Design Results for GSTM1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size150
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size1000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 7 To Exon 8 (Pair 1)
Forward (595,20)AAGTGCTTGGACGCCTTCCCAmplicon SizecDNA: 126 bpgenomic: 2,767
Reverse (720,22)GACAGCCATCTTTGAGAACACANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.838 kcal/mol in 3' area
Forward Dimers-1.093 kcal/mol
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.514 kcal/mol outside primersite
Amplicon SequenceAAGTGCTTGGACGCCTTCCCAAATCTGAAGGACTTCATCTCCCGCTTTGAGGGCTTGGAG
AAGATCTCTGCCTACATGAAGTCCAGCCGCTTCCTCCCAAGACCTGTGTTCTCAAAGATG
GCTGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002932 (GSTM2P1)123550 - 672
NM_000561 (GSTM1)126595 - 720
Exon 7 To Exon 8 (Pair 2)
Forward (570,22)TGACCTCCACCGTATATTTGAGAmplicon SizecDNA: 150 bpgenomic: 2,791
Reverse (719,22)ACAGCCATCTTTGAGAACACAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.071 kcal/mol
Forward Dimers0.08 kcal/mol
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-0.866 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceTGACCTCCACCGTATATTTGAGCCCAAGTGCTTGGACGCCTTCCCAAATCTGAAGGACTT
CATCTCCCGCTTTGAGGGCTTGGAGAAGATCTCTGCCTACATGAAGTCCAGCCGCTTCCT
CCCAAGACCTGTGTTCTCAAAGATGGCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)150570 - 719
Exon 7 To Exon 8 (Pair 3)
Forward (570,22)TGACCTCCACCGTATATTTGAGAmplicon SizecDNA: 151 bpgenomic: 2,792
Reverse (720,22)GACAGCCATCTTTGAGAACACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.071 kcal/mol
Forward Dimers0.08 kcal/mol
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-0.866 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceTGACCTCCACCGTATATTTGAGCCCAAGTGCTTGGACGCCTTCCCAAATCTGAAGGACTT
CATCTCCCGCTTTGAGGGCTTGGAGAAGATCTCTGCCTACATGAAGTCCAGCCGCTTCCT
CCCAAGACCTGTGTTCTCAAAGATGGCTGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)151570 - 720
Exon 7 To Exon 8 (Pair 4)
Forward (594,20)CAAGTGCTTGGACGCCTTCCAmplicon SizecDNA: 126 bpgenomic: 2,767
Reverse (719,22)ACAGCCATCTTTGAGAACACAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.957 kcal/mol in 3' area
Forward Dimers-1.765 kcal/mol
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.514 kcal/mol outside primersite
Amplicon SequenceCAAGTGCTTGGACGCCTTCCCAAATCTGAAGGACTTCATCTCCCGCTTTGAGGGCTTGGA
GAAGATCTCTGCCTACATGAAGTCCAGCCGCTTCCTCCCAAGACCTGTGTTCTCAAAGAT
GGCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002932 (GSTM2P1)123549 - 671
NM_000561 (GSTM1)126594 - 719
Exon 7 To Exon 8 (Pair 5)
Forward (602,21)TGGACGCCTTCCCAAATCTGAAmplicon SizecDNA: 119 bpgenomic: 2,760
Reverse (720,22)GACAGCCATCTTTGAGAACACANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.838 kcal/mol
Forward Dimers-0.875 kcal/mol
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-1.427 kcal/mol
Amplicon Folding-1.514 kcal/mol outside primersite
Amplicon SequenceTGGACGCCTTCCCAAATCTGAAGGACTTCATCTCCCGCTTTGAGGGCTTGGAGAAGATCT
CTGCCTACATGAAGTCCAGCCGCTTCCTCCCAAGACCTGTGTTCTCAAAGATGGCTGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002932 (GSTM2P1)116557 - 672
NM_000561 (GSTM1)119602 - 720
Exon 7 To Exon 8 (Pair 6)
Forward (601,21)TTGGACGCCTTCCCAAATCTGAmplicon SizecDNA: 119 bpgenomic: 2,760
Reverse (719,22)ACAGCCATCTTTGAGAACACAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.838 kcal/mol
Forward Dimers-1.32 kcal/mol
