555 (GRB10)257731 - 987
NM_001001549 (GRB10)257404 - 660
NM_001001550 (GRB10)257484 - 740
NM_005311 (GRB10)257404 - 660
Exon 7 To Exon 8 (Pair 4)
Forward (979,22)AAGACCAGCAGTTTAGAACCTCAmplicon SizecDNA: 167 bpgenomic: 42,910
Reverse (1145,22)CACTTTGCTTGTCCCATCTTCANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.072 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCT
GTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCG
CAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001549 (GRB10)167408 - 574
NM_001001555 (GRB10)167735 - 901
NM_001001550 (GRB10)167488 - 654
NM_005311 (GRB10)167408 - 574
Exon 7 To Exon 8 (Pair 5)
Forward (983,22)CCAGCAGTTTAGAACCTCATCTAmplicon SizecDNA: 160 bpgenomic: 42,903
Reverse (1142,23)TTTGCTTGTCCCATCTTCACTAANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.729 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.696 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceCCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGG
CCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAA
GCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001555 (GRB10)160739 - 898
NM_001001549 (GRB10)160412 - 571
NM_005311 (GRB10)160412 - 571
NM_001001550 (GRB10)160492 - 651
Exon 7 To Exon 8 (Pair 6)
Forward (982,22)ACCAGCAGTTTAGAACCTCATCAmplicon SizecDNA: 250 bpgenomic: 42,993
Reverse (1231,21)GTCCAGCTGTTGTCATCCACANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.369 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.422 kcal/mol in 3' area
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTG
GCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAA
AGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAGCAG
ACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATGACA
ACAGCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001555 (GRB10)250738 - 987
NM_001001549 (GRB10)250411 - 660
NM_005311 (GRB10)250411 - 660
NM_001001550 (GRB10)250491 - 740
Exon 7 To Exon 8 (Pair 7)
Forward (979,22)AAGACCAGCAGTTTAGAACCTCAmplicon SizecDNA: 256 bpgenomic: 42,999
Reverse (1234,21)AGTGTCCAGCTGTTGTCATCCNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.483 kcal/mol
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCT
GTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCG
CAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAG
CAGACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATG
ACAACAGCTGGACACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001555 (GRB10)256735 - 990
NM_001001549 (GRB10)256408 - 663
NM_001001550 (GRB10)256488 - 743
NM_005311 (GRB10)256408 - 663
Exon 7 To Exon 8 (Pair 8)
Forward (987,22)CAGTTTAGAACCTCATCTCTGCAmplicon SizecDNA: 163 bpgenomic: 42,906
Reverse (1149,21)CCACCACTTTGCTTGTCCCATNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol in 3' area
Forward Dimers-0.399 kcal/mol
Reverse Loops2.072 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.72 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCCT
GGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCAG
GATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001555 (GRB10)163743 - 905
NM_001001549 (GRB10)163416 - 578
NM_001001550 (GRB10)163496 - 658
NM_005311 (GRB10)163416 - 578
Exon 7 To Exon 8 (Pair 9)
Forward (980,22)AGACCAGCAGTTTAGAACCTCAAmplicon SizecDNA: 253 bpgenomic: 42,996
Reverse (1232,21)TGTCCAGCTGTTGTCATCCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTG
TGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGC
AAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAGC
AGACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATGA
CAACAGCTGGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001555 (GRB10)253736 - 988
NM_001001549 (GRB10)253409 - 661
NM_005311 (GRB10)253409 - 661
NM_001001550 (GRB10)253489 - 741
Exon 7 To Exon 8 (Pair 10)
Forward (987,22)CAGTTTAGAACCTCATCTCTGCAmplicon SizecDNA: 172 bpgenomic: 42,915
Reverse (1158,22)CTAGAATCTCCACCACTTTGCTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol in 3' area
Forward Dimers-0.399 kcal/mol
Reverse Loops2.069 kcal/mol
Reverse Dimers-0.916 kcal/mol
Forward-Reverse Dimers-1.72 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCCT
GGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCAG
GATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001549 (GRB10)172416 - 587
NM_001001555 (GRB10)172743 - 914
NM_001001550 (GRB10)172496 - 667
NM_005311 (GRB10)172416 - 587
Exon 7 To Exon 8 (Pair 11)
Forward (986,22)GCAGTTTAGAACCTCATCTCTGAmplicon SizecDNA: 159 bpgenomic: 42,902
Reverse (1144,22)ACTTTGCTTGTCCCATCTTCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol in 3' area
Forward Dimers-0.399 kcal/mol
Reverse Loops2.546 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.246 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCC
TGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCA
GGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)159415 - 573
NM_001001550 (GRB10)159495 - 653
NM_001001555 (GRB10)159742 - 900
NM_001001549 (GRB10)159415 - 573
Exon 7 To Exon 8 (Pair 12)
Forward (984,22)CAGCAGTTTAGAACCTCATCTCAmplicon SizecDNA: 248 bpgenomic: 42,991
Reverse (1231,21)GTCCAGCTGTTGTCATCCACANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.422 kcal/mol in 3' area
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.028 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGC
CCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAG
CAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAGCAGAC
ATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATGACAAC
AGCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001549 (GRB10)248413 - 660
NM_001001555 (GRB10)248740 - 987
NM_001001550 (GRB10)248493 - 740
NM_005311 (GRB10)248413 - 660
Exon 7 To Exon 8 (Pair 13)
Forward (974,21)GGAGGAAGACCAGCAGTTTAGAmplicon SizecDNA: 258 bpgenomic: 43,001
Reverse (1231,21)GTCCAGCTGTTGTCATCCACANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol in 3' area
Forward Dimers-0.893 kcal/mol
Reverse Loops1.422 kcal/mol in 3' area
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGGAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGA
ACTCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGC
CGCCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGAT
TCTAGCAGACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGT
GGATGACAACAGCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)258403 - 660
NM_001001550 (GRB10)258483 - 740
NM_001001549 (GRB10)258403 - 660
NM_001001555 (GRB10)258730 - 987
Exon 7 To Exon 8 (Pair 14)
Forward (984,22)CAGCAGTTTAGAACCTCATCTCAmplicon SizecDNA: 166 bpgenomic: 42,909
Reverse (1149,21)CCACCACTTTGCTTGTCCCATNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops2.072 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGC
CCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAG
CAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001550 (GRB10)166493 - 658
NM_001001555 (GRB10)166740 - 905
NM_001001549 (GRB10)166413 - 578
NM_005311 (GRB10)166413 - 578
Exon 7 To Exon 8 (Pair 15)
Forward (987,22)CAGTTTAGAACCTCATCTCTGCAmplicon SizecDNA: 169 bpgenomic: 42,912
Reverse (1155,22)GAATCTCCACCACTTTGCTTGTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol in 3' area
Forward Dimers-0.399 kcal/mol
Reverse Loops2.345 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-1.72 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCCT
GGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCAG
GATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001549 (GRB10)169416 - 584
NM_001001555 (GRB10)169743 - 911
NM_001001550 (GRB10)169496 - 664
