Design Results for GSTM1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size80Maximal Amplicon Size175
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size0

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 4 (Pair 1)
Forward (128,20)TCCGCCTGCTCCTGGAATACAmplicon SizecDNA: 171 bpgenomic: 908
Reverse (298,21)TGCTCTGGGTGATCTTGTGAGNr. of Isoforms 9 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.304 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops1.585 kcal/mol
Reverse Dimers-0.18 kcal/mol
Forward-Reverse Dimers-1.153 kcal/mol
Amplicon Folding-1.674 kcal/mol outside primersite
Amplicon SequenceTCCGCCTGCTCCTGGAATACACAGACTCAAGCTATGAGGAAAAGAAGTACACGATGGGGG
ACGCTCCTGATTATGACAGAAGCCAGTGGCTGAATGAAAAATTCAAGCTGGGCCTGGACT
TTCCCAATCTGCCCTACTTGATTGATGGGGCTCACAAGATCACCCAGAGCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_147148 (GSTM4)171364 - 534
NM_000561 (GSTM1)171128 - 298
NM_000851 (GSTM5)171121 - 291
NM_000849 (GSTM3)171372 - 542
NM_001142368 (GSTM2)171144 - 314
NM_000848 (GSTM2)171144 - 314
NM_000850 (GSTM4)171364 - 534
NM_146421 (GSTM1)171128 - 298
Exon 2 To Exon 4 (Pair 2)
Forward (130,20)CGCCTGCTCCTGGAATACACAmplicon SizecDNA: 174 bpgenomic: 911
Reverse (303,20)GGCGTTGCTCTGGGTGATCTNr. of Isoforms 8 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.52 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops1.585 kcal/mol in 3' area
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-2.566 kcal/mol
Amplicon Folding-1.674 kcal/mol outside primersite
Amplicon SequenceCGCCTGCTCCTGGAATACACAGACTCAAGCTATGAGGAAAAGAAGTACACGATGGGGGAC
GCTCCTGATTATGACAGAAGCCAGTGGCTGAATGAAAAATTCAAGCTGGGCCTGGACTTT
CCCAATCTGCCCTACTTGATTGATGGGGCTCACAAGATCACCCAGAGCAACGCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000848 (GSTM2)174146 - 319
NM_001142368 (GSTM2)174146 - 319
NM_000850 (GSTM4)174366 - 539
NM_146421 (GSTM1)174130 - 303
NM_000851 (GSTM5)174123 - 296
NM_000561 (GSTM1)174130 - 303
NM_147148 (GSTM4)174366 - 539
Exon 2 To Exon 4 (Pair 3)
Forward (129,20)CCGCCTGCTCCTGGAATACAAmplicon SizecDNA: 172 bpgenomic: 909
Reverse (300,21)GTTGCTCTGGGTGATCTTGTGNr. of Isoforms 9 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.52 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops1.585 kcal/mol
Reverse Dimers-0.18 kcal/mol
Forward-Reverse Dimers-1.153 kcal/mol
Amplicon Folding-1.674 kcal/mol outside primersite
Amplicon SequenceCCGCCTGCTCCTGGAATACACAGACTCAAGCTATGAGGAAAAGAAGTACACGATGGGGGA
CGCTCCTGATTATGACAGAAGCCAGTGGCTGAATGAAAAATTCAAGCTGGGCCTGGACTT
TCCCAATCTGCCCTACTTGATTGATGGGGCTCACAAGATCACCCAGAGCAAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_147148 (GSTM4)172365 - 536
NM_000561 (GSTM1)172129 - 300
NM_000851 (GSTM5)171122 - 292
NM_001142368 (GSTM2)172145 - 316
NM_000849 (GSTM3)171373 - 543
NM_000848 (GSTM2)172145 - 316
NM_146421 (GSTM1)172129 - 300
NM_000850 (GSTM4)172365 - 536
Exon 2 To Exon 4 (Pair 4)
Forward (129,20)CCGCCTGCTCCTGGAATACAAmplicon SizecDNA: 173 bpgenomic: 910
Reverse (301,21)CGTTGCTCTGGGTGATCTTGTNr. of Isoforms 9 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.52 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops1.585 kcal/mol in 3' area
Reverse Dimers-0.18 kcal/mol
Forward-Reverse Dimers-1.153 kcal/mol
Amplicon Folding-1.674 kcal/mol outside primersite
Amplicon SequenceCCGCCTGCTCCTGGAATACACAGACTCAAGCTATGAGGAAAAGAAGTACACGATGGGGGA
CGCTCCTGATTATGACAGAAGCCAGTGGCTGAATGAAAAATTCAAGCTGGGCCTGGACTT
TCCCAATCTGCCCTACTTGATTGATGGGGCTCACAAGATCACCCAGAGCAACG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000849 (GSTM3)171373 - 543
NM_000848 (GSTM2)173145 - 317
NM_001142368 (GSTM2)173145 - 317
NM_146421 (GSTM1)173129 - 301
NM_000850 (GSTM4)173365 - 537
NM_000561 (GSTM1)173129 - 301
NM_147148 (GSTM4)173365 - 537
NM_000851 (GSTM5)171122 - 292
Exon 2 To Exon 4 (Pair 5)
Forward (130,20)CGCCTGCTCCTGGAATACACAmplicon SizecDNA: 175 bpgenomic: 912
Reverse (304,20)TGGCGTTGCTCTGGGTGATCNr. of Isoforms 8 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.52 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops1.665 kcal/mol
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-2.837 kcal/mol
Amplicon Folding-1.674 kcal/mol outside primersite
Amplicon SequenceCGCCTGCTCCTGGAATACACAGACTCAAGCTATGAGGAAAAGAAGTACACGATGGGGGAC
GCTCCTGATTATGACAGAAGCCAGTGGCTGAATGAAAAATTCAAGCTGGGCCTGGACTTT
CCCAATCTGCCCTACTTGATTGATGGGGCTCACAAGATCACCCAGAGCAACGCCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_147148 (GSTM4)175366 - 540
NM_000561 (GSTM1)175130 - 304
NM_000851 (GSTM5)175123 - 297
NM_000850 (GSTM4)175366 - 540
NM_146421 (GSTM1)175130 - 304
NM_000848 (GSTM2)175146 - 320
NM_001142368 (GSTM2)175146 - 320
Exon 2 To Exon 4 (Pair 6)
Forward (129,20)CCGCCTGCTCCTGGAATACAAmplicon SizecDNA: 175 bpgenomic: 912
Reverse (303,20)GGCGTTGCTCTGGGTGATCTNr. of Isoforms 8 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.52 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops1.585 kcal/mol in 3' area
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-2.777 kcal/mol
Amplicon Folding-1.674 kcal/mol outside primersite
Amplicon SequenceCCGCCTGCTCCTGGAATACACAGACTCAAGCTATGAGGAAAAGAAGTACACGATGGGGGA
CGCTCCTGATTATGACAGAAGCCAGTGGCTGAATGAAAAATTCAAGCTGGGCCTGGACTT
TCCCAATCTGCCCTACTTGATTGATGGGGCTCACAAGATCACCCAGAGCAACGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000851 (GSTM5)175122 - 296
NM_000561 (GSTM1)175129 - 303
NM_147148 (GSTM4)175365 - 539
NM_000849 (GSTM3)175373 - 547
NM_001142368 (GSTM2)175145 - 319
NM_000848 (GSTM2)175145 - 319
NM_000850 (GSTM4)175365 - 539
NM_146421 (GSTM1)175129 - 303
Exon 2 To Exon 4 (Pair 7)
Forward (128,20)TCCGCCTGCTCCTGGAATACAmplicon SizecDNA: 173 bpgenomic: 910
Reverse (300,21)GTTGCTCTGGGTGATCTTGTGNr. of Isoforms 9 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.304 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops1.585 kcal/mol
Reverse Dimers-0.18 kcal/mol
Forward-Reverse Dimers-1.153 kcal/mol
Amplicon Folding-1.674 kcal/mol outside primersite
Amplicon SequenceTCCGCCTGCTCCTGGAATACACAGACTCAAGCTATGAGGAAAAGAAGTACACGATGGGGG
ACGCTCCTGATTATGACAGAAGCCAGTGGCTGAATGAAAAATTCAAGCTGGGCCTGGACT
TTCCCAATCTGCCCTACTTGATTGATGGGGCTCACAAGATCACCCAGAGCAAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_146421 (GSTM1)173128 - 300
NM_000850 (GSTM4)173364 - 536
NM_001142368 (GSTM2)173144 - 316
NM_000849 (GSTM3)172372 - 543
NM_000848 (GSTM2)173144 - 316
NM_147148 (GSTM4)173364 - 536
NM_000561 (GSTM1)173128 - 300
NM_000851 (GSTM5)172121 - 292
Exon 2 To Exon 4 (Pair 8)
Forward (128,20)TCCGCCTGCTCCTGGAATACAmplicon SizecDNA: 176 bpgenomic: 913
Reverse (303,20)GGCGTTGCTCTGGGTGATCTNr. of Isoforms 8 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.304 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops1.585 kcal/mol in 3' area
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-2.777 kcal/mol
Amplicon Folding-1.674 kcal/mol outside primersite
Amplicon SequenceTCCGCCTGCTCCTGGAATACACAGACTCAAGCTATGAGGAAAAGAAGTACACGATGGGGG
ACGCTCCTGATTATGACAGAAGCCAGTGGCTGAATGAAAAATTCAAGCTGGGCCTGGACT
TTCCCAATCTGCCCTACTTGATTGATGGGGCTCACAAGATCACCCAGAGCAACGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000851 (GSTM5)176121 - 296
NM_147148 (GSTM4)176364 - 539
NM_000561 (GSTM1)176128 - 303
NM_000850 (GSTM4)176364 - 539
