Design Results for HECW2

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 1 To Exon 2 (Pair 1)
Forward (15,21)TGAGGGAGAGGACGCTTCATTAmplicon SizecDNA: 165 bpgenomic: 159,170
Reverse (179,21)TCTGCTTCTCTGGGATTGGCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.148 kcal/mol
Forward Dimers-0.566 kcal/mol
Reverse Loops1.9 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.713 kcal/mol
Amplicon Folding-1.874 kcal/mol outside primersite
Amplicon SequenceTGAGGGAGAGGACGCTTCATTTCCTTTTTGGTTGGGAATGTGCCGTGAACATCCTCTGCT
GGAGCTTGGGGCCTGGAGCAAACTGGGGCTGCAGATTTAGACGTAGACGTTTCCGAGGAC
GCGAGACTGCAGAGCTTTGTAGGCAGCCAATCCCAGAGAAGCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)16515 - 179
Exon 1 To Exon 2 (Pair 2)
Forward (16,21)GAGGGAGAGGACGCTTCATTTAmplicon SizecDNA: 164 bpgenomic: 159,169
Reverse (179,21)TCTGCTTCTCTGGGATTGGCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.148 kcal/mol
Forward Dimers-0.566 kcal/mol
Reverse Loops1.9 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.713 kcal/mol
Amplicon Folding-1.874 kcal/mol outside primersite
Amplicon SequenceGAGGGAGAGGACGCTTCATTTCCTTTTTGGTTGGGAATGTGCCGTGAACATCCTCTGCTG
GAGCTTGGGGCCTGGAGCAAACTGGGGCTGCAGATTTAGACGTAGACGTTTCCGAGGACG
CGAGACTGCAGAGCTTTGTAGGCAGCCAATCCCAGAGAAGCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)16416 - 179
Exon 1 To Exon 2 (Pair 3)
Forward (57,20)CCGTGAACATCCTCTGCTGGAmplicon SizecDNA: 123 bpgenomic: 159,128
Reverse (179,21)TCTGCTTCTCTGGGATTGGCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.719 kcal/mol in 3' area
Forward Dimers-0.002 kcal/mol
Reverse Loops1.9 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.909 kcal/mol
Amplicon Folding-1.874 kcal/mol outside primersite
Amplicon SequenceCCGTGAACATCCTCTGCTGGAGCTTGGGGCCTGGAGCAAACTGGGGCTGCAGATTTAGAC
GTAGACGTTTCCGAGGACGCGAGACTGCAGAGCTTTGTAGGCAGCCAATCCCAGAGAAGC
AGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)12357 - 179
Exon 1 To Exon 2 (Pair 4)
Forward (17,21)AGGGAGAGGACGCTTCATTTCAmplicon SizecDNA: 163 bpgenomic: 159,168
Reverse (179,21)TCTGCTTCTCTGGGATTGGCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.148 kcal/mol
Forward Dimers-0.566 kcal/mol
Reverse Loops1.9 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.713 kcal/mol
Amplicon Folding-1.874 kcal/mol outside primersite
Amplicon SequenceAGGGAGAGGACGCTTCATTTCCTTTTTGGTTGGGAATGTGCCGTGAACATCCTCTGCTGG
AGCTTGGGGCCTGGAGCAAACTGGGGCTGCAGATTTAGACGTAGACGTTTCCGAGGACGC
GAGACTGCAGAGCTTTGTAGGCAGCCAATCCCAGAGAAGCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)16317 - 179
Exon 1 To Exon 2 (Pair 5)
Forward (56,20)GCCGTGAACATCCTCTGCTGAmplicon SizecDNA: 124 bpgenomic: 159,129
Reverse (179,21)TCTGCTTCTCTGGGATTGGCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.793 kcal/mol in 3' area
Forward Dimers-0.002 kcal/mol
Reverse Loops1.9 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.909 kcal/mol
Amplicon Folding-1.874 kcal/mol outside primersite
Amplicon SequenceGCCGTGAACATCCTCTGCTGGAGCTTGGGGCCTGGAGCAAACTGGGGCTGCAGATTTAGA
CGTAGACGTTTCCGAGGACGCGAGACTGCAGAGCTTTGTAGGCAGCCAATCCCAGAGAAG
CAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)12456 - 179
Exon 6 To Exon 7 (Pair 1)
Forward (1009,20)GGAGGGAGGTGCTTCAGGAAAmplicon SizecDNA: 86 bpgenomic: 4,511
Reverse (1094,21)CTTTCTTTAGCCCAACTGCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.739 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.189 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-2.523 kcal/mol
Amplicon Folding0.071 kcal/mol inside primersite
Amplicon SequenceGGAGGGAGGTGCTTCAGGAAACCTGCATTCTCGAAAACTTGTTAGCTTTACATTGTCAGA
TCTTAGGGCAGTTGGGCTAAAGAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)86696 - 781
Exon 6 To Exon 7 (Pair 2)
Forward (1044,24)AACTTGTTAGCTTTACATTGTCAGAmplicon SizecDNA: 110 bpgenomic: 4,535
Reverse (1153,22)GCTCTTCTTTCCTGGCTGAATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.117 kcal/mol
Forward Dimers-2.282 kcal/mol
Reverse Loops2.353 kcal/mol in 3' area
Reverse Dimers-0.592 kcal/mol
Forward-Reverse Dimers-1.493 kcal/mol
Amplicon Folding-0.337 kcal/mol outside primersite
Amplicon SequenceAACTTGTTAGCTTTACATTGTCAGATCTTAGGGCAGTTGGGCTAAAGAAAGGGATGTTCT
TCAATCCTGACCCTTATCTTAAGATGTCAATTCAGCCAGGAAAGAAGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)110731 - 840
Exon 6 To Exon 7 (Pair 3)
Forward (1044,24)AACTTGTTAGCTTTACATTGTCAGAmplicon SizecDNA: 111 bpgenomic: 4,536
Reverse (1154,22)TGCTCTTCTTTCCTGGCTGAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.117 kcal/mol
Forward Dimers-2.282 kcal/mol
Reverse Loops2.247 kcal/mol
Reverse Dimers-0.592 kcal/mol
Forward-Reverse Dimers-1.568 kcal/mol
Amplicon Folding-0.337 kcal/mol outside primersite
Amplicon SequenceAACTTGTTAGCTTTACATTGTCAGATCTTAGGGCAGTTGGGCTAAAGAAAGGGATGTTCT
TCAATCCTGACCCTTATCTTAAGATGTCAATTCAGCCAGGAAAGAAGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)111731 - 841
Exon 6 To Exon 7 (Pair 4)
Forward (1009,20)GGAGGGAGGTGCTTCAGGAAAmplicon SizecDNA: 87 bpgenomic: 4,512
Reverse (1095,21)CCTTTCTTTAGCCCAACTGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.739 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.189 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-2.523 kcal/mol
Amplicon Folding0.071 kcal/mol inside primersite
Amplicon SequenceGGAGGGAGGTGCTTCAGGAAACCTGCATTCTCGAAAACTTGTTAGCTTTACATTGTCAGA
TCTTAGGGCAGTTGGGCTAAAGAAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)87696 - 782
Exon 6 To Exon 7 (Pair 5)
Forward (1008,20)TGGAGGGAGGTGCTTCAGGAAmplicon SizecDNA: 87 bpgenomic: 4,512
Reverse (1094,21)CTTTCTTTAGCCCAACTGCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.739 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.189 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-2.523 kcal/mol
Amplicon Folding0.071 kcal/mol inside primersite
Amplicon SequenceTGGAGGGAGGTGCTTCAGGAAACCTGCATTCTCGAAAACTTGTTAGCTTTACATTGTCAG
ATCTTAGGGCAGTTGGGCTAAAGAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)87695 - 781
Exon 6 To Exon 7 (Pair 6)
Forward (1008,20)TGGAGGGAGGTGCTTCAGGAAmplicon SizecDNA: 88 bpgenomic: 4,513
Reverse (1095,21)CCTTTCTTTAGCCCAACTGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.739 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.189 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-2.523 kcal/mol