NM_005311 (GRB10)169416 - 584
Exon 7 To Exon 8 (Pair 16)
Forward (974,21)GGAGGAAGACCAGCAGTTTAGAmplicon SizecDNA: 170 bpgenomic: 42,913
Reverse (1143,22)CTTTGCTTGTCCCATCTTCACTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol in 3' area
Forward Dimers-0.893 kcal/mol
Reverse Loops2.696 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGGAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGA
ACTCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGC
CGCCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001550 (GRB10)170483 - 652
NM_001001555 (GRB10)170730 - 899
NM_001001549 (GRB10)170403 - 572
NM_005311 (GRB10)170403 - 572
Exon 7 To Exon 8 (Pair 17)
Forward (982,22)ACCAGCAGTTTAGAACCTCATCAmplicon SizecDNA: 171 bpgenomic: 42,914
Reverse (1152,21)TCTCCACCACTTTGCTTGTCCNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.369 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.072 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTG
GCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAA
AGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)171411 - 581
NM_001001550 (GRB10)171491 - 661
NM_001001555 (GRB10)171738 - 908
NM_001001549 (GRB10)171411 - 581
Exon 7 To Exon 8 (Pair 18)
Forward (972,21)CAGGAGGAAGACCAGCAGTTTAmplicon SizecDNA: 260 bpgenomic: 43,003
Reverse (1231,21)GTCCAGCTGTTGTCATCCACANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol in 3' area
Forward Dimers-0.893 kcal/mol
Reverse Loops1.422 kcal/mol in 3' area
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceCAGGAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCT
GAACTCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAG
GCCGCCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAG
ATTCTAGCAGACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGT
GTGGATGACAACAGCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)260401 - 660
NM_001001550 (GRB10)260481 - 740
NM_001001549 (GRB10)260401 - 660
NM_001001555 (GRB10)260728 - 987
Exon 7 To Exon 8 (Pair 19)
Forward (983,22)CCAGCAGTTTAGAACCTCATCTAmplicon SizecDNA: 168 bpgenomic: 42,911
Reverse (1150,21)TCCACCACTTTGCTTGTCCCANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.729 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.072 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceCCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGG
CCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAA
GCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001555 (GRB10)168739 - 906
NM_001001549 (GRB10)168412 - 579
NM_001001550 (GRB10)168492 - 659
NM_005311 (GRB10)168412 - 579
Exon 7 To Exon 8 (Pair 20)
Forward (982,22)ACCAGCAGTTTAGAACCTCATCAmplicon SizecDNA: 168 bpgenomic: 42,911
Reverse (1149,21)CCACCACTTTGCTTGTCCCATNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.369 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.072 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTG
GCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAA
AGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001555 (GRB10)168738 - 905
NM_001001549 (GRB10)168411 - 578
NM_001001550 (GRB10)168491 - 658
NM_005311 (GRB10)168411 - 578
Exon 7 To Exon 8 (Pair 21)
Forward (984,22)CAGCAGTTTAGAACCTCATCTCAmplicon SizecDNA: 161 bpgenomic: 42,904
Reverse (1144,22)ACTTTGCTTGTCCCATCTTCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops2.546 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGC
CCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAG
CAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001550 (GRB10)161493 - 653
NM_001001549 (GRB10)161413 - 573
NM_001001555 (GRB10)161740 - 900
NM_005311 (GRB10)161413 - 573
Exon 7 To Exon 8 (Pair 22)
Forward (980,22)AGACCAGCAGTTTAGAACCTCAAmplicon SizecDNA: 166 bpgenomic: 42,909
Reverse (1145,22)CACTTTGCTTGTCCCATCTTCANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.072 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTG
TGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGC
AAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001549 (GRB10)166409 - 574
NM_001001555 (GRB10)166736 - 901
NM_001001550 (GRB10)166489 - 654
NM_005311 (GRB10)166409 - 574
Exon 7 To Exon 8 (Pair 23)
Forward (981,22)GACCAGCAGTTTAGAACCTCATAmplicon SizecDNA: 250 bpgenomic: 42,993
Reverse (1230,21)TCCAGCTGTTGTCATCCACACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.396 kcal/mol in 3' area
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGT
GGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCA
AAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAGCA
GACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATGAC
AACAGCTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)250410 - 659
NM_001001550 (GRB10)250490 - 739
NM_001001555 (GRB10)250737 - 986
NM_001001549 (GRB10)250410 - 659
Exon 7 To Exon 8 (Pair 24)
Forward (983,22)CCAGCAGTTTAGAACCTCATCTAmplicon SizecDNA: 161 bpgenomic: 42,904
Reverse (1143,22)CTTTGCTTGTCCCATCTTCACTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.729 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.696 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceCCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGG
CCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAA
GCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)161412 - 572
NM_001001550 (GRB10)161492 - 652
NM_001001549 (GRB10)161412 - 572
NM_001001555 (GRB10)161739 - 899
Exon 7 To Exon 8 (Pair 25)
Forward (980,22)AGACCAGCAGTTTAGAACCTCAAmplicon SizecDNA: 254 bpgenomic: 42,997
Reverse (1233,21)GTGTCCAGCTGTTGTCATCCANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTG
TGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGC
AAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAGC
AGACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATGA
CAACAGCTGGACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001550 (GRB10)254489 - 742
NM_001001555 (GRB10)254736 - 989
NM_001001549 (GRB10)254409 - 662
NM_005311 (GRB10)254409 - 662
Exon 7 To Exon 8 (Pair 26)
Forward (974,21)GGAGGAAGACCAGCAGTTTAGAmplicon SizecDNA: 255 bpgenomic: 42,998
Reverse (1228,21)CAGCTGTTGTCATCCACACAGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol in 3' area
Forward Dimers-0.893 kcal/mol
Reverse Loops1.396 kcal/mol in 3' area
Reverse Dimers-2.554 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGGAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGA
ACTCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGC
CGCCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGAT
TCTAGCAGACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGT
GGATGACAACAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001549 (GRB10)255403 - 657
NM_001001555 (GRB10)255730 - 984
NM_001001550 (GRB10)255483 - 737
NM_005311 (GRB10)255403 - 657
Exon 7 To Exon 8 (Pair 27)
Forward (975,22)GAGGAAGACCAGCAGTTTAGAAAmplicon SizecDNA: 258 bpgenomic: 43,001
Reverse (1232,21)TGTCCAGCTGTTGTCATCCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.893 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAA
CTCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCC
GCCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATT
CTAGCAGACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTG
GATGACAACAGCTGGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001550 (GRB10)258484 - 741
NM_001001555 (GRB10)258731 - 988
NM_001001549 (GRB10)258404 - 661
NM_005311 (GRB10)258404 - 661
Exon 7 To Exon 8 (Pair 28)
Forward (974,21)GGAGGAAGACCAGCAGTTTAGAmplicon SizecDNA: 256 bpgenomic: 42,999
Reverse (1229,21)CCAGCTGTTGTCATCCACACANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol in 3' area