NM_146421 (GSTM1)176128 - 303
NM_000848 (GSTM2)176144 - 319
NM_000849 (GSTM3)176372 - 547
NM_001142368 (GSTM2)176144 - 319
Exon 2 To Exon 4 (Pair 9)
Forward (128,20)TCCGCCTGCTCCTGGAATACAmplicon SizecDNA: 174 bpgenomic: 911
Reverse (301,21)CGTTGCTCTGGGTGATCTTGTNr. of Isoforms 9 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.304 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops1.585 kcal/mol in 3' area
Reverse Dimers-0.18 kcal/mol
Forward-Reverse Dimers-1.153 kcal/mol
Amplicon Folding-1.674 kcal/mol outside primersite
Amplicon SequenceTCCGCCTGCTCCTGGAATACACAGACTCAAGCTATGAGGAAAAGAAGTACACGATGGGGG
ACGCTCCTGATTATGACAGAAGCCAGTGGCTGAATGAAAAATTCAAGCTGGGCCTGGACT
TTCCCAATCTGCCCTACTTGATTGATGGGGCTCACAAGATCACCCAGAGCAACG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000849 (GSTM3)172372 - 543
NM_000848 (GSTM2)174144 - 317
NM_001142368 (GSTM2)174144 - 317
NM_000850 (GSTM4)174364 - 537
NM_146421 (GSTM1)174128 - 301
NM_000851 (GSTM5)172121 - 292
NM_147148 (GSTM4)174364 - 537
NM_000561 (GSTM1)174128 - 301
Exon 2 To Exon 4 (Pair 10)
Forward (129,20)CCGCCTGCTCCTGGAATACAAmplicon SizecDNA: 170 bpgenomic: 907
Reverse (298,21)TGCTCTGGGTGATCTTGTGAGNr. of Isoforms 9 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.52 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops1.585 kcal/mol
Reverse Dimers-0.18 kcal/mol
Forward-Reverse Dimers-1.153 kcal/mol
Amplicon Folding-1.674 kcal/mol outside primersite
Amplicon SequenceCCGCCTGCTCCTGGAATACACAGACTCAAGCTATGAGGAAAAGAAGTACACGATGGGGGA
CGCTCCTGATTATGACAGAAGCCAGTGGCTGAATGAAAAATTCAAGCTGGGCCTGGACTT
TCCCAATCTGCCCTACTTGATTGATGGGGCTCACAAGATCACCCAGAGCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000849 (GSTM3)170373 - 542
NM_000848 (GSTM2)170145 - 314
NM_001142368 (GSTM2)170145 - 314
NM_146421 (GSTM1)170129 - 298
NM_000850 (GSTM4)170365 - 534
NM_147148 (GSTM4)170365 - 534
NM_000561 (GSTM1)170129 - 298
NM_000851 (GSTM5)170122 - 291
Exon 4 To Exon 5 (Pair 1)
Forward (287,20)TCACCCAGAGCAACGCCATCAmplicon SizecDNA: 86 bpgenomic: 181
Reverse (372,21)GTCCACACGAATCTTCTCCTCNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.562 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.518 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceTCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGTGGGGAGA
CAGAAGAGGAGAAGATTCGTGTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)86287 - 372
NM_147148 (GSTM4)86523 - 608
NM_000851 (GSTM5)86280 - 365
NM_000850 (GSTM4)86523 - 608
NM_146421 (GSTM1)86287 - 372
Exon 4 To Exon 5 (Pair 2)
Forward (281,21)ACAAGATCACCCAGAGCAACGAmplicon SizecDNA: 92 bpgenomic: 187
Reverse (372,21)GTCCACACGAATCTTCTCCTCNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGTG
GGGAGACAGAAGAGGAGAAGATTCGTGTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_146421 (GSTM1)92281 - 372
NM_000850 (GSTM4)92517 - 608
NM_000561 (GSTM1)92281 - 372
NM_147148 (GSTM4)92517 - 608
NM_000851 (GSTM5)92274 - 365
Exon 4 To Exon 5 (Pair 3)
Forward (278,21)CTCACAAGATCACCCAGAGCAAmplicon SizecDNA: 86 bpgenomic: 181
Reverse (363,22)AATCTTCTCCTCTTCTGTCTCCNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol in 3' area
Forward Dimers-0.806 kcal/mol
Reverse Loops3.349 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceCTCACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGT
GTGGGGAGACAGAAGAGGAGAAGATT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000850 (GSTM4)86514 - 599
NM_146421 (GSTM1)86278 - 363
NM_000561 (GSTM1)86278 - 363
NM_147148 (GSTM4)86514 - 599
NR_002932 (GSTM2P1)86233 - 318
NM_000851 (GSTM5)86271 - 356
Exon 4 To Exon 5 (Pair 4)
Forward (284,20)AGATCACCCAGAGCAACGCCAmplicon SizecDNA: 82 bpgenomic: 177
Reverse (365,22)CGAATCTTCTCCTCTTCTGTCTNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-0.574 kcal/mol
Forward-Reverse Dimers-1.672 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGTGGGG
AGACAGAAGAGGAGAAGATTCG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_146421 (GSTM1)82284 - 365
NM_000850 (GSTM4)82520 - 601
NM_147148 (GSTM4)82520 - 601
NM_000561 (GSTM1)82284 - 365
NM_000851 (GSTM5)82277 - 358
NR_002932 (GSTM2P1)80239 - 318
Exon 4 To Exon 5 (Pair 5)
Forward (278,21)CTCACAAGATCACCCAGAGCAAmplicon SizecDNA: 89 bpgenomic: 184
Reverse (366,22)ACGAATCTTCTCCTCTTCTGTCNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol in 3' area
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceCTCACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGT
GTGGGGAGACAGAAGAGGAGAAGATTCGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000851 (GSTM5)89271 - 359
NM_147148 (GSTM4)89514 - 602
NM_000561 (GSTM1)89278 - 366
NM_146421 (GSTM1)89278 - 366
NM_000850 (GSTM4)89514 - 602
Exon 4 To Exon 5 (Pair 6)
Forward (281,21)ACAAGATCACCCAGAGCAACGAmplicon SizecDNA: 83 bpgenomic: 178
Reverse (363,22)AATCTTCTCCTCTTCTGTCTCCNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops3.349 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGTG
GGGAGACAGAAGAGGAGAAGATT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000850 (GSTM4)83517 - 599
NM_146421 (GSTM1)83281 - 363
NM_000561 (GSTM1)83281 - 363
NM_147148 (GSTM4)83517 - 599
NR_002932 (GSTM2P1)83236 - 318
NM_000851 (GSTM5)83274 - 356
Exon 4 To Exon 5 (Pair 7)
Forward (281,21)ACAAGATCACCCAGAGCAACGAmplicon SizecDNA: 91 bpgenomic: 186
Reverse (371,22)TCCACACGAATCTTCTCCTCTTNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGTG
GGGAGACAGAAGAGGAGAAGATTCGTGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_146421 (GSTM1)91281 - 371
NM_000850 (GSTM4)91517 - 607
NM_000851 (GSTM5)91274 - 364
NM_000561 (GSTM1)91281 - 371
NM_147148 (GSTM4)91517 - 607
Exon 4 To Exon 5 (Pair 8)
Forward (284,20)AGATCACCCAGAGCAACGCCAmplicon SizecDNA: 89 bpgenomic: 184
Reverse (372,21)GTCCACACGAATCTTCTCCTCNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.549 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGTGGGG
AGACAGAAGAGGAGAAGATTCGTGTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_146421 (GSTM1)89284 - 372
NM_000850 (GSTM4)89520 - 608
NM_000851 (GSTM5)89277 - 365
NM_147148 (GSTM4)89520 - 608
NM_000561 (GSTM1)89284 - 372
Exon 4 To Exon 5 (Pair 9)
Forward (278,21)CTCACAAGATCACCCAGAGCAAmplicon SizecDNA: 90 bpgenomic: 185
Reverse (367,22)CACGAATCTTCTCCTCTTCTGTNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol in 3' area
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceCTCACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGT
GTGGGGAGACAGAAGAGGAGAAGATTCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)90278 - 367
NM_147148 (GSTM4)90514 - 603
NM_000851 (GSTM5)90271 - 360
NM_146421 (GSTM1)90278 - 367
NM_000850 (GSTM4)90514 - 603
Exon 4 To Exon 5 (Pair 10)
Forward (284,20)AGATCACCCAGAGCAACGCCAmplicon SizecDNA: 91 bpgenomic: 186
Reverse (374,22)ATGTCCACACGAATCTTCTCCTNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.811 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.549 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGTGGGG
AGACAGAAGAGGAGAAGATTCGTGTGGACAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_147148 (GSTM4)91520 - 610
NM_000561 (GSTM1)91284 - 374
NM_000851 (GSTM5)91277 - 367
NM_000850 (GSTM4)91520 - 610
NM_146421 (GSTM1)91284 - 374
Exon 4 To Exon 5 (Pair 11)
Forward (281,21)ACAAGATCACCCAGAGCAACGAmplicon SizecDNA: 84 bpgenomic: 179