Amplicon Folding0.071 kcal/mol inside primersite
Amplicon SequenceTGGAGGGAGGTGCTTCAGGAAACCTGCATTCTCGAAAACTTGTTAGCTTTACATTGTCAG
ATCTTAGGGCAGTTGGGCTAAAGAAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)88695 - 782
Exon 7 To Exon 9 (Pair 1)
Forward (1136,21)CAGCCAGGAAAGAAGAGCAGTAmplicon SizecDNA: 270 bpgenomic: 4,667
Reverse (1405,23)AAGGTTGTAGCTGAGCATTTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.768 kcal/mol in 3' area
Forward Dimers-1.364 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.44 kcal/mol
Amplicon Folding-2.879 kcal/mol outside primersite
Amplicon SequenceCAGCCAGGAAAGAAGAGCAGTTTCCCCACCTGTGCCCACCACGGGCAGGAGAGACGGTCT
ACTATCATCAGTAACACCACCAATCCAATTTGGCACCGAGAGAAATATTCCTTTTTTGCA
CTTCTTACTGATGTCTTAGAAATTGAAATTAAAGACAAATTTGCCAAGAGCCGTCCCATC
ATCAAGCGTTTTCTGGGGAAACTAACCATTCCAGTCCAGAGGCTGCTGGAGCGACAAGCC
ATCGGTGATCAAATGCTCAGCTACAACCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)270823 - 1092
Exon 7 To Exon 9 (Pair 2)
Forward (1129,22)GTCAATTCAGCCAGGAAAGAAGAmplicon SizecDNA: 275 bpgenomic: 4,672
Reverse (1403,22)GGTTGTAGCTGAGCATTTGATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.883 kcal/mol
Forward Dimers-1.364 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.745 kcal/mol
Amplicon Folding-2.879 kcal/mol outside primersite
Amplicon SequenceGTCAATTCAGCCAGGAAAGAAGAGCAGTTTCCCCACCTGTGCCCACCACGGGCAGGAGAG
ACGGTCTACTATCATCAGTAACACCACCAATCCAATTTGGCACCGAGAGAAATATTCCTT
TTTTGCACTTCTTACTGATGTCTTAGAAATTGAAATTAAAGACAAATTTGCCAAGAGCCG
TCCCATCATCAAGCGTTTTCTGGGGAAACTAACCATTCCAGTCCAGAGGCTGCTGGAGCG
ACAAGCCATCGGTGATCAAATGCTCAGCTACAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)275816 - 1090
Exon 7 To Exon 9 (Pair 3)
Forward (1131,22)CAATTCAGCCAGGAAAGAAGAGAmplicon SizecDNA: 276 bpgenomic: 4,673
Reverse (1406,22)CAAGGTTGTAGCTGAGCATTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.883 kcal/mol
Forward Dimers-1.364 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.745 kcal/mol
Amplicon Folding-2.879 kcal/mol outside primersite
Amplicon SequenceCAATTCAGCCAGGAAAGAAGAGCAGTTTCCCCACCTGTGCCCACCACGGGCAGGAGAGAC
GGTCTACTATCATCAGTAACACCACCAATCCAATTTGGCACCGAGAGAAATATTCCTTTT
TTGCACTTCTTACTGATGTCTTAGAAATTGAAATTAAAGACAAATTTGCCAAGAGCCGTC
CCATCATCAAGCGTTTTCTGGGGAAACTAACCATTCCAGTCCAGAGGCTGCTGGAGCGAC
AAGCCATCGGTGATCAAATGCTCAGCTACAACCTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)276818 - 1093
Exon 7 To Exon 9 (Pair 4)
Forward (1135,21)TCAGCCAGGAAAGAAGAGCAGAmplicon SizecDNA: 272 bpgenomic: 4,669
Reverse (1406,22)CAAGGTTGTAGCTGAGCATTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.768 kcal/mol in 3' area
Forward Dimers-1.364 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.745 kcal/mol
Amplicon Folding-2.879 kcal/mol outside primersite
Amplicon SequenceTCAGCCAGGAAAGAAGAGCAGTTTCCCCACCTGTGCCCACCACGGGCAGGAGAGACGGTC
TACTATCATCAGTAACACCACCAATCCAATTTGGCACCGAGAGAAATATTCCTTTTTTGC
ACTTCTTACTGATGTCTTAGAAATTGAAATTAAAGACAAATTTGCCAAGAGCCGTCCCAT
CATCAAGCGTTTTCTGGGGAAACTAACCATTCCAGTCCAGAGGCTGCTGGAGCGACAAGC
CATCGGTGATCAAATGCTCAGCTACAACCTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)272822 - 1093
Exon 7 To Exon 9 (Pair 5)
Forward (1137,22)AGCCAGGAAAGAAGAGCAGTTTAmplicon SizecDNA: 267 bpgenomic: 4,664
Reverse (1403,22)GGTTGTAGCTGAGCATTTGATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.768 kcal/mol
Forward Dimers-1.364 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.117 kcal/mol
Amplicon Folding-2.879 kcal/mol outside primersite
Amplicon SequenceAGCCAGGAAAGAAGAGCAGTTTCCCCACCTGTGCCCACCACGGGCAGGAGAGACGGTCTA
CTATCATCAGTAACACCACCAATCCAATTTGGCACCGAGAGAAATATTCCTTTTTTGCAC
TTCTTACTGATGTCTTAGAAATTGAAATTAAAGACAAATTTGCCAAGAGCCGTCCCATCA
TCAAGCGTTTTCTGGGGAAACTAACCATTCCAGTCCAGAGGCTGCTGGAGCGACAAGCCA
TCGGTGATCAAATGCTCAGCTACAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)267824 - 1090
Exon 7 To Exon 9 (Pair 6)
Forward (1133,22)ATTCAGCCAGGAAAGAAGAGCAAmplicon SizecDNA: 274 bpgenomic: 4,671
Reverse (1406,22)CAAGGTTGTAGCTGAGCATTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.768 kcal/mol in 3' area
Forward Dimers-1.364 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.745 kcal/mol
Amplicon Folding-2.879 kcal/mol outside primersite
Amplicon SequenceATTCAGCCAGGAAAGAAGAGCAGTTTCCCCACCTGTGCCCACCACGGGCAGGAGAGACGG
TCTACTATCATCAGTAACACCACCAATCCAATTTGGCACCGAGAGAAATATTCCTTTTTT
GCACTTCTTACTGATGTCTTAGAAATTGAAATTAAAGACAAATTTGCCAAGAGCCGTCCC
ATCATCAAGCGTTTTCTGGGGAAACTAACCATTCCAGTCCAGAGGCTGCTGGAGCGACAA
GCCATCGGTGATCAAATGCTCAGCTACAACCTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)274820 - 1093
Exon 7 To Exon 9 (Pair 7)
Forward (1133,22)ATTCAGCCAGGAAAGAAGAGCAAmplicon SizecDNA: 273 bpgenomic: 4,670
Reverse (1405,23)AAGGTTGTAGCTGAGCATTTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.768 kcal/mol in 3' area
Forward Dimers-1.364 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.745 kcal/mol
Amplicon Folding-2.879 kcal/mol outside primersite
Amplicon SequenceATTCAGCCAGGAAAGAAGAGCAGTTTCCCCACCTGTGCCCACCACGGGCAGGAGAGACGG
TCTACTATCATCAGTAACACCACCAATCCAATTTGGCACCGAGAGAAATATTCCTTTTTT
GCACTTCTTACTGATGTCTTAGAAATTGAAATTAAAGACAAATTTGCCAAGAGCCGTCCC
ATCATCAAGCGTTTTCTGGGGAAACTAACCATTCCAGTCCAGAGGCTGCTGGAGCGACAA
GCCATCGGTGATCAAATGCTCAGCTACAACCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)273820 - 1092
Exon 7 To Exon 9 (Pair 8)
Forward (1132,22)AATTCAGCCAGGAAAGAAGAGCAmplicon SizecDNA: 272 bpgenomic: 4,669
Reverse (1403,22)GGTTGTAGCTGAGCATTTGATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.883 kcal/mol
Forward Dimers-1.364 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.745 kcal/mol
Amplicon Folding-2.879 kcal/mol outside primersite
Amplicon SequenceAATTCAGCCAGGAAAGAAGAGCAGTTTCCCCACCTGTGCCCACCACGGGCAGGAGAGACG
GTCTACTATCATCAGTAACACCACCAATCCAATTTGGCACCGAGAGAAATATTCCTTTTT
TGCACTTCTTACTGATGTCTTAGAAATTGAAATTAAAGACAAATTTGCCAAGAGCCGTCC
CATCATCAAGCGTTTTCTGGGGAAACTAACCATTCCAGTCCAGAGGCTGCTGGAGCGACA
AGCCATCGGTGATCAAATGCTCAGCTACAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)272819 - 1090
Exon 7 To Exon 9 (Pair 9)
Forward (1127,23)ATGTCAATTCAGCCAGGAAAGAAAmplicon SizecDNA: 279 bpgenomic: 4,676
Reverse (1405,23)AAGGTTGTAGCTGAGCATTTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.883 kcal/mol in 3' area