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-1.498 kcal/mol
Amplicon Folding-1.514 kcal/mol outside primersite
Amplicon SequenceTTGGACGCCTTCCCAAATCTGAAGGACTTCATCTCCCGCTTTGAGGGCTTGGAGAAGATC
TCTGCCTACATGAAGTCCAGCCGCTTCCTCCCAAGACCTGTGTTCTCAAAGATGGCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002932 (GSTM2P1)116556 - 671
NM_000561 (GSTM1)119601 - 719
Exon 7 To Exon 8 (Pair 7)
Forward (602,21)TGGACGCCTTCCCAAATCTGAAmplicon SizecDNA: 118 bpgenomic: 2,759
Reverse (719,22)ACAGCCATCTTTGAGAACACAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.838 kcal/mol
Forward Dimers-0.875 kcal/mol
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-1.427 kcal/mol
Amplicon Folding-1.514 kcal/mol outside primersite
Amplicon SequenceTGGACGCCTTCCCAAATCTGAAGGACTTCATCTCCCGCTTTGAGGGCTTGGAGAAGATCT
CTGCCTACATGAAGTCCAGCCGCTTCCTCCCAAGACCTGTGTTCTCAAAGATGGCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)118602 - 719
NR_002932 (GSTM2P1)115557 - 671
Exon 7 To Exon 8 (Pair 8)
Forward (601,21)TTGGACGCCTTCCCAAATCTGAmplicon SizecDNA: 112 bpgenomic: 2,753
Reverse (712,22)TCTTTGAGAACACAGGTCTTGGNr. of Isoforms 4 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.838 kcal/mol
Forward Dimers-1.32 kcal/mol
Reverse Loops0.976 kcal/mol
Reverse Dimers-0.497 kcal/mol
Forward-Reverse Dimers-1.722 kcal/mol
Amplicon Folding-1.514 kcal/mol outside primersite
Amplicon SequenceTTGGACGCCTTCCCAAATCTGAAGGACTTCATCTCCCGCTTTGAGGGCTTGGAGAAGATC
TCTGCCTACATGAAGTCCAGCCGCTTCCTCCCAAGACCTGTGTTCTCAAAGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000561 (GSTM1)112601 - 712
Exon 7 To Exon 8 (Pair 9)
Forward (601,21)TTGGACGCCTTCCCAAATCTGAmplicon SizecDNA: 120 bpgenomic: 2,761
Reverse (720,22)GACAGCCATCTTTGAGAACACANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.838 kcal/mol
Forward Dimers-1.32 kcal/mol
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-1.498 kcal/mol
Amplicon Folding-1.514 kcal/mol outside primersite
Amplicon SequenceTTGGACGCCTTCCCAAATCTGAAGGACTTCATCTCCCGCTTTGAGGGCTTGGAGAAGATC
TCTGCCTACATGAAGTCCAGCCGCTTCCTCCCAAGACCTGTGTTCTCAAAGATGGCTGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002932 (GSTM2P1)117556 - 672
NM_000561 (GSTM1)120601 - 720
Exon 7 To Exon 8 (Pair 10)
Forward (594,20)CAAGTGCTTGGACGCCTTCCAmplicon SizecDNA: 127 bpgenomic: 2,768
Reverse (720,22)GACAGCCATCTTTGAGAACACANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.957 kcal/mol in 3' area
Forward Dimers-1.765 kcal/mol
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.514 kcal/mol outside primersite
Amplicon SequenceCAAGTGCTTGGACGCCTTCCCAAATCTGAAGGACTTCATCTCCCGCTTTGAGGGCTTGGA
GAAGATCTCTGCCTACATGAAGTCCAGCCGCTTCCTCCCAAGACCTGTGTTCTCAAAGAT
GGCTGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)127594 - 720
NR_002932 (GSTM2P1)124549 - 672
Exon 7 To Exon 8 (Pair 11)
Forward (595,20)AAGTGCTTGGACGCCTTCCCAmplicon SizecDNA: 125 bpgenomic: 2,766
Reverse (719,22)ACAGCCATCTTTGAGAACACAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.838 kcal/mol in 3' area
Forward Dimers-1.093 kcal/mol
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.514 kcal/mol outside primersite
Amplicon SequenceAAGTGCTTGGACGCCTTCCCAAATCTGAAGGACTTCATCTCCCGCTTTGAGGGCTTGGAG
AAGATCTCTGCCTACATGAAGTCCAGCCGCTTCCTCCCAAGACCTGTGTTCTCAAAGATG
GCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002932 (GSTM2P1)122550 - 671
NM_000561 (GSTM1)125595 - 719
 

See below for some more details.

Program Output:

Loading ...