Reverse (364,22)GAATCTTCTCCTCTTCTGTCTCNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGTG
GGGAGACAGAAGAGGAGAAGATTC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_146421 (GSTM1)84281 - 364
NM_000850 (GSTM4)84517 - 600
NM_147148 (GSTM4)84517 - 600
NM_000561 (GSTM1)84281 - 364
NR_002932 (GSTM2P1)83236 - 318
NM_000851 (GSTM5)84274 - 357
Exon 4 To Exon 5 (Pair 12)
Forward (278,21)CTCACAAGATCACCCAGAGCAAmplicon SizecDNA: 91 bpgenomic: 186
Reverse (368,22)ACACGAATCTTCTCCTCTTCTGNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol in 3' area
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceCTCACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGT
GTGGGGAGACAGAAGAGGAGAAGATTCGTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000850 (GSTM4)91514 - 604
NM_146421 (GSTM1)91278 - 368
NM_000851 (GSTM5)91271 - 361
NM_147148 (GSTM4)91514 - 604
NM_000561 (GSTM1)91278 - 368
Exon 4 To Exon 5 (Pair 13)
Forward (278,21)CTCACAAGATCACCCAGAGCAAmplicon SizecDNA: 92 bpgenomic: 187
Reverse (369,22)CACACGAATCTTCTCCTCTTCTNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol in 3' area
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceCTCACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGT
GTGGGGAGACAGAAGAGGAGAAGATTCGTGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000851 (GSTM5)92271 - 362
NM_000561 (GSTM1)92278 - 369
NM_147148 (GSTM4)92514 - 605
NM_000850 (GSTM4)92514 - 605
NM_146421 (GSTM1)92278 - 369
Exon 4 To Exon 5 (Pair 14)
Forward (281,21)ACAAGATCACCCAGAGCAACGAmplicon SizecDNA: 89 bpgenomic: 184
Reverse (369,22)CACACGAATCTTCTCCTCTTCTNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGTG
GGGAGACAGAAGAGGAGAAGATTCGTGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000850 (GSTM4)89517 - 605
NM_146421 (GSTM1)89281 - 369
NM_000561 (GSTM1)89281 - 369
NM_147148 (GSTM4)89517 - 605
NM_000851 (GSTM5)89274 - 362
Exon 4 To Exon 5 (Pair 15)
Forward (284,20)AGATCACCCAGAGCAACGCCAmplicon SizecDNA: 83 bpgenomic: 178
Reverse (366,22)ACGAATCTTCTCCTCTTCTGTCNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.672 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGTGGGG
AGACAGAAGAGGAGAAGATTCGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000850 (GSTM4)83520 - 602
NM_146421 (GSTM1)83284 - 366
NM_147148 (GSTM4)83520 - 602
NM_000561 (GSTM1)83284 - 366
NM_000851 (GSTM5)83277 - 359
Exon 4 To Exon 5 (Pair 16)
Forward (278,21)CTCACAAGATCACCCAGAGCAAmplicon SizecDNA: 97 bpgenomic: 192
Reverse (374,22)ATGTCCACACGAATCTTCTCCTNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol in 3' area
Forward Dimers-0.806 kcal/mol
Reverse Loops1.811 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceCTCACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGT
GTGGGGAGACAGAAGAGGAGAAGATTCGTGTGGACAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000851 (GSTM5)97271 - 367
NM_147148 (GSTM4)97514 - 610
NM_000561 (GSTM1)97278 - 374
NM_000850 (GSTM4)97514 - 610
NM_146421 (GSTM1)97278 - 374
Exon 4 To Exon 5 (Pair 17)
Forward (281,21)ACAAGATCACCCAGAGCAACGAmplicon SizecDNA: 85 bpgenomic: 180
Reverse (365,22)CGAATCTTCTCCTCTTCTGTCTNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-0.574 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGTG
GGGAGACAGAAGAGGAGAAGATTCG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_146421 (GSTM1)85281 - 365
NM_000850 (GSTM4)85517 - 601
NR_002932 (GSTM2P1)83236 - 318
NM_000851 (GSTM5)85274 - 358
NM_000561 (GSTM1)85281 - 365
NM_147148 (GSTM4)85517 - 601
Exon 4 To Exon 5 (Pair 18)
Forward (280,21)CACAAGATCACCCAGAGCAACAmplicon SizecDNA: 86 bpgenomic: 181
Reverse (365,22)CGAATCTTCTCCTCTTCTGTCTNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-0.574 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceCACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGT
GGGGAGACAGAAGAGGAGAAGATTCG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_146421 (GSTM1)86280 - 365
NM_000850 (GSTM4)86516 - 601
NR_002932 (GSTM2P1)84235 - 318
NM_000851 (GSTM5)86273 - 358
NM_000561 (GSTM1)86280 - 365
NM_147148 (GSTM4)86516 - 601
Exon 4 To Exon 5 (Pair 19)
Forward (287,20)TCACCCAGAGCAACGCCATCAmplicon SizecDNA: 89 bpgenomic: 184
Reverse (375,22)AATGTCCACACGAATCTTCTCCNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.562 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.811 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.518 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceTCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGTGGGGAGA
CAGAAGAGGAGAAGATTCGTGTGGACATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000851 (GSTM5)89280 - 368
NM_147148 (GSTM4)89523 - 611
NM_000561 (GSTM1)89287 - 375
NM_000850 (GSTM4)89523 - 611
NM_146421 (GSTM1)89287 - 375
Exon 4 To Exon 5 (Pair 20)
Forward (280,21)CACAAGATCACCCAGAGCAACAmplicon SizecDNA: 95 bpgenomic: 190
Reverse (374,22)ATGTCCACACGAATCTTCTCCTNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.811 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceCACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGT
GGGGAGACAGAAGAGGAGAAGATTCGTGTGGACAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_146421 (GSTM1)95280 - 374
NM_000850 (GSTM4)95516 - 610
NM_000851 (GSTM5)95273 - 367
NM_147148 (GSTM4)95516 - 610
NM_000561 (GSTM1)95280 - 374
Exon 4 To Exon 5 (Pair 21)
Forward (280,21)CACAAGATCACCCAGAGCAACAmplicon SizecDNA: 93 bpgenomic: 188
Reverse (372,21)GTCCACACGAATCTTCTCCTCNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceCACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGT
GGGGAGACAGAAGAGGAGAAGATTCGTGTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_147148 (GSTM4)93516 - 608
NM_000561 (GSTM1)93280 - 372
NM_000851 (GSTM5)93273 - 365
NM_000850 (GSTM4)93516 - 608
NM_146421 (GSTM1)93280 - 372
Exon 4 To Exon 5 (Pair 22)
Forward (280,21)CACAAGATCACCCAGAGCAACAmplicon SizecDNA: 89 bpgenomic: 184
Reverse (368,22)ACACGAATCTTCTCCTCTTCTGNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceCACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGT
GGGGAGACAGAAGAGGAGAAGATTCGTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000851 (GSTM5)89273 - 361
NM_147148 (GSTM4)89516 - 604
NM_000561 (GSTM1)89280 - 368
NM_000850 (GSTM4)89516 - 604
NM_146421 (GSTM1)89280 - 368
Exon 4 To Exon 5 (Pair 23)
Forward (278,21)CTCACAAGATCACCCAGAGCAAmplicon SizecDNA: 95 bpgenomic: 190
Reverse (372,21)GTCCACACGAATCTTCTCCTCNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol in 3' area
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceCTCACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGT
GTGGGGAGACAGAAGAGGAGAAGATTCGTGTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000851 (GSTM5)95271 - 365
NM_147148 (GSTM4)95514 - 608
NM_000561 (GSTM1)95278 - 372
NM_146421 (GSTM1)95278 - 372
NM_000850 (GSTM4)95514 - 608
Exon 4 To Exon 5 (Pair 24)
Forward (280,21)CACAAGATCACCCAGAGCAACAmplicon SizecDNA: 84 bpgenomic: 179
Reverse (363,22)AATCTTCTCCTCTTCTGTCTCCNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops3.349 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceCACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGT
GGGGAGACAGAAGAGGAGAAGATT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000850 (GSTM4)84516 - 599
NM_146421 (GSTM1)84280 - 363
NR_002932 (GSTM2P1)84235 - 318