Forward Dimers-1.364 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.745 kcal/mol
Amplicon Folding-2.879 kcal/mol outside primersite
Amplicon SequenceATGTCAATTCAGCCAGGAAAGAAGAGCAGTTTCCCCACCTGTGCCCACCACGGGCAGGAG
AGACGGTCTACTATCATCAGTAACACCACCAATCCAATTTGGCACCGAGAGAAATATTCC
TTTTTTGCACTTCTTACTGATGTCTTAGAAATTGAAATTAAAGACAAATTTGCCAAGAGC
CGTCCCATCATCAAGCGTTTTCTGGGGAAACTAACCATTCCAGTCCAGAGGCTGCTGGAG
CGACAAGCCATCGGTGATCAAATGCTCAGCTACAACCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)279814 - 1092
Exon 7 To Exon 9 (Pair 10)
Forward (1131,22)CAATTCAGCCAGGAAAGAAGAGAmplicon SizecDNA: 273 bpgenomic: 4,670
Reverse (1403,22)GGTTGTAGCTGAGCATTTGATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.883 kcal/mol
Forward Dimers-1.364 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.745 kcal/mol
Amplicon Folding-2.879 kcal/mol outside primersite
Amplicon SequenceCAATTCAGCCAGGAAAGAAGAGCAGTTTCCCCACCTGTGCCCACCACGGGCAGGAGAGAC
GGTCTACTATCATCAGTAACACCACCAATCCAATTTGGCACCGAGAGAAATATTCCTTTT
TTGCACTTCTTACTGATGTCTTAGAAATTGAAATTAAAGACAAATTTGCCAAGAGCCGTC
CCATCATCAAGCGTTTTCTGGGGAAACTAACCATTCCAGTCCAGAGGCTGCTGGAGCGAC
AAGCCATCGGTGATCAAATGCTCAGCTACAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)273818 - 1090
Exon 7 To Exon 9 (Pair 11)
Forward (1129,22)GTCAATTCAGCCAGGAAAGAAGAmplicon SizecDNA: 278 bpgenomic: 4,675
Reverse (1406,22)CAAGGTTGTAGCTGAGCATTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.883 kcal/mol
Forward Dimers-1.364 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.745 kcal/mol
Amplicon Folding-2.879 kcal/mol outside primersite
Amplicon SequenceGTCAATTCAGCCAGGAAAGAAGAGCAGTTTCCCCACCTGTGCCCACCACGGGCAGGAGAG
ACGGTCTACTATCATCAGTAACACCACCAATCCAATTTGGCACCGAGAGAAATATTCCTT
TTTTGCACTTCTTACTGATGTCTTAGAAATTGAAATTAAAGACAAATTTGCCAAGAGCCG
TCCCATCATCAAGCGTTTTCTGGGGAAACTAACCATTCCAGTCCAGAGGCTGCTGGAGCG
ACAAGCCATCGGTGATCAAATGCTCAGCTACAACCTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)278816 - 1093
Exon 7 To Exon 9 (Pair 12)
Forward (1131,22)CAATTCAGCCAGGAAAGAAGAGAmplicon SizecDNA: 275 bpgenomic: 4,672
Reverse (1405,23)AAGGTTGTAGCTGAGCATTTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.883 kcal/mol
Forward Dimers-1.364 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.745 kcal/mol
Amplicon Folding-2.879 kcal/mol outside primersite
Amplicon SequenceCAATTCAGCCAGGAAAGAAGAGCAGTTTCCCCACCTGTGCCCACCACGGGCAGGAGAGAC
GGTCTACTATCATCAGTAACACCACCAATCCAATTTGGCACCGAGAGAAATATTCCTTTT
TTGCACTTCTTACTGATGTCTTAGAAATTGAAATTAAAGACAAATTTGCCAAGAGCCGTC
CCATCATCAAGCGTTTTCTGGGGAAACTAACCATTCCAGTCCAGAGGCTGCTGGAGCGAC
AAGCCATCGGTGATCAAATGCTCAGCTACAACCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)275818 - 1092
Exon 7 To Exon 9 (Pair 13)
Forward (1135,21)TCAGCCAGGAAAGAAGAGCAGAmplicon SizecDNA: 269 bpgenomic: 4,666
Reverse (1403,22)GGTTGTAGCTGAGCATTTGATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.768 kcal/mol in 3' area
Forward Dimers-1.364 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.745 kcal/mol
Amplicon Folding-2.879 kcal/mol outside primersite
Amplicon SequenceTCAGCCAGGAAAGAAGAGCAGTTTCCCCACCTGTGCCCACCACGGGCAGGAGAGACGGTC
TACTATCATCAGTAACACCACCAATCCAATTTGGCACCGAGAGAAATATTCCTTTTTTGC
ACTTCTTACTGATGTCTTAGAAATTGAAATTAAAGACAAATTTGCCAAGAGCCGTCCCAT
CATCAAGCGTTTTCTGGGGAAACTAACCATTCCAGTCCAGAGGCTGCTGGAGCGACAAGC
CATCGGTGATCAAATGCTCAGCTACAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)269822 - 1090
Exon 7 To Exon 9 (Pair 14)
Forward (1129,22)GTCAATTCAGCCAGGAAAGAAGAmplicon SizecDNA: 277 bpgenomic: 4,674
Reverse (1405,23)AAGGTTGTAGCTGAGCATTTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.883 kcal/mol
Forward Dimers-1.364 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.745 kcal/mol
Amplicon Folding-2.879 kcal/mol outside primersite
Amplicon SequenceGTCAATTCAGCCAGGAAAGAAGAGCAGTTTCCCCACCTGTGCCCACCACGGGCAGGAGAG
ACGGTCTACTATCATCAGTAACACCACCAATCCAATTTGGCACCGAGAGAAATATTCCTT
TTTTGCACTTCTTACTGATGTCTTAGAAATTGAAATTAAAGACAAATTTGCCAAGAGCCG
TCCCATCATCAAGCGTTTTCTGGGGAAACTAACCATTCCAGTCCAGAGGCTGCTGGAGCG
ACAAGCCATCGGTGATCAAATGCTCAGCTACAACCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)277816 - 1092
Exon 7 To Exon 9 (Pair 15)
Forward (1137,22)AGCCAGGAAAGAAGAGCAGTTTAmplicon SizecDNA: 270 bpgenomic: 4,667
Reverse (1406,22)CAAGGTTGTAGCTGAGCATTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.768 kcal/mol
Forward Dimers-1.364 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.117 kcal/mol
Amplicon Folding-2.879 kcal/mol outside primersite
Amplicon SequenceAGCCAGGAAAGAAGAGCAGTTTCCCCACCTGTGCCCACCACGGGCAGGAGAGACGGTCTA
CTATCATCAGTAACACCACCAATCCAATTTGGCACCGAGAGAAATATTCCTTTTTTGCAC
TTCTTACTGATGTCTTAGAAATTGAAATTAAAGACAAATTTGCCAAGAGCCGTCCCATCA
TCAAGCGTTTTCTGGGGAAACTAACCATTCCAGTCCAGAGGCTGCTGGAGCGACAAGCCA
TCGGTGATCAAATGCTCAGCTACAACCTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)270824 - 1093
Exon 7 To Exon 9 (Pair 16)
Forward (1133,22)ATTCAGCCAGGAAAGAAGAGCAAmplicon SizecDNA: 271 bpgenomic: 4,668
Reverse (1403,22)GGTTGTAGCTGAGCATTTGATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.768 kcal/mol in 3' area
Forward Dimers-1.364 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.745 kcal/mol
Amplicon Folding-2.879 kcal/mol outside primersite
Amplicon SequenceATTCAGCCAGGAAAGAAGAGCAGTTTCCCCACCTGTGCCCACCACGGGCAGGAGAGACGG
TCTACTATCATCAGTAACACCACCAATCCAATTTGGCACCGAGAGAAATATTCCTTTTTT
GCACTTCTTACTGATGTCTTAGAAATTGAAATTAAAGACAAATTTGCCAAGAGCCGTCCC
ATCATCAAGCGTTTTCTGGGGAAACTAACCATTCCAGTCCAGAGGCTGCTGGAGCGACAA
GCCATCGGTGATCAAATGCTCAGCTACAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)271820 - 1090
Exon 7 To Exon 9 (Pair 17)
Forward (1127,23)ATGTCAATTCAGCCAGGAAAGAAAmplicon SizecDNA: 277 bpgenomic: 4,674
Reverse (1403,22)GGTTGTAGCTGAGCATTTGATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.883 kcal/mol in 3' area
Forward Dimers-1.364 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.745 kcal/mol
Amplicon Folding-2.879 kcal/mol outside primersite
Amplicon SequenceATGTCAATTCAGCCAGGAAAGAAGAGCAGTTTCCCCACCTGTGCCCACCACGGGCAGGAG
AGACGGTCTACTATCATCAGTAACACCACCAATCCAATTTGGCACCGAGAGAAATATTCC
TTTTTTGCACTTCTTACTGATGTCTTAGAAATTGAAATTAAAGACAAATTTGCCAAGAGC
CGTCCCATCATCAAGCGTTTTCTGGGGAAACTAACCATTCCAGTCCAGAGGCTGCTGGAG
CGACAAGCCATCGGTGATCAAATGCTCAGCTACAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)277814 - 1090