Forward Dimers-0.893 kcal/mol
Reverse Loops1.396 kcal/mol in 3' area
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGGAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGA
ACTCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGC
CGCCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGAT
TCTAGCAGACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGT
GGATGACAACAGCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001550 (GRB10)256483 - 738
NM_001001555 (GRB10)256730 - 985
NM_001001549 (GRB10)256403 - 658
NM_005311 (GRB10)256403 - 658
Exon 7 To Exon 8 (Pair 29)
Forward (987,22)CAGTTTAGAACCTCATCTCTGCAmplicon SizecDNA: 166 bpgenomic: 42,909
Reverse (1152,21)TCTCCACCACTTTGCTTGTCCNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol in 3' area
Forward Dimers-0.399 kcal/mol
Reverse Loops2.072 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.72 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCCT
GGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCAG
GATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001550 (GRB10)166496 - 661
NM_001001555 (GRB10)166743 - 908
NM_001001549 (GRB10)166416 - 581
NM_005311 (GRB10)166416 - 581
Exon 7 To Exon 8 (Pair 30)
Forward (981,22)GACCAGCAGTTTAGAACCTCATAmplicon SizecDNA: 164 bpgenomic: 42,907
Reverse (1144,22)ACTTTGCTTGTCCCATCTTCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.546 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGT
GGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCA
AAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001549 (GRB10)164410 - 573
NM_001001555 (GRB10)164737 - 900
NM_001001550 (GRB10)164490 - 653
NM_005311 (GRB10)164410 - 573
Exon 7 To Exon 8 (Pair 31)
Forward (976,22)AGGAAGACCAGCAGTTTAGAACAmplicon SizecDNA: 253 bpgenomic: 42,996
Reverse (1228,21)CAGCTGTTGTCATCCACACAGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.893 kcal/mol
Reverse Loops1.396 kcal/mol in 3' area
Reverse Dimers-2.554 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAAC
TCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCG
CCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTC
TAGCAGACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGG
ATGACAACAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)253405 - 657
NM_001001555 (GRB10)253732 - 984
NM_001001549 (GRB10)253405 - 657
NM_001001550 (GRB10)253485 - 737
Exon 7 To Exon 8 (Pair 32)
Forward (988,22)AGTTTAGAACCTCATCTCTGCCAmplicon SizecDNA: 241 bpgenomic: 42,984
Reverse (1228,21)CAGCTGTTGTCATCCACACAGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol
Forward Dimers-0.399 kcal/mol
Reverse Loops1.396 kcal/mol in 3' area
Reverse Dimers-2.554 kcal/mol
Forward-Reverse Dimers-0.693 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCCTG
GGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCAGG
ATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAGCAGACATGA
CAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATGACAACAGCT
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)241417 - 657
NM_001001549 (GRB10)241417 - 657
NM_001001555 (GRB10)241744 - 984
NM_001001550 (GRB10)241497 - 737
Exon 7 To Exon 8 (Pair 33)
Forward (978,22)GAAGACCAGCAGTTTAGAACCTAmplicon SizecDNA: 256 bpgenomic: 42,999
Reverse (1233,21)GTGTCCAGCTGTTGTCATCCANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTC
TGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCC
GCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTA
GCAGACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGAT
GACAACAGCTGGACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001550 (GRB10)256487 - 742
NM_001001555 (GRB10)256734 - 989
NM_001001549 (GRB10)256407 - 662
NM_005311 (GRB10)256407 - 662
Exon 7 To Exon 8 (Pair 34)
Forward (987,22)CAGTTTAGAACCTCATCTCTGCAmplicon SizecDNA: 247 bpgenomic: 42,990
Reverse (1233,21)GTGTCCAGCTGTTGTCATCCANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol in 3' area
Forward Dimers-0.399 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-0.693 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCCT
GGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCAG
GATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAGCAGACATG
ACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATGACAACAGC
TGGACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001550 (GRB10)247496 - 742
NM_001001555 (GRB10)247743 - 989
NM_001001549 (GRB10)247416 - 662
NM_005311 (GRB10)247416 - 662
Exon 7 To Exon 8 (Pair 35)
Forward (983,22)CCAGCAGTTTAGAACCTCATCTAmplicon SizecDNA: 250 bpgenomic: 42,993
Reverse (1232,21)TGTCCAGCTGTTGTCATCCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.729 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceCCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGG
CCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAA
GCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAGCAGA
CATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATGACAA
CAGCTGGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001550 (GRB10)250492 - 741
NM_001001555 (GRB10)250739 - 988
NM_001001549 (GRB10)250412 - 661
NM_005311 (GRB10)250412 - 661
Exon 7 To Exon 8 (Pair 36)
Forward (978,22)GAAGACCAGCAGTTTAGAACCTAmplicon SizecDNA: 172 bpgenomic: 42,915
Reverse (1149,21)CCACCACTTTGCTTGTCCCATNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.072 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTC
TGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCC
GCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)172407 - 578
NM_001001550 (GRB10)172487 - 658
NM_001001555 (GRB10)172734 - 905
NM_001001549 (GRB10)172407 - 578
Exon 7 To Exon 8 (Pair 37)
Forward (975,22)GAGGAAGACCAGCAGTTTAGAAAmplicon SizecDNA: 168 bpgenomic: 42,911
Reverse (1142,23)TTTGCTTGTCCCATCTTCACTAANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.893 kcal/mol
Reverse Loops2.696 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAA
CTCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCC
GCCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)168404 - 571
NM_001001549 (GRB10)168404 - 571
NM_001001555 (GRB10)168731 - 898
NM_001001550 (GRB10)168484 - 651
Exon 7 To Exon 8 (Pair 38)
Forward (975,22)GAGGAAGACCAGCAGTTTAGAAAmplicon SizecDNA: 171 bpgenomic: 42,914
Reverse (1145,22)CACTTTGCTTGTCCCATCTTCANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.893 kcal/mol
Reverse Loops2.072 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAA
CTCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCC
GCCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001550 (GRB10)171484 - 654
NM_001001549 (GRB10)171404 - 574
NM_001001555 (GRB10)171731 - 901
NM_005311 (GRB10)171404 - 574
Exon 7 To Exon 8 (Pair 39)
Forward (981,22)GACCAGCAGTTTAGAACCTCATAmplicon SizecDNA: 162 bpgenomic: 42,905
Reverse (1142,23)TTTGCTTGTCCCATCTTCACTAANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.696 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGT
GGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCA
AAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001550 (GRB10)162490 - 651
NM_001001555 (GRB10)162737 - 898
NM_001001549 (GRB10)162410 - 571
NM_005311 (GRB10)162410 - 571
Exon 7 To Exon 8 (Pair 40)
Forward (981,22)GACCAGCAGTTTAGAACCTCATAmplicon SizecDNA: 161 bpgenomic: 42,904
Reverse (1141,23)TTGCTTGTCCCATCTTCACTAAANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.647 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGT
GGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCA
AAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001549 (GRB10)161410 - 570