NM_000851 (GSTM5)84273 - 356
NM_147148 (GSTM4)84516 - 599
NM_000561 (GSTM1)84280 - 363
Exon 4 To Exon 5 (Pair 25)
Forward (280,21)CACAAGATCACCCAGAGCAACAmplicon SizecDNA: 92 bpgenomic: 187
Reverse (371,22)TCCACACGAATCTTCTCCTCTTNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceCACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGT
GGGGAGACAGAAGAGGAGAAGATTCGTGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000851 (GSTM5)92273 - 364
NM_147148 (GSTM4)92516 - 607
NM_000561 (GSTM1)92280 - 371
NM_146421 (GSTM1)92280 - 371
NM_000850 (GSTM4)92516 - 607
Exon 4 To Exon 5 (Pair 26)
Forward (281,21)ACAAGATCACCCAGAGCAACGAmplicon SizecDNA: 86 bpgenomic: 181
Reverse (366,22)ACGAATCTTCTCCTCTTCTGTCNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGTG
GGGAGACAGAAGAGGAGAAGATTCGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000851 (GSTM5)86274 - 359
NM_147148 (GSTM4)86517 - 602
NM_000561 (GSTM1)86281 - 366
NM_000850 (GSTM4)86517 - 602
NM_146421 (GSTM1)86281 - 366
Exon 4 To Exon 5 (Pair 27)
Forward (284,20)AGATCACCCAGAGCAACGCCAmplicon SizecDNA: 84 bpgenomic: 179
Reverse (367,22)CACGAATCTTCTCCTCTTCTGTNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.672 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGTGGGG
AGACAGAAGAGGAGAAGATTCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000850 (GSTM4)84520 - 603
NM_146421 (GSTM1)84284 - 367
NM_000851 (GSTM5)84277 - 360
NM_000561 (GSTM1)84284 - 367
NM_147148 (GSTM4)84520 - 603
Exon 4 To Exon 5 (Pair 28)
Forward (281,21)ACAAGATCACCCAGAGCAACGAmplicon SizecDNA: 88 bpgenomic: 183
Reverse (368,22)ACACGAATCTTCTCCTCTTCTGNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGTG
GGGAGACAGAAGAGGAGAAGATTCGTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000850 (GSTM4)88517 - 604
NM_146421 (GSTM1)88281 - 368
NM_000851 (GSTM5)88274 - 361
NM_147148 (GSTM4)88517 - 604
NM_000561 (GSTM1)88281 - 368
Exon 4 To Exon 5 (Pair 29)
Forward (280,21)CACAAGATCACCCAGAGCAACAmplicon SizecDNA: 88 bpgenomic: 183
Reverse (367,22)CACGAATCTTCTCCTCTTCTGTNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceCACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGT
GGGGAGACAGAAGAGGAGAAGATTCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000851 (GSTM5)88273 - 360
NM_000561 (GSTM1)88280 - 367
NM_147148 (GSTM4)88516 - 603
NM_146421 (GSTM1)88280 - 367
NM_000850 (GSTM4)88516 - 603
Exon 4 To Exon 5 (Pair 30)
Forward (284,20)AGATCACCCAGAGCAACGCCAmplicon SizecDNA: 92 bpgenomic: 187
Reverse (375,22)AATGTCCACACGAATCTTCTCCNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.811 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.549 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGTGGGG
AGACAGAAGAGGAGAAGATTCGTGTGGACATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_146421 (GSTM1)92284 - 375
NM_000850 (GSTM4)92520 - 611
NM_000851 (GSTM5)92277 - 368
NM_147148 (GSTM4)92520 - 611
NM_000561 (GSTM1)92284 - 375
Exon 4 To Exon 5 (Pair 31)
Forward (281,21)ACAAGATCACCCAGAGCAACGAmplicon SizecDNA: 94 bpgenomic: 189
Reverse (374,22)ATGTCCACACGAATCTTCTCCTNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.811 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGTG
GGGAGACAGAAGAGGAGAAGATTCGTGTGGACAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000851 (GSTM5)94274 - 367
NM_000561 (GSTM1)94281 - 374
NM_147148 (GSTM4)94517 - 610
NM_000850 (GSTM4)94517 - 610
NM_146421 (GSTM1)94281 - 374
Exon 4 To Exon 5 (Pair 32)
Forward (285,20)GATCACCCAGAGCAACGCCAAmplicon SizecDNA: 83 bpgenomic: 178
Reverse (367,22)CACGAATCTTCTCCTCTTCTGTNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.672 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGTGGGGA
GACAGAAGAGGAGAAGATTCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_146421 (GSTM1)83285 - 367
NM_000850 (GSTM4)83521 - 603
NM_147148 (GSTM4)83521 - 603
NM_000561 (GSTM1)83285 - 367
NM_000851 (GSTM5)83278 - 360
Exon 4 To Exon 5 (Pair 33)
Forward (280,21)CACAAGATCACCCAGAGCAACAmplicon SizecDNA: 90 bpgenomic: 185
Reverse (369,22)CACACGAATCTTCTCCTCTTCTNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceCACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGT
GGGGAGACAGAAGAGGAGAAGATTCGTGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_146421 (GSTM1)90280 - 369
NM_000850 (GSTM4)90516 - 605
NM_000851 (GSTM5)90273 - 362
NM_000561 (GSTM1)90280 - 369
NM_147148 (GSTM4)90516 - 605
Exon 4 To Exon 5 (Pair 34)
Forward (280,21)CACAAGATCACCCAGAGCAACAmplicon SizecDNA: 87 bpgenomic: 182
Reverse (366,22)ACGAATCTTCTCCTCTTCTGTCNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceCACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGT
GGGGAGACAGAAGAGGAGAAGATTCGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000851 (GSTM5)87273 - 359
NM_000561 (GSTM1)87280 - 366
NM_147148 (GSTM4)87516 - 602
NM_146421 (GSTM1)87280 - 366
NM_000850 (GSTM4)87516 - 602
Exon 4 To Exon 5 (Pair 35)
Forward (278,21)CTCACAAGATCACCCAGAGCAAmplicon SizecDNA: 87 bpgenomic: 182
Reverse (364,22)GAATCTTCTCCTCTTCTGTCTCNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol in 3' area
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceCTCACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGT
GTGGGGAGACAGAAGAGGAGAAGATTC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000851 (GSTM5)87271 - 357
NR_002932 (GSTM2P1)86233 - 318
NM_000561 (GSTM1)87278 - 364
NM_147148 (GSTM4)87514 - 600
NM_146421 (GSTM1)87278 - 364
NM_000850 (GSTM4)87514 - 600
Exon 4 To Exon 5 (Pair 36)
Forward (278,21)CTCACAAGATCACCCAGAGCAAmplicon SizecDNA: 94 bpgenomic: 189
Reverse (371,22)TCCACACGAATCTTCTCCTCTTNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol in 3' area
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceCTCACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGT
GTGGGGAGACAGAAGAGGAGAAGATTCGTGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000850 (GSTM4)94514 - 607
NM_146421 (GSTM1)94278 - 371
NM_147148 (GSTM4)94514 - 607
NM_000561 (GSTM1)94278 - 371
NM_000851 (GSTM5)94271 - 364
Exon 4 To Exon 5 (Pair 37)
Forward (287,20)TCACCCAGAGCAACGCCATCAmplicon SizecDNA: 88 bpgenomic: 183
Reverse (374,22)ATGTCCACACGAATCTTCTCCTNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.562 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.811 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.518 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceTCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGTGGGGAGA
CAGAAGAGGAGAAGATTCGTGTGGACAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_146421 (GSTM1)88287 - 374
NM_000850 (GSTM4)88523 - 610
NM_147148 (GSTM4)88523 - 610
NM_000561 (GSTM1)88287 - 374
NM_000851 (GSTM5)88280 - 367
Exon 4 To Exon 5 (Pair 38)
Forward (280,21)CACAAGATCACCCAGAGCAACAmplicon SizecDNA: 85 bpgenomic: 180
Reverse (364,22)GAATCTTCTCCTCTTCTGTCTCNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceCACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGT
GGGGAGACAGAAGAGGAGAAGATTC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000561 (GSTM1)85280 - 364
NM_147148 (GSTM4)85516 - 600
NM_000851 (GSTM5)85273 - 357
NR_002932 (GSTM2P1)84235 - 318
NM_000850 (GSTM4)85516 - 600
NM_146421 (GSTM1)85280 - 364
Exon 4 To Exon 5 (Pair 39)
Forward (285,20)GATCACCCAGAGCAACGCCAAmplicon SizecDNA: 82 bpgenomic: 177
