Design Results for HDHD3

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size90Maximal Amplicon Size150
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size0

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 1 To Exon 2 (Pair 1)
Forward (555,21)GTCTGGAAGTTTGGGTTCTGGAmplicon SizecDNA: 112 bpgenomic: 1,035
Reverse (666,22)GGTCAGATTTGCTGGCTAACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.564 kcal/mol
Forward Dimers-0.398 kcal/mol
Reverse Loops0.477 kcal/mol
Reverse Dimers-1.096 kcal/mol
Forward-Reverse Dimers-1.145 kcal/mol
Amplicon Folding-0.756 kcal/mol outside primersite
Amplicon SequenceGTCTGGAAGTTTGGGTTCTGGTCCTGGCTGTGCCACTGACTCACTGTGACCTTGGGATCT
TGTGCTGTGAAGACATTTCCCAAGTGCTTCATGTTAGCCAGCAAATCTGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031219 (HDHD3)112555 - 666
Exon 1 To Exon 2 (Pair 2)
Forward (555,21)GTCTGGAAGTTTGGGTTCTGGAmplicon SizecDNA: 120 bpgenomic: 1,043
Reverse (674,21)GCCTTGTGGGTCAGATTTGCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.564 kcal/mol
Forward Dimers-0.398 kcal/mol
Reverse Loops1.123 kcal/mol
Reverse Dimers-0.314 kcal/mol
Forward-Reverse Dimers-1.145 kcal/mol
Amplicon Folding-0.756 kcal/mol outside primersite
Amplicon SequenceGTCTGGAAGTTTGGGTTCTGGTCCTGGCTGTGCCACTGACTCACTGTGACCTTGGGATCT
TGTGCTGTGAAGACATTTCCCAAGTGCTTCATGTTAGCCAGCAAATCTGACCCACAAGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031219 (HDHD3)120555 - 674
Exon 1 To Exon 2 (Pair 3)
Forward (550,22)AGAGAGTCTGGAAGTTTGGGTTAmplicon SizecDNA: 116 bpgenomic: 1,039
Reverse (665,22)GTCAGATTTGCTGGCTAACATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.564 kcal/mol
Forward Dimers-2.29 kcal/mol
Reverse Loops0.768 kcal/mol
Reverse Dimers-1.047 kcal/mol
Forward-Reverse Dimers-1.145 kcal/mol
Amplicon Folding-0.756 kcal/mol outside primersite
Amplicon SequenceAGAGAGTCTGGAAGTTTGGGTTCTGGTCCTGGCTGTGCCACTGACTCACTGTGACCTTGG
GATCTTGTGCTGTGAAGACATTTCCCAAGTGCTTCATGTTAGCCAGCAAATCTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031219 (HDHD3)116550 - 665
Exon 1 To Exon 2 (Pair 4)
Forward (552,22)AGAGTCTGGAAGTTTGGGTTCTAmplicon SizecDNA: 114 bpgenomic: 1,037
Reverse (665,22)GTCAGATTTGCTGGCTAACATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.564 kcal/mol
Forward Dimers-1.164 kcal/mol
Reverse Loops0.768 kcal/mol
Reverse Dimers-1.047 kcal/mol
Forward-Reverse Dimers-1.145 kcal/mol
Amplicon Folding-0.756 kcal/mol outside primersite
Amplicon SequenceAGAGTCTGGAAGTTTGGGTTCTGGTCCTGGCTGTGCCACTGACTCACTGTGACCTTGGGA
TCTTGTGCTGTGAAGACATTTCCCAAGTGCTTCATGTTAGCCAGCAAATCTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031219 (HDHD3)114552 - 665
Exon 1 To Exon 2 (Pair 5)
Forward (552,22)AGAGTCTGGAAGTTTGGGTTCTAmplicon SizecDNA: 123 bpgenomic: 1,046
Reverse (674,21)GCCTTGTGGGTCAGATTTGCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.564 kcal/mol
Forward Dimers-1.164 kcal/mol
Reverse Loops1.123 kcal/mol
Reverse Dimers-0.314 kcal/mol
Forward-Reverse Dimers-1.145 kcal/mol
Amplicon Folding-0.756 kcal/mol outside primersite
Amplicon SequenceAGAGTCTGGAAGTTTGGGTTCTGGTCCTGGCTGTGCCACTGACTCACTGTGACCTTGGGA
TCTTGTGCTGTGAAGACATTTCCCAAGTGCTTCATGTTAGCCAGCAAATCTGACCCACAA
GGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031219 (HDHD3)123552 - 674
Exon 1 To Exon 2 (Pair 6)
Forward (549,21)CAGAGAGTCTGGAAGTTTGGGAmplicon SizecDNA: 126 bpgenomic: 1,049
Reverse (674,21)GCCTTGTGGGTCAGATTTGCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.106 kcal/mol
Forward Dimers-2.29 kcal/mol
Reverse Loops1.123 kcal/mol
Reverse Dimers-0.314 kcal/mol
Forward-Reverse Dimers-1.145 kcal/mol
Amplicon Folding-0.756 kcal/mol outside primersite
Amplicon SequenceCAGAGAGTCTGGAAGTTTGGGTTCTGGTCCTGGCTGTGCCACTGACTCACTGTGACCTTG
GGATCTTGTGCTGTGAAGACATTTCCCAAGTGCTTCATGTTAGCCAGCAAATCTGACCCA
CAAGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031219 (HDHD3)126549 - 674
Exon 1 To Exon 2 (Pair 7)
Forward (549,21)CAGAGAGTCTGGAAGTTTGGGAmplicon SizecDNA: 118 bpgenomic: 1,041
Reverse (666,22)GGTCAGATTTGCTGGCTAACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.106 kcal/mol
Forward Dimers-2.29 kcal/mol
Reverse Loops0.477 kcal/mol
Reverse Dimers-1.096 kcal/mol
Forward-Reverse Dimers-1.145 kcal/mol
Amplicon Folding-0.756 kcal/mol outside primersite
Amplicon SequenceCAGAGAGTCTGGAAGTTTGGGTTCTGGTCCTGGCTGTGCCACTGACTCACTGTGACCTTG
GGATCTTGTGCTGTGAAGACATTTCCCAAGTGCTTCATGTTAGCCAGCAAATCTGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031219 (HDHD3)118549 - 666
Exon 1 To Exon 2 (Pair 8)
Forward (550,22)AGAGAGTCTGGAAGTTTGGGTTAmplicon SizecDNA: 125 bpgenomic: 1,048
Reverse (674,21)GCCTTGTGGGTCAGATTTGCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.564 kcal/mol
Forward Dimers-2.29 kcal/mol
Reverse Loops1.123 kcal/mol
Reverse Dimers-0.314 kcal/mol
Forward-Reverse Dimers-1.145 kcal/mol
Amplicon Folding-0.756 kcal/mol outside primersite
Amplicon SequenceAGAGAGTCTGGAAGTTTGGGTTCTGGTCCTGGCTGTGCCACTGACTCACTGTGACCTTGG
GATCTTGTGCTGTGAAGACATTTCCCAAGTGCTTCATGTTAGCCAGCAAATCTGACCCAC
AAGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031219 (HDHD3)125550 - 674
Exon 1 To Exon 2 (Pair 9)
Forward (552,22)AGAGTCTGGAAGTTTGGGTTCTAmplicon SizecDNA: 115 bpgenomic: 1,038
Reverse (666,22)GGTCAGATTTGCTGGCTAACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.564 kcal/mol
Forward Dimers-1.164 kcal/mol
Reverse Loops0.477 kcal/mol
Reverse Dimers-1.096 kcal/mol
Forward-Reverse Dimers-1.145 kcal/mol
Amplicon Folding-0.756 kcal/mol outside primersite
Amplicon SequenceAGAGTCTGGAAGTTTGGGTTCTGGTCCTGGCTGTGCCACTGACTCACTGTGACCTTGGGA
TCTTGTGCTGTGAAGACATTTCCCAAGTGCTTCATGTTAGCCAGCAAATCTGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031219 (HDHD3)115552 - 666
Exon 1 To Exon 2 (Pair 10)
Forward (555,21)GTCTGGAAGTTTGGGTTCTGGAmplicon SizecDNA: 111 bpgenomic: 1,034
Reverse (665,22)GTCAGATTTGCTGGCTAACATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.564 kcal/mol
Forward Dimers-0.398 kcal/mol
Reverse Loops0.768 kcal/mol
Reverse Dimers-1.047 kcal/mol
Forward-Reverse Dimers-1.145 kcal/mol
Amplicon Folding-0.756 kcal/mol outside primersite
Amplicon SequenceGTCTGGAAGTTTGGGTTCTGGTCCTGGCTGTGCCACTGACTCACTGTGACCTTGGGATCT
TGTGCTGTGAAGACATTTCCCAAGTGCTTCATGTTAGCCAGCAAATCTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031219 (HDHD3)111555 - 665
Exon 1 To Exon 2 (Pair 11)
Forward (550,22)AGAGAGTCTGGAAGTTTGGGTTAmplicon SizecDNA: 117 bpgenomic: 1,040
Reverse (666,22)GGTCAGATTTGCTGGCTAACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.564 kcal/mol
Forward Dimers-2.29 kcal/mol
Reverse Loops0.477 kcal/mol
Reverse Dimers-1.096 kcal/mol
Forward-Reverse Dimers-1.145 kcal/mol
Amplicon Folding-0.756 kcal/mol outside primersite
Amplicon SequenceAGAGAGTCTGGAAGTTTGGGTTCTGGTCCTGGCTGTGCCACTGACTCACTGTGACCTTGG
GATCTTGTGCTGTGAAGACATTTCCCAAGTGCTTCATGTTAGCCAGCAAATCTGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031219 (HDHD3)117550 - 666
Exon 1 To Exon 2 (Pair 12)
Forward (549,21)CAGAGAGTCTGGAAGTTTGGGAmplicon SizecDNA: 117 bpgenomic: 1,040
Reverse (665,22)GTCAGATTTGCTGGCTAACATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.106 kcal/mol
Forward Dimers-2.29 kcal/mol
Reverse Loops0.768 kcal/mol
Reverse Dimers-1.047 kcal/mol
Forward-Reverse Dimers-1.145 kcal/mol
Amplicon Folding-0.756 kcal/mol outside primersite
Amplicon SequenceCAGAGAGTCTGGAAGTTTGGGTTCTGGTCCTGGCTGTGCCACTGACTCACTGTGACCTTG
GGATCTTGTGCTGTGAAGACATTTCCCAAGTGCTTCATGTTAGCCAGCAAATCTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031219 (HDHD3)117549 - 665
 

See below for some more details.

Program Output:

Loading ...