NM_001001555 (GRB10)161737 - 897
NM_001001550 (GRB10)161490 - 650
NM_005311 (GRB10)161410 - 570
Exon 7 To Exon 8 (Pair 41)
Forward (987,22)CAGTTTAGAACCTCATCTCTGCAmplicon SizecDNA: 245 bpgenomic: 42,988
Reverse (1231,21)GTCCAGCTGTTGTCATCCACANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol in 3' area
Forward Dimers-0.399 kcal/mol
Reverse Loops1.422 kcal/mol in 3' area
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-0.693 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCCT
GGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCAG
GATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAGCAGACATG
ACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATGACAACAGC
TGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)245416 - 660
NM_001001555 (GRB10)245743 - 987
NM_001001549 (GRB10)245416 - 660
NM_001001550 (GRB10)245496 - 740
Exon 7 To Exon 8 (Pair 42)
Forward (976,22)AGGAAGACCAGCAGTTTAGAACAmplicon SizecDNA: 255 bpgenomic: 42,998
Reverse (1230,21)TCCAGCTGTTGTCATCCACACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.893 kcal/mol
Reverse Loops1.396 kcal/mol in 3' area
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAAC
TCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCG
CCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTC
TAGCAGACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGG
ATGACAACAGCTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)255405 - 659
NM_001001550 (GRB10)255485 - 739
NM_001001555 (GRB10)255732 - 986
NM_001001549 (GRB10)255405 - 659
Exon 7 To Exon 8 (Pair 43)
Forward (979,22)AAGACCAGCAGTTTAGAACCTCAmplicon SizecDNA: 172 bpgenomic: 42,915
Reverse (1150,21)TCCACCACTTTGCTTGTCCCANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.072 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCT
GTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCG
CAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001549 (GRB10)172408 - 579
NM_001001555 (GRB10)172735 - 906
NM_001001550 (GRB10)172488 - 659
NM_005311 (GRB10)172408 - 579
Exon 7 To Exon 8 (Pair 44)
Forward (982,22)ACCAGCAGTTTAGAACCTCATCAmplicon SizecDNA: 162 bpgenomic: 42,905
Reverse (1143,22)CTTTGCTTGTCCCATCTTCACTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.369 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.696 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTG
GCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAA
AGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)162411 - 572
NM_001001549 (GRB10)162411 - 572
NM_001001555 (GRB10)162738 - 899
NM_001001550 (GRB10)162491 - 652
Exon 7 To Exon 8 (Pair 45)
Forward (988,22)AGTTTAGAACCTCATCTCTGCCAmplicon SizecDNA: 171 bpgenomic: 42,914
Reverse (1158,22)CTAGAATCTCCACCACTTTGCTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol
Forward Dimers-0.399 kcal/mol
Reverse Loops2.069 kcal/mol
Reverse Dimers-0.916 kcal/mol
Forward-Reverse Dimers-1.246 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCCTG
GGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCAGG
ATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)171417 - 587
NM_001001550 (GRB10)171497 - 667
NM_001001549 (GRB10)171417 - 587
NM_001001555 (GRB10)171744 - 914
Exon 7 To Exon 8 (Pair 46)
Forward (980,22)AGACCAGCAGTTTAGAACCTCAAmplicon SizecDNA: 164 bpgenomic: 42,907
Reverse (1143,22)CTTTGCTTGTCCCATCTTCACTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.696 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTG
TGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGC
AAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)164409 - 572
NM_001001550 (GRB10)164489 - 652
NM_001001555 (GRB10)164736 - 899
NM_001001549 (GRB10)164409 - 572
Exon 7 To Exon 8 (Pair 47)
Forward (986,22)GCAGTTTAGAACCTCATCTCTGAmplicon SizecDNA: 167 bpgenomic: 42,910
Reverse (1152,21)TCTCCACCACTTTGCTTGTCCNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol in 3' area
Forward Dimers-0.399 kcal/mol
Reverse Loops2.072 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.72 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCC
TGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCA
GGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001555 (GRB10)167742 - 908
NM_001001549 (GRB10)167415 - 581
NM_001001550 (GRB10)167495 - 661
NM_005311 (GRB10)167415 - 581
Exon 7 To Exon 8 (Pair 48)
Forward (986,22)GCAGTTTAGAACCTCATCTCTGAmplicon SizecDNA: 165 bpgenomic: 42,908
Reverse (1150,21)TCCACCACTTTGCTTGTCCCANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol in 3' area
Forward Dimers-0.399 kcal/mol
Reverse Loops2.072 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.72 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCC
TGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCA
GGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001549 (GRB10)165415 - 579
NM_001001555 (GRB10)165742 - 906
NM_001001550 (GRB10)165495 - 659
NM_005311 (GRB10)165415 - 579
Exon 7 To Exon 8 (Pair 49)
Forward (974,21)GGAGGAAGACCAGCAGTTTAGAmplicon SizecDNA: 260 bpgenomic: 43,003
Reverse (1233,21)GTGTCCAGCTGTTGTCATCCANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol in 3' area
Forward Dimers-0.893 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGGAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGA
ACTCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGC
CGCCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGAT
TCTAGCAGACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGT
GGATGACAACAGCTGGACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)260403 - 662
NM_001001549 (GRB10)260403 - 662
NM_001001555 (GRB10)260730 - 989
NM_001001550 (GRB10)260483 - 742
Exon 7 To Exon 8 (Pair 50)
Forward (980,22)AGACCAGCAGTTTAGAACCTCAAmplicon SizecDNA: 163 bpgenomic: 42,906
Reverse (1142,23)TTTGCTTGTCCCATCTTCACTAANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.696 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTG
TGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGC
AAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)163409 - 571
NM_001001555 (GRB10)163736 - 898
NM_001001549 (GRB10)163409 - 571
NM_001001550 (GRB10)163489 - 651
Exon 7 To Exon 8 (Pair 51)
Forward (988,22)AGTTTAGAACCTCATCTCTGCCAmplicon SizecDNA: 163 bpgenomic: 42,906
Reverse (1150,21)TCCACCACTTTGCTTGTCCCANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol
Forward Dimers-0.399 kcal/mol
Reverse Loops2.072 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.246 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCCTG
GGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCAGG
ATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001555 (GRB10)163744 - 906
NM_001001549 (GRB10)163417 - 579
NM_001001550 (GRB10)163497 - 659
NM_005311 (GRB10)163417 - 579
Exon 7 To Exon 8 (Pair 52)
Forward (978,22)GAAGACCAGCAGTTTAGAACCTAmplicon SizecDNA: 175 bpgenomic: 42,918
Reverse (1152,21)TCTCCACCACTTTGCTTGTCCNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.072 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTC
TGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCC
GCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001550 (GRB10)175487 - 661
NM_001001549 (GRB10)175407 - 581
NM_001001555 (GRB10)175734 - 908
NM_005311 (GRB10)175407 - 581
Exon 7 To Exon 8 (Pair 53)
Forward (972,21)CAGGAGGAAGACCAGCAGTTTAmplicon SizecDNA: 263 bpgenomic: 43,006
Reverse (1234,21)AGTGTCCAGCTGTTGTCATCCNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol in 3' area
Forward Dimers-0.893 kcal/mol
Reverse Loops1.483 kcal/mol