Reverse (366,22)ACGAATCTTCTCCTCTTCTGTCNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.672 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGTGGGGA
GACAGAAGAGGAGAAGATTCGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000850 (GSTM4)82521 - 602
NM_146421 (GSTM1)82285 - 366
NM_000561 (GSTM1)82285 - 366
NM_147148 (GSTM4)82521 - 602
NM_000851 (GSTM5)82278 - 359
Exon 4 To Exon 5 (Pair 40)
Forward (278,21)CTCACAAGATCACCCAGAGCAAmplicon SizecDNA: 88 bpgenomic: 183
Reverse (365,22)CGAATCTTCTCCTCTTCTGTCTNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol in 3' area
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-0.574 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceCTCACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGT
GTGGGGAGACAGAAGAGGAGAAGATTCG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000851 (GSTM5)88271 - 358
NR_002932 (GSTM2P1)86233 - 318
NM_147148 (GSTM4)88514 - 601
NM_000561 (GSTM1)88278 - 365
NM_000850 (GSTM4)88514 - 601
NM_146421 (GSTM1)88278 - 365
Exon 4 To Exon 5 (Pair 41)
Forward (281,21)ACAAGATCACCCAGAGCAACGAmplicon SizecDNA: 87 bpgenomic: 182
Reverse (367,22)CACGAATCTTCTCCTCTTCTGTNr. of Isoforms 5 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.983 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.229 kcal/mol outside primersite
Amplicon SequenceACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATTGCCCGCAAGCACAACCTGTGTG
GGGAGACAGAAGAGGAGAAGATTCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)87281 - 367
NM_147148 (GSTM4)87517 - 603
NM_000851 (GSTM5)87274 - 360
NM_000850 (GSTM4)87517 - 603
NM_146421 (GSTM1)87281 - 367
Exon 6 To Exon 7 (Pair 1)
Forward (486,21)GCTCTACTCAGAGTTTCTGGGAmplicon SizecDNA: 104 bpgenomic: 191
Reverse (589,22)CAAATATACGGTGGAGGTCAAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.516 kcal/mol in 3' area
Forward Dimers-2.762 kcal/mol
Reverse Loops1.897 kcal/mol in 3' area
Reverse Dimers-0.416 kcal/mol
Forward-Reverse Dimers-0.865 kcal/mol
Amplicon Folding0.355 kcal/mol inside primersite
Amplicon SequenceGCTCTACTCAGAGTTTCTGGGGAAGCGGCCATGGTTTGCAGGAAACAAGATCACTTTTGT
AGATTTTCTCGTCTATGATGTCCTTGACCTCCACCGTATATTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)104486 - 589
Exon 6 To Exon 7 (Pair 2)
Forward (484,22)AAGCTCTACTCAGAGTTTCTGGAmplicon SizecDNA: 110 bpgenomic: 197
Reverse (593,21)GGCTCAAATATACGGTGGAGGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.581 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops2.055 kcal/mol in 3' area
Reverse Dimers-0.416 kcal/mol
Forward-Reverse Dimers-1.9 kcal/mol
Amplicon Folding0.355 kcal/mol inside primersite
Amplicon SequenceAAGCTCTACTCAGAGTTTCTGGGGAAGCGGCCATGGTTTGCAGGAAACAAGATCACTTTT
GTAGATTTTCTCGTCTATGATGTCCTTGACCTCCACCGTATATTTGAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)110484 - 593
Exon 6 To Exon 7 (Pair 3)
Forward (486,21)GCTCTACTCAGAGTTTCTGGGAmplicon SizecDNA: 109 bpgenomic: 196
Reverse (594,21)GGGCTCAAATATACGGTGGAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.516 kcal/mol in 3' area
Forward Dimers-2.762 kcal/mol
Reverse Loops2.217 kcal/mol in 3' area
Reverse Dimers-0.416 kcal/mol
Forward-Reverse Dimers-0.94 kcal/mol
Amplicon Folding0.355 kcal/mol inside primersite
Amplicon SequenceGCTCTACTCAGAGTTTCTGGGGAAGCGGCCATGGTTTGCAGGAAACAAGATCACTTTTGT
AGATTTTCTCGTCTATGATGTCCTTGACCTCCACCGTATATTTGAGCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)109486 - 594
Exon 6 To Exon 7 (Pair 4)
Forward (486,21)GCTCTACTCAGAGTTTCTGGGAmplicon SizecDNA: 103 bpgenomic: 190
Reverse (588,22)AAATATACGGTGGAGGTCAAGGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.516 kcal/mol in 3' area
Forward Dimers-2.762 kcal/mol
Reverse Loops1.897 kcal/mol in 3' area
Reverse Dimers-0.416 kcal/mol
Forward-Reverse Dimers-0.865 kcal/mol
Amplicon Folding0.355 kcal/mol inside primersite
Amplicon SequenceGCTCTACTCAGAGTTTCTGGGGAAGCGGCCATGGTTTGCAGGAAACAAGATCACTTTTGT
AGATTTTCTCGTCTATGATGTCCTTGACCTCCACCGTATATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)103486 - 588
Exon 6 To Exon 7 (Pair 5)
Forward (484,22)AAGCTCTACTCAGAGTTTCTGGAmplicon SizecDNA: 106 bpgenomic: 193
Reverse (589,22)CAAATATACGGTGGAGGTCAAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.581 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.897 kcal/mol in 3' area
Reverse Dimers-0.416 kcal/mol
Forward-Reverse Dimers-0.865 kcal/mol
Amplicon Folding0.355 kcal/mol inside primersite
Amplicon SequenceAAGCTCTACTCAGAGTTTCTGGGGAAGCGGCCATGGTTTGCAGGAAACAAGATCACTTTT
GTAGATTTTCTCGTCTATGATGTCCTTGACCTCCACCGTATATTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)106484 - 589
Exon 6 To Exon 7 (Pair 6)
Forward (486,21)GCTCTACTCAGAGTTTCTGGGAmplicon SizecDNA: 108 bpgenomic: 195
Reverse (593,21)GGCTCAAATATACGGTGGAGGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.516 kcal/mol in 3' area
Forward Dimers-2.762 kcal/mol
Reverse Loops2.055 kcal/mol in 3' area
Reverse Dimers-0.416 kcal/mol
Forward-Reverse Dimers-0.94 kcal/mol
Amplicon Folding0.355 kcal/mol inside primersite
Amplicon SequenceGCTCTACTCAGAGTTTCTGGGGAAGCGGCCATGGTTTGCAGGAAACAAGATCACTTTTGT
AGATTTTCTCGTCTATGATGTCCTTGACCTCCACCGTATATTTGAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)108486 - 593
Exon 6 To Exon 7 (Pair 7)
Forward (486,21)GCTCTACTCAGAGTTTCTGGGAmplicon SizecDNA: 102 bpgenomic: 189
Reverse (587,22)AATATACGGTGGAGGTCAAGGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.516 kcal/mol in 3' area
Forward Dimers-2.762 kcal/mol
Reverse Loops1.897 kcal/mol in 3' area
Reverse Dimers-0.416 kcal/mol
Forward-Reverse Dimers-0.865 kcal/mol
Amplicon Folding0.355 kcal/mol inside primersite
Amplicon SequenceGCTCTACTCAGAGTTTCTGGGGAAGCGGCCATGGTTTGCAGGAAACAAGATCACTTTTGT
AGATTTTCTCGTCTATGATGTCCTTGACCTCCACCGTATATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)102486 - 587
Exon 6 To Exon 7 (Pair 8)
Forward (484,22)AAGCTCTACTCAGAGTTTCTGGAmplicon SizecDNA: 104 bpgenomic: 191
Reverse (587,22)AATATACGGTGGAGGTCAAGGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.581 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.897 kcal/mol in 3' area
Reverse Dimers-0.416 kcal/mol
Forward-Reverse Dimers-0.865 kcal/mol
Amplicon Folding0.355 kcal/mol inside primersite
Amplicon SequenceAAGCTCTACTCAGAGTTTCTGGGGAAGCGGCCATGGTTTGCAGGAAACAAGATCACTTTT
GTAGATTTTCTCGTCTATGATGTCCTTGACCTCCACCGTATATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)104484 - 587
Exon 6 To Exon 7 (Pair 9)
Forward (486,21)GCTCTACTCAGAGTTTCTGGGAmplicon SizecDNA: 114 bpgenomic: 201
Reverse (599,22)CACTTGGGCTCAAATATACGGTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.516 kcal/mol in 3' area
Forward Dimers-2.762 kcal/mol
Reverse Loops1.667 kcal/mol
Reverse Dimers-2.52 kcal/mol
Forward-Reverse Dimers-1.809 kcal/mol
Amplicon Folding0.355 kcal/mol inside primersite
Amplicon SequenceGCTCTACTCAGAGTTTCTGGGGAAGCGGCCATGGTTTGCAGGAAACAAGATCACTTTTGT
AGATTTTCTCGTCTATGATGTCCTTGACCTCCACCGTATATTTGAGCCCAAGTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NR_002932 (GSTM2P1)114441 - 554
NM_000851 (GSTM5)114479 - 592
NM_000561 (GSTM1)114486 - 599
Exon 6 To Exon 7 (Pair 10)
Forward (484,22)AAGCTCTACTCAGAGTTTCTGGAmplicon SizecDNA: 102 bpgenomic: 189