Exon 7 To Exon 9 (Pair 18)
Forward (1135,21)TCAGCCAGGAAAGAAGAGCAGAmplicon SizecDNA: 271 bpgenomic: 4,668
Reverse (1405,23)AAGGTTGTAGCTGAGCATTTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.768 kcal/mol in 3' area
Forward Dimers-1.364 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.745 kcal/mol
Amplicon Folding-2.879 kcal/mol outside primersite
Amplicon SequenceTCAGCCAGGAAAGAAGAGCAGTTTCCCCACCTGTGCCCACCACGGGCAGGAGAGACGGTC
TACTATCATCAGTAACACCACCAATCCAATTTGGCACCGAGAGAAATATTCCTTTTTTGC
ACTTCTTACTGATGTCTTAGAAATTGAAATTAAAGACAAATTTGCCAAGAGCCGTCCCAT
CATCAAGCGTTTTCTGGGGAAACTAACCATTCCAGTCCAGAGGCTGCTGGAGCGACAAGC
CATCGGTGATCAAATGCTCAGCTACAACCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)271822 - 1092
Exon 7 To Exon 9 (Pair 19)
Forward (1132,22)AATTCAGCCAGGAAAGAAGAGCAmplicon SizecDNA: 274 bpgenomic: 4,671
Reverse (1405,23)AAGGTTGTAGCTGAGCATTTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.883 kcal/mol
Forward Dimers-1.364 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.745 kcal/mol
Amplicon Folding-2.879 kcal/mol outside primersite
Amplicon SequenceAATTCAGCCAGGAAAGAAGAGCAGTTTCCCCACCTGTGCCCACCACGGGCAGGAGAGACG
GTCTACTATCATCAGTAACACCACCAATCCAATTTGGCACCGAGAGAAATATTCCTTTTT
TGCACTTCTTACTGATGTCTTAGAAATTGAAATTAAAGACAAATTTGCCAAGAGCCGTCC
CATCATCAAGCGTTTTCTGGGGAAACTAACCATTCCAGTCCAGAGGCTGCTGGAGCGACA
AGCCATCGGTGATCAAATGCTCAGCTACAACCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)274819 - 1092
Exon 7 To Exon 9 (Pair 20)
Forward (1137,22)AGCCAGGAAAGAAGAGCAGTTTAmplicon SizecDNA: 269 bpgenomic: 4,666
Reverse (1405,23)AAGGTTGTAGCTGAGCATTTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.768 kcal/mol
Forward Dimers-1.364 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.117 kcal/mol
Amplicon Folding-2.879 kcal/mol outside primersite
Amplicon SequenceAGCCAGGAAAGAAGAGCAGTTTCCCCACCTGTGCCCACCACGGGCAGGAGAGACGGTCTA
CTATCATCAGTAACACCACCAATCCAATTTGGCACCGAGAGAAATATTCCTTTTTTGCAC
TTCTTACTGATGTCTTAGAAATTGAAATTAAAGACAAATTTGCCAAGAGCCGTCCCATCA
TCAAGCGTTTTCTGGGGAAACTAACCATTCCAGTCCAGAGGCTGCTGGAGCGACAAGCCA
TCGGTGATCAAATGCTCAGCTACAACCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)269824 - 1092
Exon 7 To Exon 9 (Pair 21)
Forward (1136,21)CAGCCAGGAAAGAAGAGCAGTAmplicon SizecDNA: 271 bpgenomic: 4,668
Reverse (1406,22)CAAGGTTGTAGCTGAGCATTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.768 kcal/mol in 3' area
Forward Dimers-1.364 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.44 kcal/mol
Amplicon Folding-2.879 kcal/mol outside primersite
Amplicon SequenceCAGCCAGGAAAGAAGAGCAGTTTCCCCACCTGTGCCCACCACGGGCAGGAGAGACGGTCT
ACTATCATCAGTAACACCACCAATCCAATTTGGCACCGAGAGAAATATTCCTTTTTTGCA
CTTCTTACTGATGTCTTAGAAATTGAAATTAAAGACAAATTTGCCAAGAGCCGTCCCATC
ATCAAGCGTTTTCTGGGGAAACTAACCATTCCAGTCCAGAGGCTGCTGGAGCGACAAGCC
ATCGGTGATCAAATGCTCAGCTACAACCTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)271823 - 1093
Exon 7 To Exon 9 (Pair 22)
Forward (1127,23)ATGTCAATTCAGCCAGGAAAGAAAmplicon SizecDNA: 280 bpgenomic: 4,677
Reverse (1406,22)CAAGGTTGTAGCTGAGCATTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.883 kcal/mol in 3' area
Forward Dimers-1.364 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.745 kcal/mol
Amplicon Folding-2.879 kcal/mol outside primersite
Amplicon SequenceATGTCAATTCAGCCAGGAAAGAAGAGCAGTTTCCCCACCTGTGCCCACCACGGGCAGGAG
AGACGGTCTACTATCATCAGTAACACCACCAATCCAATTTGGCACCGAGAGAAATATTCC
TTTTTTGCACTTCTTACTGATGTCTTAGAAATTGAAATTAAAGACAAATTTGCCAAGAGC
CGTCCCATCATCAAGCGTTTTCTGGGGAAACTAACCATTCCAGTCCAGAGGCTGCTGGAG
CGACAAGCCATCGGTGATCAAATGCTCAGCTACAACCTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)280814 - 1093
Exon 7 To Exon 9 (Pair 23)
Forward (1136,21)CAGCCAGGAAAGAAGAGCAGTAmplicon SizecDNA: 268 bpgenomic: 4,665
Reverse (1403,22)GGTTGTAGCTGAGCATTTGATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.768 kcal/mol in 3' area
Forward Dimers-1.364 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.44 kcal/mol
Amplicon Folding-2.879 kcal/mol outside primersite
Amplicon SequenceCAGCCAGGAAAGAAGAGCAGTTTCCCCACCTGTGCCCACCACGGGCAGGAGAGACGGTCT
ACTATCATCAGTAACACCACCAATCCAATTTGGCACCGAGAGAAATATTCCTTTTTTGCA
CTTCTTACTGATGTCTTAGAAATTGAAATTAAAGACAAATTTGCCAAGAGCCGTCCCATC
ATCAAGCGTTTTCTGGGGAAACTAACCATTCCAGTCCAGAGGCTGCTGGAGCGACAAGCC
ATCGGTGATCAAATGCTCAGCTACAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)268823 - 1090
Exon 7 To Exon 9 (Pair 24)
Forward (1132,22)AATTCAGCCAGGAAAGAAGAGCAmplicon SizecDNA: 275 bpgenomic: 4,672
Reverse (1406,22)CAAGGTTGTAGCTGAGCATTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.883 kcal/mol
Forward Dimers-1.364 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-2.745 kcal/mol
Amplicon Folding-2.879 kcal/mol outside primersite
Amplicon SequenceAATTCAGCCAGGAAAGAAGAGCAGTTTCCCCACCTGTGCCCACCACGGGCAGGAGAGACG
GTCTACTATCATCAGTAACACCACCAATCCAATTTGGCACCGAGAGAAATATTCCTTTTT
TGCACTTCTTACTGATGTCTTAGAAATTGAAATTAAAGACAAATTTGCCAAGAGCCGTCC
CATCATCAAGCGTTTTCTGGGGAAACTAACCATTCCAGTCCAGAGGCTGCTGGAGCGACA
AGCCATCGGTGATCAAATGCTCAGCTACAACCTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)275819 - 1093
Exon 13 To Exon 15 (Pair 1)
Forward (3160,21)AGCTGACTTTCACCAAGCCAGAmplicon SizecDNA: 238 bpgenomic: 14,492
Reverse (3397,21)GTAGCGTTCAAAGTGGTGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.243 kcal/mol in 3' area
Forward Dimers-1.606 kcal/mol
Reverse Loops2.285 kcal/mol
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-2.595 kcal/mol
Amplicon Folding-2.586 kcal/mol outside primersite
Amplicon SequenceAGCTGACTTTCACCAAGCCAGTGCAGATTTCCGACGGGAGAACATCCTGCCTCACTCTAC
CTCCAGATCCAGGATCACGTTGCTGTTACAGTCTCCCCCCGTGAAGTTCCTCATCAGCCC
AGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAACAACAC
GTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACGCTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)2382847 - 3084
Exon 13 To Exon 15 (Pair 2)
Forward (3154,21)GGAGGAAGCTGACTTTCACCAAmplicon SizecDNA: 244 bpgenomic: 14,498
Reverse (3397,21)GTAGCGTTCAAAGTGGTGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.517 kcal/mol
Forward Dimers-2.688 kcal/mol
Reverse Loops2.285 kcal/mol
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-2.595 kcal/mol
Amplicon Folding-2.586 kcal/mol outside primersite