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceCAGGAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCT
GAACTCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAG
GCCGCCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAG
ATTCTAGCAGACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGT
GTGGATGACAACAGCTGGACACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001550 (GRB10)263481 - 743
NM_001001555 (GRB10)263728 - 990
NM_001001549 (GRB10)263401 - 663
NM_005311 (GRB10)263401 - 663
Exon 7 To Exon 8 (Pair 54)
Forward (986,22)GCAGTTTAGAACCTCATCTCTGAmplicon SizecDNA: 169 bpgenomic: 42,912
Reverse (1154,22)AATCTCCACCACTTTGCTTGTCNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol in 3' area
Forward Dimers-0.399 kcal/mol
Reverse Loops2.072 kcal/mol in 3' area
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-1.72 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCC
TGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCA
GGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)169415 - 583
NM_001001549 (GRB10)169415 - 583
NM_001001555 (GRB10)169742 - 910
NM_001001550 (GRB10)169495 - 663
Exon 7 To Exon 8 (Pair 55)
Forward (980,22)AGACCAGCAGTTTAGAACCTCAAmplicon SizecDNA: 250 bpgenomic: 42,993
Reverse (1229,21)CCAGCTGTTGTCATCCACACANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.396 kcal/mol in 3' area
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTG
TGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGC
AAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAGC
AGACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATGA
CAACAGCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)250409 - 658
NM_001001550 (GRB10)250489 - 738
NM_001001549 (GRB10)250409 - 658
NM_001001555 (GRB10)250736 - 985
Exon 7 To Exon 8 (Pair 56)
Forward (986,22)GCAGTTTAGAACCTCATCTCTGAmplicon SizecDNA: 160 bpgenomic: 42,903
Reverse (1145,22)CACTTTGCTTGTCCCATCTTCANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol in 3' area
Forward Dimers-0.399 kcal/mol
Reverse Loops2.072 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.72 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCC
TGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCA
GGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)160415 - 574
NM_001001549 (GRB10)160415 - 574
NM_001001555 (GRB10)160742 - 901
NM_001001550 (GRB10)160495 - 654
Exon 7 To Exon 8 (Pair 57)
Forward (976,22)AGGAAGACCAGCAGTTTAGAACAmplicon SizecDNA: 169 bpgenomic: 42,912
Reverse (1144,22)ACTTTGCTTGTCCCATCTTCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.893 kcal/mol
Reverse Loops2.546 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAAC
TCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCG
CCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001549 (GRB10)169405 - 573
NM_001001555 (GRB10)169732 - 900
NM_001001550 (GRB10)169485 - 653
NM_005311 (GRB10)169405 - 573
Exon 7 To Exon 8 (Pair 58)
Forward (976,22)AGGAAGACCAGCAGTTTAGAACAmplicon SizecDNA: 170 bpgenomic: 42,913
Reverse (1145,22)CACTTTGCTTGTCCCATCTTCANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.893 kcal/mol
Reverse Loops2.072 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAAC
TCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCG
CCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)170405 - 574
NM_001001550 (GRB10)170485 - 654
NM_001001549 (GRB10)170405 - 574
NM_001001555 (GRB10)170732 - 901
Exon 7 To Exon 8 (Pair 59)
Forward (979,22)AAGACCAGCAGTTTAGAACCTCAmplicon SizecDNA: 166 bpgenomic: 42,909
Reverse (1144,22)ACTTTGCTTGTCCCATCTTCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.546 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCT
GTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCG
CAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001549 (GRB10)166408 - 573
NM_001001555 (GRB10)166735 - 900
NM_001001550 (GRB10)166488 - 653
NM_005311 (GRB10)166408 - 573
Exon 7 To Exon 8 (Pair 60)
Forward (979,22)AAGACCAGCAGTTTAGAACCTCAmplicon SizecDNA: 171 bpgenomic: 42,914
Reverse (1149,21)CCACCACTTTGCTTGTCCCATNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.072 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCT
GTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCG
CAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)171408 - 578
NM_001001550 (GRB10)171488 - 658
NM_001001549 (GRB10)171408 - 578
NM_001001555 (GRB10)171735 - 905
Exon 7 To Exon 8 (Pair 61)
Forward (976,22)AGGAAGACCAGCAGTTTAGAACAmplicon SizecDNA: 167 bpgenomic: 42,910
Reverse (1142,23)TTTGCTTGTCCCATCTTCACTAANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.893 kcal/mol
Reverse Loops2.696 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAAC
TCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCG
CCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)167405 - 571
NM_001001549 (GRB10)167405 - 571
NM_001001555 (GRB10)167732 - 898
NM_001001550 (GRB10)167485 - 651
Exon 7 To Exon 8 (Pair 62)
Forward (980,22)AGACCAGCAGTTTAGAACCTCAAmplicon SizecDNA: 165 bpgenomic: 42,908
Reverse (1144,22)ACTTTGCTTGTCCCATCTTCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.546 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTG
TGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGC
AAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001550 (GRB10)165489 - 653
NM_001001555 (GRB10)165736 - 900
NM_001001549 (GRB10)165409 - 573
NM_005311 (GRB10)165409 - 573
Exon 7 To Exon 8 (Pair 63)
Forward (972,21)CAGGAGGAAGACCAGCAGTTTAmplicon SizecDNA: 262 bpgenomic: 43,005
Reverse (1233,21)GTGTCCAGCTGTTGTCATCCANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol in 3' area
Forward Dimers-0.893 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceCAGGAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCT
GAACTCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAG
GCCGCCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAG
ATTCTAGCAGACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGT
GTGGATGACAACAGCTGGACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)262401 - 662
NM_001001555 (GRB10)262728 - 989
NM_001001549 (GRB10)262401 - 662
NM_001001550 (GRB10)262481 - 742
Exon 7 To Exon 8 (Pair 64)
Forward (975,22)GAGGAAGACCAGCAGTTTAGAAAmplicon SizecDNA: 178 bpgenomic: 42,921
Reverse (1152,21)TCTCCACCACTTTGCTTGTCCNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.893 kcal/mol
Reverse Loops2.072 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAA
CTCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCC
GCCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001549 (GRB10)178404 - 581
NM_001001555 (GRB10)178731 - 908
NM_001001550 (GRB10)178484 - 661
NM_005311 (GRB10)178404 - 581
Exon 7 To Exon 8 (Pair 65)
Forward (970,21)TTCAGGAGGAAGACCAGCAGTAmplicon SizecDNA: 189 bpgenomic: 42,932
Reverse (1158,22)CTAGAATCTCCACCACTTTGCTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.042 kcal/mol
Forward Dimers-0.893 kcal/mol
Reverse Loops2.069 kcal/mol
Reverse Dimers-0.916 kcal/mol
Forward-Reverse Dimers-1.979 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceTTCAGGAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTC
CTGAACTCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCC
AGGCCGCCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGG
AGATTCTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001550 (GRB10)189479 - 667
NM_005311 (GRB10)189399 - 587
NM_001001549 (GRB10)189399 - 587
NM_001001555 (GRB10)189726 - 914
Exon 7 To Exon 8 (Pair 66)
Forward (984,22)CAGCAGTTTAGAACCTCATCTCAmplicon SizecDNA: 249 bpgenomic: 42,992