Reverse (585,21)TATACGGTGGAGGTCAAGGACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.581 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.744 kcal/mol in 3' area
Reverse Dimers-0.36 kcal/mol
Forward-Reverse Dimers-0.865 kcal/mol
Amplicon Folding0.355 kcal/mol inside primersite
Amplicon SequenceAAGCTCTACTCAGAGTTTCTGGGGAAGCGGCCATGGTTTGCAGGAAACAAGATCACTTTT
GTAGATTTTCTCGTCTATGATGTCCTTGACCTCCACCGTATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)102484 - 585
Exon 6 To Exon 7 (Pair 11)
Forward (486,21)GCTCTACTCAGAGTTTCTGGGAmplicon SizecDNA: 100 bpgenomic: 187
Reverse (585,21)TATACGGTGGAGGTCAAGGACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.516 kcal/mol in 3' area
Forward Dimers-2.762 kcal/mol
Reverse Loops1.744 kcal/mol in 3' area
Reverse Dimers-0.36 kcal/mol
Forward-Reverse Dimers-0.865 kcal/mol
Amplicon Folding0.355 kcal/mol inside primersite
Amplicon SequenceGCTCTACTCAGAGTTTCTGGGGAAGCGGCCATGGTTTGCAGGAAACAAGATCACTTTTGT
AGATTTTCTCGTCTATGATGTCCTTGACCTCCACCGTATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)100486 - 585
Exon 6 To Exon 7 (Pair 12)
Forward (484,22)AAGCTCTACTCAGAGTTTCTGGAmplicon SizecDNA: 113 bpgenomic: 200
Reverse (596,22)TTGGGCTCAAATATACGGTGGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.581 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.667 kcal/mol
Reverse Dimers-2.52 kcal/mol
Forward-Reverse Dimers-2.089 kcal/mol
Amplicon Folding0.355 kcal/mol inside primersite
Amplicon SequenceAAGCTCTACTCAGAGTTTCTGGGGAAGCGGCCATGGTTTGCAGGAAACAAGATCACTTTT
GTAGATTTTCTCGTCTATGATGTCCTTGACCTCCACCGTATATTTGAGCCCAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000851 (GSTM5)113477 - 589
NM_000561 (GSTM1)113484 - 596
Exon 6 To Exon 7 (Pair 13)
Forward (484,22)AAGCTCTACTCAGAGTTTCTGGAmplicon SizecDNA: 115 bpgenomic: 202
Reverse (598,22)ACTTGGGCTCAAATATACGGTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.581 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.667 kcal/mol
Reverse Dimers-2.52 kcal/mol
Forward-Reverse Dimers-2.089 kcal/mol
Amplicon Folding0.355 kcal/mol inside primersite
Amplicon SequenceAAGCTCTACTCAGAGTTTCTGGGGAAGCGGCCATGGTTTGCAGGAAACAAGATCACTTTT
GTAGATTTTCTCGTCTATGATGTCCTTGACCTCCACCGTATATTTGAGCCCAAGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000851 (GSTM5)115477 - 591
NM_000561 (GSTM1)115484 - 598
Exon 6 To Exon 7 (Pair 14)
Forward (486,21)GCTCTACTCAGAGTTTCTGGGAmplicon SizecDNA: 111 bpgenomic: 198
Reverse (596,22)TTGGGCTCAAATATACGGTGGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.516 kcal/mol in 3' area
Forward Dimers-2.762 kcal/mol
Reverse Loops1.667 kcal/mol
Reverse Dimers-2.52 kcal/mol
Forward-Reverse Dimers-0.94 kcal/mol
Amplicon Folding0.355 kcal/mol inside primersite
Amplicon SequenceGCTCTACTCAGAGTTTCTGGGGAAGCGGCCATGGTTTGCAGGAAACAAGATCACTTTTGT
AGATTTTCTCGTCTATGATGTCCTTGACCTCCACCGTATATTTGAGCCCAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000561 (GSTM1)111486 - 596
NM_000851 (GSTM5)111479 - 589
Exon 6 To Exon 7 (Pair 15)
Forward (484,22)AAGCTCTACTCAGAGTTTCTGGAmplicon SizecDNA: 105 bpgenomic: 192
Reverse (588,22)AAATATACGGTGGAGGTCAAGGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.581 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.897 kcal/mol in 3' area
Reverse Dimers-0.416 kcal/mol
Forward-Reverse Dimers-0.865 kcal/mol
Amplicon Folding0.355 kcal/mol inside primersite
Amplicon SequenceAAGCTCTACTCAGAGTTTCTGGGGAAGCGGCCATGGTTTGCAGGAAACAAGATCACTTTT
GTAGATTTTCTCGTCTATGATGTCCTTGACCTCCACCGTATATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)105484 - 588
Exon 6 To Exon 7 (Pair 16)
Forward (484,22)AAGCTCTACTCAGAGTTTCTGGAmplicon SizecDNA: 111 bpgenomic: 198
Reverse (594,21)GGGCTCAAATATACGGTGGAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.581 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops2.217 kcal/mol in 3' area
Reverse Dimers-0.416 kcal/mol
Forward-Reverse Dimers-1.917 kcal/mol
Amplicon Folding0.355 kcal/mol inside primersite
Amplicon SequenceAAGCTCTACTCAGAGTTTCTGGGGAAGCGGCCATGGTTTGCAGGAAACAAGATCACTTTT
GTAGATTTTCTCGTCTATGATGTCCTTGACCTCCACCGTATATTTGAGCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)111484 - 594
Exon 6 To Exon 7 (Pair 17)
Forward (486,21)GCTCTACTCAGAGTTTCTGGGAmplicon SizecDNA: 116 bpgenomic: 203
Reverse (601,22)AGCACTTGGGCTCAAATATACGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.516 kcal/mol in 3' area
Forward Dimers-2.762 kcal/mol
Reverse Loops0.545 kcal/mol
Reverse Dimers-2.52 kcal/mol
Forward-Reverse Dimers-1.809 kcal/mol
Amplicon Folding0.355 kcal/mol inside primersite
Amplicon SequenceGCTCTACTCAGAGTTTCTGGGGAAGCGGCCATGGTTTGCAGGAAACAAGATCACTTTTGT
AGATTTTCTCGTCTATGATGTCCTTGACCTCCACCGTATATTTGAGCCCAAGTGCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NR_002932 (GSTM2P1)114441 - 554
NM_000851 (GSTM5)116479 - 594
NM_000561 (GSTM1)116486 - 601
Exon 6 To Exon 7 (Pair 18)
Forward (484,22)AAGCTCTACTCAGAGTTTCTGGAmplicon SizecDNA: 118 bpgenomic: 205
Reverse (601,22)AGCACTTGGGCTCAAATATACGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.581 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops0.545 kcal/mol
Reverse Dimers-2.52 kcal/mol
Forward-Reverse Dimers-2.089 kcal/mol
Amplicon Folding0.355 kcal/mol inside primersite
Amplicon SequenceAAGCTCTACTCAGAGTTTCTGGGGAAGCGGCCATGGTTTGCAGGAAACAAGATCACTTTT
GTAGATTTTCTCGTCTATGATGTCCTTGACCTCCACCGTATATTTGAGCCCAAGTGCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000561 (GSTM1)118484 - 601
NR_002932 (GSTM2P1)116439 - 554
NM_000851 (GSTM5)118477 - 594
Exon 6 To Exon 7 (Pair 19)
Forward (486,21)GCTCTACTCAGAGTTTCTGGGAmplicon SizecDNA: 113 bpgenomic: 200
Reverse (598,22)ACTTGGGCTCAAATATACGGTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.516 kcal/mol in 3' area
Forward Dimers-2.762 kcal/mol
Reverse Loops1.667 kcal/mol
Reverse Dimers-2.52 kcal/mol
Forward-Reverse Dimers-1.335 kcal/mol
Amplicon Folding0.355 kcal/mol inside primersite
Amplicon SequenceGCTCTACTCAGAGTTTCTGGGGAAGCGGCCATGGTTTGCAGGAAACAAGATCACTTTTGT
AGATTTTCTCGTCTATGATGTCCTTGACCTCCACCGTATATTTGAGCCCAAGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NR_002932 (GSTM2P1)113441 - 553
NM_000851 (GSTM5)113479 - 591
NM_000561 (GSTM1)113486 - 598
Exon 6 To Exon 7 (Pair 20)
Forward (484,22)AAGCTCTACTCAGAGTTTCTGGAmplicon SizecDNA: 116 bpgenomic: 203
Reverse (599,22)CACTTGGGCTCAAATATACGGTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.581 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.667 kcal/mol
Reverse Dimers-2.52 kcal/mol
Forward-Reverse Dimers-2.089 kcal/mol
Amplicon Folding0.355 kcal/mol inside primersite
Amplicon SequenceAAGCTCTACTCAGAGTTTCTGGGGAAGCGGCCATGGTTTGCAGGAAACAAGATCACTTTT
GTAGATTTTCTCGTCTATGATGTCCTTGACCTCCACCGTATATTTGAGCCCAAGTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000851 (GSTM5)116477 - 592
NR_002932 (GSTM2P1)116439 - 554
NM_000561 (GSTM1)116484 - 599
Exon 7 To Exon 8 (Pair 1)
Forward (567,22)CCTTGACCTCCACCGTATATTTAmplicon SizecDNA: 176 bpgenomic: 2,817
Reverse (742,20)CAAGGCCCTACTTGTTGCCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2 kcal/mol
Forward Dimers0.08 kcal/mol in 3' area
Reverse Loops0.623 kcal/mol in 3' area
Reverse Dimers-2.658 kcal/mol
Forward-Reverse Dimers-2.354 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceCCTTGACCTCCACCGTATATTTGAGCCCAAGTGCTTGGACGCCTTCCCAAATCTGAAGGA
CTTCATCTCCCGCTTTGAGGGCTTGGAGAAGATCTCTGCCTACATGAAGTCCAGCCGCTT