Amplicon SequenceGGAGGAAGCTGACTTTCACCAAGCCAGTGCAGATTTCCGACGGGAGAACATCCTGCCTCA
CTCTACCTCCAGATCCAGGATCACGTTGCTGTTACAGTCTCCCCCCGTGAAGTTCCTCAT
CAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAA
CAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACG
CTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)2442841 - 3084
Exon 13 To Exon 15 (Pair 3)
Forward (3154,21)GGAGGAAGCTGACTTTCACCAAmplicon SizecDNA: 246 bpgenomic: 14,500
Reverse (3399,21)TGGTAGCGTTCAAAGTGGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.517 kcal/mol
Forward Dimers-2.688 kcal/mol
Reverse Loops2.285 kcal/mol in 3' area
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-2.595 kcal/mol
Amplicon Folding-2.586 kcal/mol outside primersite
Amplicon SequenceGGAGGAAGCTGACTTTCACCAAGCCAGTGCAGATTTCCGACGGGAGAACATCCTGCCTCA
CTCTACCTCCAGATCCAGGATCACGTTGCTGTTACAGTCTCCCCCCGTGAAGTTCCTCAT
CAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAA
CAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACG
CTACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)2462841 - 3086
Exon 13 To Exon 15 (Pair 4)
Forward (3160,21)AGCTGACTTTCACCAAGCCAGAmplicon SizecDNA: 248 bpgenomic: 14,502
Reverse (3407,22)GGTTATGCTGGTAGCGTTCAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.243 kcal/mol in 3' area
Forward Dimers-1.606 kcal/mol
Reverse Loops0.563 kcal/mol
Reverse Dimers-1.273 kcal/mol
Forward-Reverse Dimers-2.218 kcal/mol
Amplicon Folding-2.586 kcal/mol outside primersite
Amplicon SequenceAGCTGACTTTCACCAAGCCAGTGCAGATTTCCGACGGGAGAACATCCTGCCTCACTCTAC
CTCCAGATCCAGGATCACGTTGCTGTTACAGTCTCCCCCCGTGAAGTTCCTCATCAGCCC
AGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAACAACAC
GTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACGCTACCA
GCATAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)2482847 - 3094
Exon 13 To Exon 15 (Pair 5)
Forward (3158,21)GAAGCTGACTTTCACCAAGCCAmplicon SizecDNA: 242 bpgenomic: 14,496
Reverse (3399,21)TGGTAGCGTTCAAAGTGGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.517 kcal/mol
Forward Dimers-2.688 kcal/mol
Reverse Loops2.285 kcal/mol in 3' area
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-2.595 kcal/mol
Amplicon Folding-2.586 kcal/mol outside primersite
Amplicon SequenceGAAGCTGACTTTCACCAAGCCAGTGCAGATTTCCGACGGGAGAACATCCTGCCTCACTCT
ACCTCCAGATCCAGGATCACGTTGCTGTTACAGTCTCCCCCCGTGAAGTTCCTCATCAGC
CCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAACAAC
ACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACGCTAC
CA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)2422845 - 3086
Exon 13 To Exon 15 (Pair 6)
Forward (3160,21)AGCTGACTTTCACCAAGCCAGAmplicon SizecDNA: 251 bpgenomic: 14,505
Reverse (3410,20)CGCGGTTATGCTGGTAGCGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.243 kcal/mol in 3' area
Forward Dimers-1.606 kcal/mol
Reverse Loops0.737 kcal/mol in 3' area
Reverse Dimers-2.414 kcal/mol
Forward-Reverse Dimers-2.218 kcal/mol
Amplicon Folding-2.586 kcal/mol outside primersite
Amplicon SequenceAGCTGACTTTCACCAAGCCAGTGCAGATTTCCGACGGGAGAACATCCTGCCTCACTCTAC
CTCCAGATCCAGGATCACGTTGCTGTTACAGTCTCCCCCCGTGAAGTTCCTCATCAGCCC
AGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAACAACAC
GTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACGCTACCA
GCATAACCGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)2512847 - 3097
Exon 13 To Exon 15 (Pair 7)
Forward (3160,21)AGCTGACTTTCACCAAGCCAGAmplicon SizecDNA: 240 bpgenomic: 14,494
Reverse (3399,21)TGGTAGCGTTCAAAGTGGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.243 kcal/mol in 3' area
Forward Dimers-1.606 kcal/mol
Reverse Loops2.285 kcal/mol in 3' area
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-2.595 kcal/mol
Amplicon Folding-2.586 kcal/mol outside primersite
Amplicon SequenceAGCTGACTTTCACCAAGCCAGTGCAGATTTCCGACGGGAGAACATCCTGCCTCACTCTAC
CTCCAGATCCAGGATCACGTTGCTGTTACAGTCTCCCCCCGTGAAGTTCCTCATCAGCCC
AGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAACAACAC
GTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACGCTACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)2402847 - 3086
Exon 13 To Exon 15 (Pair 8)
Forward (3160,21)AGCTGACTTTCACCAAGCCAGAmplicon SizecDNA: 247 bpgenomic: 14,501
Reverse (3406,22)GTTATGCTGGTAGCGTTCAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.243 kcal/mol in 3' area
Forward Dimers-1.606 kcal/mol
Reverse Loops0.563 kcal/mol
Reverse Dimers-1.273 kcal/mol
Forward-Reverse Dimers-2.218 kcal/mol
Amplicon Folding-2.586 kcal/mol outside primersite
Amplicon SequenceAGCTGACTTTCACCAAGCCAGTGCAGATTTCCGACGGGAGAACATCCTGCCTCACTCTAC
CTCCAGATCCAGGATCACGTTGCTGTTACAGTCTCCCCCCGTGAAGTTCCTCATCAGCCC
AGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAACAACAC
GTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACGCTACCA
GCATAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)2472847 - 3093
Exon 13 To Exon 15 (Pair 9)
Forward (3157,21)GGAAGCTGACTTTCACCAAGCAmplicon SizecDNA: 243 bpgenomic: 14,497
Reverse (3399,21)TGGTAGCGTTCAAAGTGGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.517 kcal/mol
Forward Dimers-2.688 kcal/mol
Reverse Loops2.285 kcal/mol in 3' area
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-2.595 kcal/mol
Amplicon Folding-2.586 kcal/mol outside primersite
Amplicon SequenceGGAAGCTGACTTTCACCAAGCCAGTGCAGATTTCCGACGGGAGAACATCCTGCCTCACTC
TACCTCCAGATCCAGGATCACGTTGCTGTTACAGTCTCCCCCCGTGAAGTTCCTCATCAG
CCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAACAA
CACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACGCTA
CCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)2432844 - 3086
Exon 13 To Exon 15 (Pair 10)
Forward (3158,21)GAAGCTGACTTTCACCAAGCCAmplicon SizecDNA: 240 bpgenomic: 14,494
Reverse (3397,21)GTAGCGTTCAAAGTGGTGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.517 kcal/mol
Forward Dimers-2.688 kcal/mol
Reverse Loops2.285 kcal/mol
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-2.595 kcal/mol
Amplicon Folding-2.586 kcal/mol outside primersite
Amplicon SequenceGAAGCTGACTTTCACCAAGCCAGTGCAGATTTCCGACGGGAGAACATCCTGCCTCACTCT
ACCTCCAGATCCAGGATCACGTTGCTGTTACAGTCTCCCCCCGTGAAGTTCCTCATCAGC
CCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAACAAC
ACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACGCTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)2402845 - 3084