Reverse (1232,21)TGTCCAGCTGTTGTCATCCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.028 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGC
CCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAG
CAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAGCAGAC
ATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATGACAAC
AGCTGGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001555 (GRB10)249740 - 988
NM_001001549 (GRB10)249413 - 661
NM_001001550 (GRB10)249493 - 741
NM_005311 (GRB10)249413 - 661
Exon 7 To Exon 8 (Pair 67)
Forward (978,22)GAAGACCAGCAGTTTAGAACCTAmplicon SizecDNA: 254 bpgenomic: 42,997
Reverse (1231,21)GTCCAGCTGTTGTCATCCACANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.422 kcal/mol in 3' area
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTC
TGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCC
GCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTA
GCAGACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGAT
GACAACAGCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001549 (GRB10)254407 - 660
NM_001001555 (GRB10)254734 - 987
NM_001001550 (GRB10)254487 - 740
NM_005311 (GRB10)254407 - 660
Exon 7 To Exon 8 (Pair 68)
Forward (988,22)AGTTTAGAACCTCATCTCTGCCAmplicon SizecDNA: 247 bpgenomic: 42,990
Reverse (1234,21)AGTGTCCAGCTGTTGTCATCCNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol
Forward Dimers-0.399 kcal/mol
Reverse Loops1.483 kcal/mol
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-0.693 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCCTG
GGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCAGG
ATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAGCAGACATGA
CAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATGACAACAGCT
GGACACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001555 (GRB10)247744 - 990
NM_001001549 (GRB10)247417 - 663
NM_005311 (GRB10)247417 - 663
NM_001001550 (GRB10)247497 - 743
Exon 7 To Exon 8 (Pair 69)
Forward (974,21)GGAGGAAGACCAGCAGTTTAGAmplicon SizecDNA: 259 bpgenomic: 43,002
Reverse (1232,21)TGTCCAGCTGTTGTCATCCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol in 3' area
Forward Dimers-0.893 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGGAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGA
ACTCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGC
CGCCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGAT
TCTAGCAGACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGT
GGATGACAACAGCTGGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001550 (GRB10)259483 - 741
NM_005311 (GRB10)259403 - 661
NM_001001555 (GRB10)259730 - 988
NM_001001549 (GRB10)259403 - 661
Exon 7 To Exon 8 (Pair 70)
Forward (984,22)CAGCAGTTTAGAACCTCATCTCAmplicon SizecDNA: 247 bpgenomic: 42,990
Reverse (1230,21)TCCAGCTGTTGTCATCCACACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.396 kcal/mol in 3' area
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.028 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGC
CCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAG
CAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAGCAGAC
ATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATGACAAC
AGCTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)247413 - 659
NM_001001550 (GRB10)247493 - 739
NM_001001549 (GRB10)247413 - 659
NM_001001555 (GRB10)247740 - 986
Exon 7 To Exon 8 (Pair 71)
Forward (982,22)ACCAGCAGTTTAGAACCTCATCAmplicon SizecDNA: 160 bpgenomic: 42,903
Reverse (1141,23)TTGCTTGTCCCATCTTCACTAAANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.369 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.647 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTG
GCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAA
AGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001555 (GRB10)160738 - 897
NM_001001549 (GRB10)160411 - 570
NM_005311 (GRB10)160411 - 570
NM_001001550 (GRB10)160491 - 650
Exon 7 To Exon 8 (Pair 72)
Forward (986,22)GCAGTTTAGAACCTCATCTCTGAmplicon SizecDNA: 248 bpgenomic: 42,991
Reverse (1233,21)GTGTCCAGCTGTTGTCATCCANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol in 3' area
Forward Dimers-0.399 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-0.731 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCC
TGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCA
GGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAGCAGACAT
GACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATGACAACAG
CTGGACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001550 (GRB10)248495 - 742
NM_005311 (GRB10)248415 - 662
NM_001001549 (GRB10)248415 - 662
NM_001001555 (GRB10)248742 - 989
Exon 7 To Exon 8 (Pair 73)
Forward (982,22)ACCAGCAGTTTAGAACCTCATCAmplicon SizecDNA: 249 bpgenomic: 42,992
Reverse (1230,21)TCCAGCTGTTGTCATCCACACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.369 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.396 kcal/mol in 3' area
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTG
GCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAA
AGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAGCAG
ACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATGACA
ACAGCTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001555 (GRB10)249738 - 986
NM_001001549 (GRB10)249411 - 659
NM_001001550 (GRB10)249491 - 739
NM_005311 (GRB10)249411 - 659
Exon 7 To Exon 8 (Pair 74)
Forward (986,22)GCAGTTTAGAACCTCATCTCTGAmplicon SizecDNA: 247 bpgenomic: 42,990
Reverse (1232,21)TGTCCAGCTGTTGTCATCCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol in 3' area
Forward Dimers-0.399 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-0.731 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCC
TGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCA
GGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAGCAGACAT
GACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATGACAACAG
CTGGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001555 (GRB10)247742 - 988
NM_001001549 (GRB10)247415 - 661
NM_001001550 (GRB10)247495 - 741
NM_005311 (GRB10)247415 - 661
Exon 7 To Exon 8 (Pair 75)
Forward (978,22)GAAGACCAGCAGTTTAGAACCTAmplicon SizecDNA: 165 bpgenomic: 42,908
Reverse (1142,23)TTTGCTTGTCCCATCTTCACTAANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.696 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTC
TGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCC
GCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001550 (GRB10)165487 - 651
NM_005311 (GRB10)165407 - 571
NM_001001555 (GRB10)165734 - 898
NM_001001549 (GRB10)165407 - 571
Exon 7 To Exon 8 (Pair 76)
Forward (988,22)AGTTTAGAACCTCATCTCTGCCAmplicon SizecDNA: 157 bpgenomic: 42,900
Reverse (1144,22)ACTTTGCTTGTCCCATCTTCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol
Forward Dimers-0.399 kcal/mol
Reverse Loops2.546 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.861 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCCTG
GGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCAGG
ATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001550 (GRB10)157497 - 653
NM_005311 (GRB10)157417 - 573
NM_001001555 (GRB10)157744 - 900
NM_001001549 (GRB10)157417 - 573
Exon 7 To Exon 8 (Pair 77)
Forward (987,22)CAGTTTAGAACCTCATCTCTGCAmplicon SizecDNA: 246 bpgenomic: 42,989
Reverse (1232,21)TGTCCAGCTGTTGTCATCCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol in 3' area
Forward Dimers-0.399 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-0.693 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCCT
GGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCAG
GATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAGCAGACATG
ACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATGACAACAGC
TGGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001555 (GRB10)246743 - 988
NM_001001549 (GRB10)246416 - 661
NM_005311 (GRB10)246416 - 661
NM_001001550 (GRB10)246496 - 741
Exon 7 To Exon 8 (Pair 78)
Forward (986,22)GCAGTTTAGAACCTCATCTCTGAmplicon SizecDNA: 171 bpgenomic: 42,914
Reverse (1156,22)AGAATCTCCACCACTTTGCTTGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol in 3' area
Forward Dimers-0.399 kcal/mol
Reverse Loops2.298 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-1.72 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCC
TGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCA
GGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001549 (GRB10)171415 - 585
NM_001001555 (GRB10)171742 - 912
NM_001001550 (GRB10)171495 - 665
NM_005311 (GRB10)171415 - 585
Exon 7 To Exon 8 (Pair 79)
Forward (975,22)GAGGAAGACCAGCAGTTTAGAAAmplicon SizecDNA: 259 bpgenomic: 43,002
Reverse (1233,21)GTGTCCAGCTGTTGTCATCCANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.893 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAA
CTCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCC
GCCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATT
CTAGCAGACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTG
GATGACAACAGCTGGACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)259404 - 662
NM_001001550 (GRB10)259484 - 742
NM_001001555 (GRB10)259731 - 989
NM_001001549 (GRB10)259404 - 662
Exon 7 To Exon 8 (Pair 80)
Forward (982,22)ACCAGCAGTTTAGAACCTCATCAmplicon SizecDNA: 164 bpgenomic: 42,907
Reverse (1145,22)CACTTTGCTTGTCCCATCTTCANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.369 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.072 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTG
GCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAA
AGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001555 (GRB10)164738 - 901
NM_001001549 (GRB10)164411 - 574
NM_001001550 (GRB10)164491 - 654
NM_005311 (GRB10)164411 - 574
Exon 7 To Exon 8 (Pair 81)
Forward (975,22)GAGGAAGACCAGCAGTTTAGAAAmplicon SizecDNA: 260 bpgenomic: 43,003
Reverse (1234,21)AGTGTCCAGCTGTTGTCATCCNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.893 kcal/mol
Reverse Loops1.483 kcal/mol
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAA
CTCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCC
GCCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATT
CTAGCAGACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTG
GATGACAACAGCTGGACACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)260404 - 663
NM_001001550 (GRB10)260484 - 743
NM_001001555 (GRB10)260731 - 990
NM_001001549 (GRB10)260404 - 663
Exon 7 To Exon 8 (Pair 82)
Forward (972,21)CAGGAGGAAGACCAGCAGTTTAmplicon SizecDNA: 259 bpgenomic: 43,002
Reverse (1230,21)TCCAGCTGTTGTCATCCACACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol in 3' area
Forward Dimers-0.893 kcal/mol
Reverse Loops1.396 kcal/mol in 3' area
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceCAGGAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCT
GAACTCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAG
GCCGCCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAG
ATTCTAGCAGACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGT
GTGGATGACAACAGCTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)259401 - 659
NM_001001550 (GRB10)259481 - 739
NM_001001549 (GRB10)259401 - 659
NM_001001555 (GRB10)259728 - 986
Exon 7 To Exon 8 (Pair 83)
Forward (987,22)CAGTTTAGAACCTCATCTCTGCAmplicon SizecDNA: 158 bpgenomic: 42,901
Reverse (1144,22)ACTTTGCTTGTCCCATCTTCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol in 3' area
Forward Dimers-0.399 kcal/mol
Reverse Loops2.546 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.246 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCCT
GGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCAG
GATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001549 (GRB10)158416 - 573
NM_001001555 (GRB10)158743 - 900
NM_001001550 (GRB10)158496 - 653
NM_005311 (GRB10)158416 - 573
Exon 7 To Exon 8 (Pair 84)
Forward (974,21)GGAGGAAGACCAGCAGTTTAGAmplicon SizecDNA: 257 bpgenomic: 43,000
Reverse (1230,21)TCCAGCTGTTGTCATCCACACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol in 3' area
Forward Dimers-0.893 kcal/mol
Reverse Loops1.396 kcal/mol in 3' area
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGGAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGA
ACTCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGC
CGCCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGAT
TCTAGCAGACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGT
GGATGACAACAGCTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001550 (GRB10)257483 - 739
NM_005311 (GRB10)257403 - 659
NM_001001555 (GRB10)257730 - 986
NM_001001549 (GRB10)257403 - 659
Exon 7 To Exon 8 (Pair 85)
Forward (986,22)GCAGTTTAGAACCTCATCTCTGAmplicon SizecDNA: 164 bpgenomic: 42,907
Reverse (1149,21)CCACCACTTTGCTTGTCCCATNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol in 3' area
Forward Dimers-0.399 kcal/mol
Reverse Loops2.072 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.72 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCC
TGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCA
GGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)164415 - 578
NM_001001550 (GRB10)164495 - 658
NM_001001549 (GRB10)164415 - 578
NM_001001555 (GRB10)164742 - 905
Exon 7 To Exon 8 (Pair 86)
Forward (982,22)ACCAGCAGTTTAGAACCTCATCAmplicon SizecDNA: 253 bpgenomic: 42,996
Reverse (1234,21)AGTGTCCAGCTGTTGTCATCCNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.369 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.483 kcal/mol
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTG
GCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAA
AGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAGCAG
ACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATGACA
ACAGCTGGACACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001549 (GRB10)253411 - 663
NM_001001555 (GRB10)253738 - 990
NM_005311 (GRB10)253411 - 663
NM_001001550 (GRB10)253491 - 743
Exon 7 To Exon 8 (Pair 87)
Forward (976,22)AGGAAGACCAGCAGTTTAGAACAmplicon SizecDNA: 257 bpgenomic: 43,000
Reverse (1232,21)TGTCCAGCTGTTGTCATCCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.893 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAAC
TCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCG
CCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTC
TAGCAGACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGG
ATGACAACAGCTGGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001550 (GRB10)257485 - 741
NM_005311 (GRB10)257405 - 661
NM_001001555 (GRB10)257732 - 988
NM_001001549 (GRB10)257405 - 661
Exon 7 To Exon 8 (Pair 88)
Forward (979,22)AAGACCAGCAGTTTAGAACCTCAmplicon SizecDNA: 174 bpgenomic: 42,917
Reverse (1152,21)TCTCCACCACTTTGCTTGTCCNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.072 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCT
GTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCG
CAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001555 (GRB10)174735 - 908
NM_001001549 (GRB10)174408 - 581
NM_005311 (GRB10)174408 - 581
NM_001001550 (GRB10)174488 - 661
Exon 7 To Exon 8 (Pair 89)
Forward (987,22)CAGTTTAGAACCTCATCTCTGCAmplicon SizecDNA: 243 bpgenomic: 42,986
Reverse (1229,21)CCAGCTGTTGTCATCCACACANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol in 3' area