CCTCCCAAGACCTGTGTTCTCAAAGATGGCTGTCTGGGGCAACAAGTAGGGCCTTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000561 (GSTM1)176567 - 742
Exon 7 To Exon 8 (Pair 2)
Forward (570,22)TGACCTCCACCGTATATTTGAGAmplicon SizecDNA: 173 bpgenomic: 2,814
Reverse (742,20)CAAGGCCCTACTTGTTGCCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.071 kcal/mol
Forward Dimers0.08 kcal/mol
Reverse Loops0.623 kcal/mol in 3' area
Reverse Dimers-2.658 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceTGACCTCCACCGTATATTTGAGCCCAAGTGCTTGGACGCCTTCCCAAATCTGAAGGACTT
CATCTCCCGCTTTGAGGGCTTGGAGAAGATCTCTGCCTACATGAAGTCCAGCCGCTTCCT
CCCAAGACCTGTGTTCTCAAAGATGGCTGTCTGGGGCAACAAGTAGGGCCTTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000561 (GSTM1)173570 - 742
Exon 7 To Exon 8 (Pair 3)
Forward (568,22)CTTGACCTCCACCGTATATTTGAmplicon SizecDNA: 175 bpgenomic: 2,816
Reverse (742,20)CAAGGCCCTACTTGTTGCCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2 kcal/mol
Forward Dimers0.08 kcal/mol in 3' area
Reverse Loops0.623 kcal/mol in 3' area
Reverse Dimers-2.658 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceCTTGACCTCCACCGTATATTTGAGCCCAAGTGCTTGGACGCCTTCCCAAATCTGAAGGAC
TTCATCTCCCGCTTTGAGGGCTTGGAGAAGATCTCTGCCTACATGAAGTCCAGCCGCTTC
CTCCCAAGACCTGTGTTCTCAAAGATGGCTGTCTGGGGCAACAAGTAGGGCCTTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000561 (GSTM1)175568 - 742
Exon 7 To Exon 8 (Pair 4)
Forward (566,22)TCCTTGACCTCCACCGTATATTAmplicon SizecDNA: 154 bpgenomic: 2,795
Reverse (719,22)ACAGCCATCTTTGAGAACACAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2 kcal/mol
Forward Dimers0.08 kcal/mol in 3' area
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-0.866 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceTCCTTGACCTCCACCGTATATTTGAGCCCAAGTGCTTGGACGCCTTCCCAAATCTGAAGG
ACTTCATCTCCCGCTTTGAGGGCTTGGAGAAGATCTCTGCCTACATGAAGTCCAGCCGCT
TCCTCCCAAGACCTGTGTTCTCAAAGATGGCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)154566 - 719
Exon 7 To Exon 8 (Pair 5)
Forward (566,22)TCCTTGACCTCCACCGTATATTAmplicon SizecDNA: 155 bpgenomic: 2,796
Reverse (720,22)GACAGCCATCTTTGAGAACACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2 kcal/mol
Forward Dimers0.08 kcal/mol in 3' area
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-0.866 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceTCCTTGACCTCCACCGTATATTTGAGCCCAAGTGCTTGGACGCCTTCCCAAATCTGAAGG
ACTTCATCTCCCGCTTTGAGGGCTTGGAGAAGATCTCTGCCTACATGAAGTCCAGCCGCT
TCCTCCCAAGACCTGTGTTCTCAAAGATGGCTGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)155566 - 720
Exon 7 To Exon 8 (Pair 6)
Forward (602,21)TGGACGCCTTCCCAAATCTGAAmplicon SizecDNA: 119 bpgenomic: 2,760
Reverse (720,22)GACAGCCATCTTTGAGAACACANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.838 kcal/mol
Forward Dimers-0.875 kcal/mol
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-1.427 kcal/mol
Amplicon Folding-1.514 kcal/mol outside primersite
Amplicon SequenceTGGACGCCTTCCCAAATCTGAAGGACTTCATCTCCCGCTTTGAGGGCTTGGAGAAGATCT
CTGCCTACATGAAGTCCAGCCGCTTCCTCCCAAGACCTGTGTTCTCAAAGATGGCTGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)119602 - 720
NR_002932 (GSTM2P1)116557 - 672
Exon 7 To Exon 8 (Pair 7)
Forward (550,23)TTTCTCGTCTATGATGTCCTTGAAmplicon SizecDNA: 170 bpgenomic: 2,811
Reverse (719,22)ACAGCCATCTTTGAGAACACAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.208 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-1.328 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceTTTCTCGTCTATGATGTCCTTGACCTCCACCGTATATTTGAGCCCAAGTGCTTGGACGCC
TTCCCAAATCTGAAGGACTTCATCTCCCGCTTTGAGGGCTTGGAGAAGATCTCTGCCTAC
ATGAAGTCCAGCCGCTTCCTCCCAAGACCTGTGTTCTCAAAGATGGCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)170550 - 719
Exon 7 To Exon 8 (Pair 8)
Forward (595,20)AAGTGCTTGGACGCCTTCCCAmplicon SizecDNA: 125 bpgenomic: 2,766
Reverse (719,22)ACAGCCATCTTTGAGAACACAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.838 kcal/mol in 3' area
Forward Dimers-1.093 kcal/mol
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.514 kcal/mol outside primersite
Amplicon SequenceAAGTGCTTGGACGCCTTCCCAAATCTGAAGGACTTCATCTCCCGCTTTGAGGGCTTGGAG
AAGATCTCTGCCTACATGAAGTCCAGCCGCTTCCTCCCAAGACCTGTGTTCTCAAAGATG
GCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002932 (GSTM2P1)122550 - 671
NM_000561 (GSTM1)125595 - 719
Exon 7 To Exon 8 (Pair 9)
Forward (565,21)GTCCTTGACCTCCACCGTATAAmplicon SizecDNA: 156 bpgenomic: 2,797
Reverse (720,22)GACAGCCATCTTTGAGAACACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.916 kcal/mol
Forward Dimers0.369 kcal/mol
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-0.866 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceGTCCTTGACCTCCACCGTATATTTGAGCCCAAGTGCTTGGACGCCTTCCCAAATCTGAAG
GACTTCATCTCCCGCTTTGAGGGCTTGGAGAAGATCTCTGCCTACATGAAGTCCAGCCGC
TTCCTCCCAAGACCTGTGTTCTCAAAGATGGCTGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)156565 - 720
Exon 7 To Exon 8 (Pair 10)
Forward (567,22)CCTTGACCTCCACCGTATATTTAmplicon SizecDNA: 154 bpgenomic: 2,795
Reverse (720,22)GACAGCCATCTTTGAGAACACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2 kcal/mol
Forward Dimers0.08 kcal/mol in 3' area
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-0.866 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceCCTTGACCTCCACCGTATATTTGAGCCCAAGTGCTTGGACGCCTTCCCAAATCTGAAGGA
CTTCATCTCCCGCTTTGAGGGCTTGGAGAAGATCTCTGCCTACATGAAGTCCAGCCGCTT
CCTCCCAAGACCTGTGTTCTCAAAGATGGCTGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)154567 - 720
Exon 7 To Exon 8 (Pair 11)
Forward (568,22)CTTGACCTCCACCGTATATTTGAmplicon SizecDNA: 153 bpgenomic: 2,794
Reverse (720,22)GACAGCCATCTTTGAGAACACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2 kcal/mol
Forward Dimers0.08 kcal/mol in 3' area
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-0.866 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceCTTGACCTCCACCGTATATTTGAGCCCAAGTGCTTGGACGCCTTCCCAAATCTGAAGGAC
TTCATCTCCCGCTTTGAGGGCTTGGAGAAGATCTCTGCCTACATGAAGTCCAGCCGCTTC
CTCCCAAGACCTGTGTTCTCAAAGATGGCTGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)153568 - 720
Exon 7 To Exon 8 (Pair 12)
Forward (594,20)CAAGTGCTTGGACGCCTTCCAmplicon SizecDNA: 127 bpgenomic: 2,768
Reverse (720,22)GACAGCCATCTTTGAGAACACANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.957 kcal/mol in 3' area
Forward Dimers-1.765 kcal/mol
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.514 kcal/mol outside primersite
Amplicon SequenceCAAGTGCTTGGACGCCTTCCCAAATCTGAAGGACTTCATCTCCCGCTTTGAGGGCTTGGA
GAAGATCTCTGCCTACATGAAGTCCAGCCGCTTCCTCCCAAGACCTGTGTTCTCAAAGAT
GGCTGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002932 (GSTM2P1)124549 - 672
NM_000561 (GSTM1)127594 - 720
Exon 7 To Exon 8 (Pair 13)
Forward (570,22)TGACCTCCACCGTATATTTGAGAmplicon SizecDNA: 175 bpgenomic: 2,816
Reverse (744,21)TTCAAGGCCCTACTTGTTGCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.071 kcal/mol
Forward Dimers0.08 kcal/mol
Reverse Loops0.742 kcal/mol in 3' area
Reverse Dimers-2.658 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceTGACCTCCACCGTATATTTGAGCCCAAGTGCTTGGACGCCTTCCCAAATCTGAAGGACTT
CATCTCCCGCTTTGAGGGCTTGGAGAAGATCTCTGCCTACATGAAGTCCAGCCGCTTCCT
CCCAAGACCTGTGTTCTCAAAGATGGCTGTCTGGGGCAACAAGTAGGGCCTTGAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000561 (GSTM1)175570 - 744