Exon 13 To Exon 15 (Pair 11)
Forward (3157,21)GGAAGCTGACTTTCACCAAGCAmplicon SizecDNA: 241 bpgenomic: 14,495
Reverse (3397,21)GTAGCGTTCAAAGTGGTGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.517 kcal/mol
Forward Dimers-2.688 kcal/mol
Reverse Loops2.285 kcal/mol
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-2.595 kcal/mol
Amplicon Folding-2.586 kcal/mol outside primersite
Amplicon SequenceGGAAGCTGACTTTCACCAAGCCAGTGCAGATTTCCGACGGGAGAACATCCTGCCTCACTC
TACCTCCAGATCCAGGATCACGTTGCTGTTACAGTCTCCCCCCGTGAAGTTCCTCATCAG
CCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAACAA
CACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACGCTA
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)2412844 - 3084
Exon 14 To Exon 15 (Pair 1)
Forward (3284,22)TTCTTCACCGTGCTGCATTCTAAmplicon SizecDNA: 119 bpgenomic: 13,856
Reverse (3402,21)TGCTGGTAGCGTTCAAAGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.251 kcal/mol
Forward Dimers-2.138 kcal/mol
Reverse Loops0.815 kcal/mol
Reverse Dimers-1.021 kcal/mol
Forward-Reverse Dimers-1.679 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAACAACACGTGT
TTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACGCTACCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1192971 - 3089
Exon 14 To Exon 15 (Pair 2)
Forward (3266,21)TTCCTCATCAGCCCAGAGTTCAmplicon SizecDNA: 142 bpgenomic: 13,879
Reverse (3407,22)GGTTATGCTGGTAGCGTTCAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol in 3' area
Forward Dimers-0.318 kcal/mol
Reverse Loops0.563 kcal/mol
Reverse Dimers-1.273 kcal/mol
Forward-Reverse Dimers-2.409 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTTCCTCATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATG
TTTACAAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCAC
TTTGAACGCTACCAGCATAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1422953 - 3094
Exon 14 To Exon 15 (Pair 3)
Forward (3288,21)TCACCGTGCTGCATTCTAACCAmplicon SizecDNA: 119 bpgenomic: 13,856
Reverse (3406,22)GTTATGCTGGTAGCGTTCAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.251 kcal/mol
Forward Dimers-2.138 kcal/mol
Reverse Loops0.563 kcal/mol
Reverse Dimers-1.273 kcal/mol
Forward-Reverse Dimers-2.063 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAACAACACGTGTTTGA
AGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACGCTACCAGCATAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1192975 - 3093
Exon 14 To Exon 15 (Pair 4)
Forward (3210,21)CTCACTCTACCTCCAGATCCAAmplicon SizecDNA: 193 bpgenomic: 13,930
Reverse (3402,21)TGCTGGTAGCGTTCAAAGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.19 kcal/mol
Forward Dimers-0.65 kcal/mol
Reverse Loops0.815 kcal/mol
Reverse Dimers-1.021 kcal/mol
Forward-Reverse Dimers-2.405 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceCTCACTCTACCTCCAGATCCAGGATCACGTTGCTGTTACAGTCTCCCCCCGTGAAGTTCC
TCATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTA
CAAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTG
AACGCTACCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1932897 - 3089
Exon 14 To Exon 15 (Pair 5)
Forward (3211,21)TCACTCTACCTCCAGATCCAGAmplicon SizecDNA: 189 bpgenomic: 13,926
Reverse (3399,21)TGGTAGCGTTCAAAGTGGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.19 kcal/mol
Forward Dimers-0.65 kcal/mol
Reverse Loops2.285 kcal/mol in 3' area
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-2.199 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTCACTCTACCTCCAGATCCAGGATCACGTTGCTGTTACAGTCTCCCCCCGTGAAGTTCCT
CATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTAC
AAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGA
ACGCTACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1892898 - 3086
Exon 14 To Exon 15 (Pair 6)
Forward (3210,21)CTCACTCTACCTCCAGATCCAAmplicon SizecDNA: 197 bpgenomic: 13,934
Reverse (3406,22)GTTATGCTGGTAGCGTTCAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.19 kcal/mol
Forward Dimers-0.65 kcal/mol
Reverse Loops0.563 kcal/mol
Reverse Dimers-1.273 kcal/mol
Forward-Reverse Dimers-2.405 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceCTCACTCTACCTCCAGATCCAGGATCACGTTGCTGTTACAGTCTCCCCCCGTGAAGTTCC
TCATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTA
CAAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTG
AACGCTACCAGCATAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1972897 - 3093
Exon 14 To Exon 15 (Pair 7)
Forward (3210,21)CTCACTCTACCTCCAGATCCAAmplicon SizecDNA: 188 bpgenomic: 13,925
Reverse (3397,21)GTAGCGTTCAAAGTGGTGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.19 kcal/mol
Forward Dimers-0.65 kcal/mol
Reverse Loops2.285 kcal/mol
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-2.069 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceCTCACTCTACCTCCAGATCCAGGATCACGTTGCTGTTACAGTCTCCCCCCGTGAAGTTCC
TCATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTA
CAAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTG
AACGCTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1882897 - 3084
Exon 14 To Exon 15 (Pair 8)
Forward (3267,21)TCCTCATCAGCCCAGAGTTCTAmplicon SizecDNA: 163 bpgenomic: 13,900
Reverse (3429,21)TTGAGGAATCCCACAAGGTCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.794 kcal/mol in 3' area
Forward Dimers-0.318 kcal/mol
Reverse Loops1.035 kcal/mol
Reverse Dimers-1.286 kcal/mol
Forward-Reverse Dimers-2.928 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTCCTCATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGT
TTACAAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACT
TTGAACGCTACCAGCATAACCGCGACCTTGTGGGATTCCTCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1632954 - 3116
Exon 14 To Exon 15 (Pair 9)
Forward (3262,21)GAAGTTCCTCATCAGCCCAGAAmplicon SizecDNA: 141 bpgenomic: 13,878
Reverse (3402,21)TGCTGGTAGCGTTCAAAGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.757 kcal/mol
Forward Dimers-0.406 kcal/mol
Reverse Loops0.815 kcal/mol
Reverse Dimers-1.021 kcal/mol
Forward-Reverse Dimers-2.409 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceGAAGTTCCTCATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCG
CATGTTTACAAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCA
CCACTTTGAACGCTACCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1412949 - 3089