Forward Dimers-0.399 kcal/mol
Reverse Loops1.396 kcal/mol in 3' area
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-0.693 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCCT
GGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCAG
GATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAGCAGACATG
ACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATGACAACAGC
TGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)243416 - 658
NM_001001550 (GRB10)243496 - 738
NM_001001555 (GRB10)243743 - 985
NM_001001549 (GRB10)243416 - 658
Exon 7 To Exon 8 (Pair 90)
Forward (980,22)AGACCAGCAGTTTAGAACCTCAAmplicon SizecDNA: 170 bpgenomic: 42,913
Reverse (1149,21)CCACCACTTTGCTTGTCCCATNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.072 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTG
TGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGC
AAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)170409 - 578
NM_001001550 (GRB10)170489 - 658
NM_001001549 (GRB10)170409 - 578
NM_001001555 (GRB10)170736 - 905
Exon 7 To Exon 8 (Pair 91)
Forward (983,22)CCAGCAGTTTAGAACCTCATCTAmplicon SizecDNA: 170 bpgenomic: 42,913
Reverse (1152,21)TCTCCACCACTTTGCTTGTCCNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.729 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.072 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceCCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGG
CCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAA
GCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001549 (GRB10)170412 - 581
NM_001001555 (GRB10)170739 - 908
NM_005311 (GRB10)170412 - 581
NM_001001550 (GRB10)170492 - 661
Exon 7 To Exon 8 (Pair 92)
Forward (988,22)AGTTTAGAACCTCATCTCTGCCAmplicon SizecDNA: 165 bpgenomic: 42,908
Reverse (1152,21)TCTCCACCACTTTGCTTGTCCNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol
Forward Dimers-0.399 kcal/mol
Reverse Loops2.072 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.246 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCCTG
GGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCAGG
ATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001555 (GRB10)165744 - 908
NM_001001549 (GRB10)165417 - 581
NM_005311 (GRB10)165417 - 581
NM_001001550 (GRB10)165497 - 661
Exon 7 To Exon 8 (Pair 93)
Forward (984,22)CAGCAGTTTAGAACCTCATCTCAmplicon SizecDNA: 250 bpgenomic: 42,993
Reverse (1233,21)GTGTCCAGCTGTTGTCATCCANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.028 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGC
CCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAG
CAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAGCAGAC
ATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATGACAAC
AGCTGGACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001549 (GRB10)250413 - 662
NM_001001555 (GRB10)250740 - 989
NM_001001550 (GRB10)250493 - 742
NM_005311 (GRB10)250413 - 662
Exon 7 To Exon 8 (Pair 94)
Forward (980,22)AGACCAGCAGTTTAGAACCTCAAmplicon SizecDNA: 173 bpgenomic: 42,916
Reverse (1152,21)TCTCCACCACTTTGCTTGTCCNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.072 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTG
TGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGC
AAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001549 (GRB10)173409 - 581
NM_001001555 (GRB10)173736 - 908
NM_001001550 (GRB10)173489 - 661
NM_005311 (GRB10)173409 - 581
Exon 7 To Exon 8 (Pair 95)
Forward (979,22)AAGACCAGCAGTTTAGAACCTCAmplicon SizecDNA: 250 bpgenomic: 42,993
Reverse (1228,21)CAGCTGTTGTCATCCACACAGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.396 kcal/mol in 3' area
Reverse Dimers-2.554 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCT
GTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCG
CAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAG
CAGACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATG
ACAACAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001555 (GRB10)250735 - 984
NM_001001549 (GRB10)250408 - 657
NM_001001550 (GRB10)250488 - 737
NM_005311 (GRB10)250408 - 657
Exon 7 To Exon 8 (Pair 96)
Forward (981,22)GACCAGCAGTTTAGAACCTCATAmplicon SizecDNA: 253 bpgenomic: 42,996
Reverse (1233,21)GTGTCCAGCTGTTGTCATCCANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGT
GGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCA
AAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAGCA
GACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATGAC
AACAGCTGGACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001550 (GRB10)253490 - 742
NM_005311 (GRB10)253410 - 662
NM_001001555 (GRB10)253737 - 989
NM_001001549 (GRB10)253410 - 662
Exon 7 To Exon 8 (Pair 97)
Forward (983,22)CCAGCAGTTTAGAACCTCATCTAmplicon SizecDNA: 159 bpgenomic: 42,902
Reverse (1141,23)TTGCTTGTCCCATCTTCACTAAANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.729 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops2.647 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceCCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGG
CCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAA
GCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)159412 - 570
NM_001001550 (GRB10)159492 - 650
NM_001001555 (GRB10)159739 - 897
NM_001001549 (GRB10)159412 - 570
Exon 7 To Exon 8 (Pair 98)
Forward (981,22)GACCAGCAGTTTAGAACCTCATAmplicon SizecDNA: 248 bpgenomic: 42,991
Reverse (1228,21)CAGCTGTTGTCATCCACACAGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.396 kcal/mol in 3' area
Reverse Dimers-2.554 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGT
GGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCA
AAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAGCA
GACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATGAC
AACAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001549 (GRB10)248410 - 657
NM_001001555 (GRB10)248737 - 984
NM_005311 (GRB10)248410 - 657
NM_001001550 (GRB10)248490 - 737
Exon 7 To Exon 8 (Pair 99)
Forward (981,22)GACCAGCAGTTTAGAACCTCATAmplicon SizecDNA: 249 bpgenomic: 42,992
Reverse (1229,21)CCAGCTGTTGTCATCCACACANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.396 kcal/mol in 3' area
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.171 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGT
GGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCA
AAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAGCA
GACATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATGAC
AACAGCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001001555 (GRB10)249737 - 985
NM_001001549 (GRB10)249410 - 658
NM_005311 (GRB10)249410 - 658
NM_001001550 (GRB10)249490 - 738
Exon 7 To Exon 8 (Pair 100)
Forward (987,22)CAGTTTAGAACCTCATCTCTGCAmplicon SizecDNA: 244 bpgenomic: 42,987
Reverse (1230,21)TCCAGCTGTTGTCATCCACACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol in 3' area
Forward Dimers-0.399 kcal/mol
Reverse Loops1.396 kcal/mol in 3' area
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-0.693 kcal/mol
Amplicon Folding-0.136 kcal/mol outside primersite
Amplicon SequenceCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCCT
GGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCAG
GATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAGCAGACATG
ACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATGACAACAGC
TGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005311 (GRB10)244416 - 659
NM_001001550 (GRB10)244496 - 739
NM_001001549 (GRB10)244416 - 659
NM_001001555 (GRB10)244743 - 986
 

See below for some more details.

Program Output:

Loading ...