Exon 7 To Exon 8 (Pair 14)
Forward (601,21)TTGGACGCCTTCCCAAATCTGAmplicon SizecDNA: 112 bpgenomic: 2,753
Reverse (712,22)TCTTTGAGAACACAGGTCTTGGNr. of Isoforms 4 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.838 kcal/mol
Forward Dimers-1.32 kcal/mol
Reverse Loops0.976 kcal/mol
Reverse Dimers-0.497 kcal/mol
Forward-Reverse Dimers-1.722 kcal/mol
Amplicon Folding-1.514 kcal/mol outside primersite
Amplicon SequenceTTGGACGCCTTCCCAAATCTGAAGGACTTCATCTCCCGCTTTGAGGGCTTGGAGAAGATC
TCTGCCTACATGAAGTCCAGCCGCTTCCTCCCAAGACCTGTGTTCTCAAAGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000561 (GSTM1)112601 - 712
Exon 7 To Exon 8 (Pair 15)
Forward (567,22)CCTTGACCTCCACCGTATATTTAmplicon SizecDNA: 153 bpgenomic: 2,794
Reverse (719,22)ACAGCCATCTTTGAGAACACAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2 kcal/mol
Forward Dimers0.08 kcal/mol in 3' area
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-0.866 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceCCTTGACCTCCACCGTATATTTGAGCCCAAGTGCTTGGACGCCTTCCCAAATCTGAAGGA
CTTCATCTCCCGCTTTGAGGGCTTGGAGAAGATCTCTGCCTACATGAAGTCCAGCCGCTT
CCTCCCAAGACCTGTGTTCTCAAAGATGGCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)153567 - 719
Exon 7 To Exon 8 (Pair 16)
Forward (568,22)CTTGACCTCCACCGTATATTTGAmplicon SizecDNA: 152 bpgenomic: 2,793
Reverse (719,22)ACAGCCATCTTTGAGAACACAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2 kcal/mol
Forward Dimers0.08 kcal/mol in 3' area
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-0.866 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceCTTGACCTCCACCGTATATTTGAGCCCAAGTGCTTGGACGCCTTCCCAAATCTGAAGGAC
TTCATCTCCCGCTTTGAGGGCTTGGAGAAGATCTCTGCCTACATGAAGTCCAGCCGCTTC
CTCCCAAGACCTGTGTTCTCAAAGATGGCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)152568 - 719
Exon 7 To Exon 8 (Pair 17)
Forward (594,20)CAAGTGCTTGGACGCCTTCCAmplicon SizecDNA: 126 bpgenomic: 2,767
Reverse (719,22)ACAGCCATCTTTGAGAACACAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.957 kcal/mol in 3' area
Forward Dimers-1.765 kcal/mol
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.514 kcal/mol outside primersite
Amplicon SequenceCAAGTGCTTGGACGCCTTCCCAAATCTGAAGGACTTCATCTCCCGCTTTGAGGGCTTGGA
GAAGATCTCTGCCTACATGAAGTCCAGCCGCTTCCTCCCAAGACCTGTGTTCTCAAAGAT
GGCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)126594 - 719
NR_002932 (GSTM2P1)123549 - 671
Exon 7 To Exon 8 (Pair 18)
Forward (601,21)TTGGACGCCTTCCCAAATCTGAmplicon SizecDNA: 119 bpgenomic: 2,760
Reverse (719,22)ACAGCCATCTTTGAGAACACAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.838 kcal/mol
Forward Dimers-1.32 kcal/mol
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-1.498 kcal/mol
Amplicon Folding-1.514 kcal/mol outside primersite
Amplicon SequenceTTGGACGCCTTCCCAAATCTGAAGGACTTCATCTCCCGCTTTGAGGGCTTGGAGAAGATC
TCTGCCTACATGAAGTCCAGCCGCTTCCTCCCAAGACCTGTGTTCTCAAAGATGGCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002932 (GSTM2P1)116556 - 671
NM_000561 (GSTM1)119601 - 719
Exon 7 To Exon 8 (Pair 19)
Forward (570,22)TGACCTCCACCGTATATTTGAGAmplicon SizecDNA: 150 bpgenomic: 2,791
Reverse (719,22)ACAGCCATCTTTGAGAACACAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.071 kcal/mol
Forward Dimers0.08 kcal/mol
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-0.866 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceTGACCTCCACCGTATATTTGAGCCCAAGTGCTTGGACGCCTTCCCAAATCTGAAGGACTT
CATCTCCCGCTTTGAGGGCTTGGAGAAGATCTCTGCCTACATGAAGTCCAGCCGCTTCCT
CCCAAGACCTGTGTTCTCAAAGATGGCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)150570 - 719
Exon 7 To Exon 8 (Pair 20)
Forward (570,22)TGACCTCCACCGTATATTTGAGAmplicon SizecDNA: 176 bpgenomic: 2,817
Reverse (745,21)CTTCAAGGCCCTACTTGTTGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.071 kcal/mol
Forward Dimers0.08 kcal/mol
Reverse Loops1.103 kcal/mol in 3' area
Reverse Dimers-2.658 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceTGACCTCCACCGTATATTTGAGCCCAAGTGCTTGGACGCCTTCCCAAATCTGAAGGACTT
CATCTCCCGCTTTGAGGGCTTGGAGAAGATCTCTGCCTACATGAAGTCCAGCCGCTTCCT
CCCAAGACCTGTGTTCTCAAAGATGGCTGTCTGGGGCAACAAGTAGGGCCTTGAAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000561 (GSTM1)176570 - 745
Exon 7 To Exon 8 (Pair 21)
Forward (601,21)TTGGACGCCTTCCCAAATCTGAmplicon SizecDNA: 120 bpgenomic: 2,761
Reverse (720,22)GACAGCCATCTTTGAGAACACANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.838 kcal/mol
Forward Dimers-1.32 kcal/mol
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-1.498 kcal/mol
Amplicon Folding-1.514 kcal/mol outside primersite
Amplicon SequenceTTGGACGCCTTCCCAAATCTGAAGGACTTCATCTCCCGCTTTGAGGGCTTGGAGAAGATC
TCTGCCTACATGAAGTCCAGCCGCTTCCTCCCAAGACCTGTGTTCTCAAAGATGGCTGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002932 (GSTM2P1)117556 - 672
NM_000561 (GSTM1)120601 - 720
Exon 7 To Exon 8 (Pair 22)
Forward (565,21)GTCCTTGACCTCCACCGTATAAmplicon SizecDNA: 155 bpgenomic: 2,796
Reverse (719,22)ACAGCCATCTTTGAGAACACAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.916 kcal/mol
Forward Dimers0.369 kcal/mol
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-0.866 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceGTCCTTGACCTCCACCGTATATTTGAGCCCAAGTGCTTGGACGCCTTCCCAAATCTGAAG
GACTTCATCTCCCGCTTTGAGGGCTTGGAGAAGATCTCTGCCTACATGAAGTCCAGCCGC
TTCCTCCCAAGACCTGTGTTCTCAAAGATGGCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)155565 - 719
Exon 7 To Exon 8 (Pair 23)
Forward (602,21)TGGACGCCTTCCCAAATCTGAAmplicon SizecDNA: 118 bpgenomic: 2,759
Reverse (719,22)ACAGCCATCTTTGAGAACACAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.838 kcal/mol
Forward Dimers-0.875 kcal/mol
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-1.427 kcal/mol
Amplicon Folding-1.514 kcal/mol outside primersite
Amplicon SequenceTGGACGCCTTCCCAAATCTGAAGGACTTCATCTCCCGCTTTGAGGGCTTGGAGAAGATCT
CTGCCTACATGAAGTCCAGCCGCTTCCTCCCAAGACCTGTGTTCTCAAAGATGGCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)118602 - 719
NR_002932 (GSTM2P1)115557 - 671
Exon 7 To Exon 8 (Pair 24)
Forward (595,20)AAGTGCTTGGACGCCTTCCCAmplicon SizecDNA: 126 bpgenomic: 2,767
Reverse (720,22)GACAGCCATCTTTGAGAACACANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.838 kcal/mol in 3' area
Forward Dimers-1.093 kcal/mol
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.514 kcal/mol outside primersite
Amplicon SequenceAAGTGCTTGGACGCCTTCCCAAATCTGAAGGACTTCATCTCCCGCTTTGAGGGCTTGGAG
AAGATCTCTGCCTACATGAAGTCCAGCCGCTTCCTCCCAAGACCTGTGTTCTCAAAGATG
GCTGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002932 (GSTM2P1)123550 - 672
NM_000561 (GSTM1)126595 - 720
Exon 7 To Exon 8 (Pair 25)
Forward (570,22)TGACCTCCACCGTATATTTGAGAmplicon SizecDNA: 151 bpgenomic: 2,792
Reverse (720,22)GACAGCCATCTTTGAGAACACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.071 kcal/mol
Forward Dimers0.08 kcal/mol
Reverse Loops1.411 kcal/mol
Reverse Dimers-0.606 kcal/mol
Forward-Reverse Dimers-0.866 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceTGACCTCCACCGTATATTTGAGCCCAAGTGCTTGGACGCCTTCCCAAATCTGAAGGACTT
CATCTCCCGCTTTGAGGGCTTGGAGAAGATCTCTGCCTACATGAAGTCCAGCCGCTTCCT
CCCAAGACCTGTGTTCTCAAAGATGGCTGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000561 (GSTM1)151570 - 720
 

See below for some more details.

Program Output:

Loading ...