Exon 14 To Exon 15 (Pair 10)
Forward (3262,21)GAAGTTCCTCATCAGCCCAGAAmplicon SizecDNA: 146 bpgenomic: 13,883
Reverse (3407,22)GGTTATGCTGGTAGCGTTCAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.757 kcal/mol
Forward Dimers-0.406 kcal/mol
Reverse Loops0.563 kcal/mol
Reverse Dimers-1.273 kcal/mol
Forward-Reverse Dimers-2.409 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceGAAGTTCCTCATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCG
CATGTTTACAAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCA
CCACTTTGAACGCTACCAGCATAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1462949 - 3094
Exon 14 To Exon 15 (Pair 11)
Forward (3276,20)GCCCAGAGTTCTTCACCGTGAmplicon SizecDNA: 126 bpgenomic: 13,863
Reverse (3401,21)GCTGGTAGCGTTCAAAGTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.289 kcal/mol
Forward Dimers-0.408 kcal/mol
Reverse Loops1.261 kcal/mol
Reverse Dimers-0.575 kcal/mol
Forward-Reverse Dimers-2.311 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAACA
ACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACGCT
ACCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1262963 - 3088
Exon 14 To Exon 15 (Pair 12)
Forward (3262,21)GAAGTTCCTCATCAGCCCAGAAmplicon SizecDNA: 77 bpgenomic: 13,814
Reverse (3338,23)TGTTGTTTGTAAACATGCGGTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.757 kcal/mol
Forward Dimers-0.406 kcal/mol
Reverse Loops0.828 kcal/mol in 3' area
Reverse Dimers-1.122 kcal/mol
Forward-Reverse Dimers-1.143 kcal/mol
Amplicon Folding0.483 kcal/mol inside primersite
Amplicon SequenceGAAGTTCCTCATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCG
CATGTTTACAAACAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)772949 - 3025
Exon 14 To Exon 15 (Pair 13)
Forward (3272,21)ATCAGCCCAGAGTTCTTCACCAmplicon SizecDNA: 135 bpgenomic: 13,872
Reverse (3406,22)GTTATGCTGGTAGCGTTCAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.289 kcal/mol
Forward Dimers-0.408 kcal/mol
Reverse Loops0.563 kcal/mol
Reverse Dimers-1.273 kcal/mol
Forward-Reverse Dimers-2.311 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACA
AACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAA
CGCTACCAGCATAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1352959 - 3093
Exon 14 To Exon 15 (Pair 14)
Forward (3274,20)CAGCCCAGAGTTCTTCACCGAmplicon SizecDNA: 134 bpgenomic: 13,871
Reverse (3407,22)GGTTATGCTGGTAGCGTTCAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.289 kcal/mol
Forward Dimers-0.408 kcal/mol
Reverse Loops0.563 kcal/mol
Reverse Dimers-1.273 kcal/mol
Forward-Reverse Dimers-2.311 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAA
CAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACG
CTACCAGCATAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1342961 - 3094
Exon 14 To Exon 15 (Pair 15)
Forward (3267,21)TCCTCATCAGCCCAGAGTTCTAmplicon SizecDNA: 164 bpgenomic: 13,901
Reverse (3430,21)GTTGAGGAATCCCACAAGGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.794 kcal/mol in 3' area
Forward Dimers-0.318 kcal/mol
Reverse Loops1.035 kcal/mol
Reverse Dimers-1.286 kcal/mol
Forward-Reverse Dimers-2.928 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTCCTCATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGT
TTACAAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACT
TTGAACGCTACCAGCATAACCGCGACCTTGTGGGATTCCTCAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1642954 - 3117
Exon 14 To Exon 15 (Pair 16)
Forward (3266,21)TTCCTCATCAGCCCAGAGTTCAmplicon SizecDNA: 145 bpgenomic: 13,882
Reverse (3410,20)CGCGGTTATGCTGGTAGCGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol in 3' area
Forward Dimers-0.318 kcal/mol
Reverse Loops0.737 kcal/mol in 3' area
Reverse Dimers-2.414 kcal/mol
Forward-Reverse Dimers-2.409 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTTCCTCATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATG
TTTACAAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCAC
TTTGAACGCTACCAGCATAACCGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1452953 - 3097
Exon 14 To Exon 15 (Pair 17)
Forward (3210,21)CTCACTCTACCTCCAGATCCAAmplicon SizecDNA: 201 bpgenomic: 13,938
Reverse (3410,20)CGCGGTTATGCTGGTAGCGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.19 kcal/mol
Forward Dimers-0.65 kcal/mol
Reverse Loops0.737 kcal/mol in 3' area
Reverse Dimers-2.414 kcal/mol
Forward-Reverse Dimers-2.405 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceCTCACTCTACCTCCAGATCCAGGATCACGTTGCTGTTACAGTCTCCCCCCGTGAAGTTCC
TCATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTA
CAAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTG
AACGCTACCAGCATAACCGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)2012897 - 3097
Exon 14 To Exon 15 (Pair 18)
Forward (3290,21)ACCGTGCTGCATTCTAACCCTAmplicon SizecDNA: 121 bpgenomic: 13,858
Reverse (3410,20)CGCGGTTATGCTGGTAGCGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.264 kcal/mol
Forward Dimers-2.138 kcal/mol
Reverse Loops0.737 kcal/mol in 3' area
Reverse Dimers-2.414 kcal/mol
Forward-Reverse Dimers-2.88 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAACAACACGTGTTTGAAG
CACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACGCTACCAGCATAACCGC
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1212977 - 3097
Exon 14 To Exon 15 (Pair 19)
Forward (3211,21)TCACTCTACCTCCAGATCCAGAmplicon SizecDNA: 196 bpgenomic: 13,933
Reverse (3406,22)GTTATGCTGGTAGCGTTCAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.19 kcal/mol
Forward Dimers-0.65 kcal/mol
Reverse Loops0.563 kcal/mol
Reverse Dimers-1.273 kcal/mol
Forward-Reverse Dimers-2.405 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTCACTCTACCTCCAGATCCAGGATCACGTTGCTGTTACAGTCTCCCCCCGTGAAGTTCCT
CATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTAC
AAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGA
ACGCTACCAGCATAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1962898 - 3093
Exon 14 To Exon 15 (Pair 20)
Forward (3266,21)TTCCTCATCAGCCCAGAGTTCAmplicon SizecDNA: 139 bpgenomic: 13,876
Reverse (3404,22)TATGCTGGTAGCGTTCAAAGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol in 3' area
Forward Dimers-0.318 kcal/mol
Reverse Loops0.563 kcal/mol
Reverse Dimers-1.273 kcal/mol
Forward-Reverse Dimers-2.409 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTTCCTCATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATG
TTTACAAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCAC
TTTGAACGCTACCAGCATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1392953 - 3091
Exon 14 To Exon 15 (Pair 21)
Forward (3274,20)CAGCCCAGAGTTCTTCACCGAmplicon SizecDNA: 128 bpgenomic: 13,865
Reverse (3401,21)GCTGGTAGCGTTCAAAGTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.289 kcal/mol
Forward Dimers-0.408 kcal/mol
Reverse Loops1.261 kcal/mol
Reverse Dimers-0.575 kcal/mol
Forward-Reverse Dimers-2.311 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAA
CAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACG
CTACCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1282961 - 3088
Exon 14 To Exon 15 (Pair 22)
Forward (3277,20)CCCAGAGTTCTTCACCGTGCAmplicon SizecDNA: 128 bpgenomic: 13,865
Reverse (3404,22)TATGCTGGTAGCGTTCAAAGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.289 kcal/mol
Forward Dimers-0.408 kcal/mol
Reverse Loops0.563 kcal/mol
Reverse Dimers-1.273 kcal/mol
Forward-Reverse Dimers-2.311 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAACAA
CACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACGCTA
CCAGCATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1282964 - 3091
Exon 14 To Exon 15 (Pair 23)
Forward (3211,21)TCACTCTACCTCCAGATCCAGAmplicon SizecDNA: 187 bpgenomic: 13,924
Reverse (3397,21)GTAGCGTTCAAAGTGGTGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.19 kcal/mol
Forward Dimers-0.65 kcal/mol
Reverse Loops2.285 kcal/mol
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-2.054 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTCACTCTACCTCCAGATCCAGGATCACGTTGCTGTTACAGTCTCCCCCCGTGAAGTTCCT
CATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTAC
AAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGA
ACGCTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1872898 - 3084
Exon 14 To Exon 15 (Pair 24)
Forward (3266,21)TTCCTCATCAGCCCAGAGTTCAmplicon SizecDNA: 137 bpgenomic: 13,874
Reverse (3402,21)TGCTGGTAGCGTTCAAAGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol in 3' area
Forward Dimers-0.318 kcal/mol
Reverse Loops0.815 kcal/mol
Reverse Dimers-1.021 kcal/mol
Forward-Reverse Dimers-2.409 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTTCCTCATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATG
TTTACAAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCAC
TTTGAACGCTACCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1372953 - 3089
Exon 14 To Exon 15 (Pair 25)
Forward (3285,22)TCTTCACCGTGCTGCATTCTAAAmplicon SizecDNA: 118 bpgenomic: 13,855
Reverse (3402,21)TGCTGGTAGCGTTCAAAGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.251 kcal/mol
Forward Dimers-2.138 kcal/mol
Reverse Loops0.815 kcal/mol
Reverse Dimers-1.021 kcal/mol
Forward-Reverse Dimers-1.679 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAACAACACGTGTT
TGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACGCTACCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1182972 - 3089
Exon 14 To Exon 15 (Pair 26)
Forward (3210,21)CTCACTCTACCTCCAGATCCAAmplicon SizecDNA: 191 bpgenomic: 13,928
Reverse (3400,21)CTGGTAGCGTTCAAAGTGGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.19 kcal/mol
Forward Dimers-0.65 kcal/mol
Reverse Loops2.285 kcal/mol in 3' area
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-2.199 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceCTCACTCTACCTCCAGATCCAGGATCACGTTGCTGTTACAGTCTCCCCCCGTGAAGTTCC
TCATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTA
CAAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTG
AACGCTACCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1912897 - 3087
Exon 14 To Exon 15 (Pair 27)
Forward (3277,20)CCCAGAGTTCTTCACCGTGCAmplicon SizecDNA: 130 bpgenomic: 13,867
Reverse (3406,22)GTTATGCTGGTAGCGTTCAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.289 kcal/mol
Forward Dimers-0.408 kcal/mol
Reverse Loops0.563 kcal/mol
Reverse Dimers-1.273 kcal/mol
Forward-Reverse Dimers-2.311 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAACAA
CACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACGCTA
CCAGCATAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1302964 - 3093
Exon 14 To Exon 15 (Pair 28)
Forward (3276,20)GCCCAGAGTTCTTCACCGTGAmplicon SizecDNA: 129 bpgenomic: 13,866
Reverse (3404,22)TATGCTGGTAGCGTTCAAAGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.289 kcal/mol
Forward Dimers-0.408 kcal/mol
Reverse Loops0.563 kcal/mol
Reverse Dimers-1.273 kcal/mol
Forward-Reverse Dimers-2.311 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAACA
ACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACGCT
ACCAGCATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1292963 - 3091
Exon 14 To Exon 15 (Pair 29)
Forward (3267,21)TCCTCATCAGCCCAGAGTTCTAmplicon SizecDNA: 134 bpgenomic: 13,871
Reverse (3400,21)CTGGTAGCGTTCAAAGTGGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.794 kcal/mol in 3' area
Forward Dimers-0.318 kcal/mol
Reverse Loops2.285 kcal/mol in 3' area
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTCCTCATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGT
TTACAAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACT
TTGAACGCTACCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1342954 - 3087
Exon 14 To Exon 15 (Pair 30)
Forward (3262,21)GAAGTTCCTCATCAGCCCAGAAmplicon SizecDNA: 149 bpgenomic: 13,886
Reverse (3410,20)CGCGGTTATGCTGGTAGCGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.757 kcal/mol
Forward Dimers-0.406 kcal/mol
Reverse Loops0.737 kcal/mol in 3' area
Reverse Dimers-2.414 kcal/mol
Forward-Reverse Dimers-2.409 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceGAAGTTCCTCATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCG
CATGTTTACAAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCA
CCACTTTGAACGCTACCAGCATAACCGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1492949 - 3097
Exon 14 To Exon 15 (Pair 31)
Forward (3285,22)TCTTCACCGTGCTGCATTCTAAAmplicon SizecDNA: 122 bpgenomic: 13,859
Reverse (3406,22)GTTATGCTGGTAGCGTTCAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.251 kcal/mol
Forward Dimers-2.138 kcal/mol
Reverse Loops0.563 kcal/mol
Reverse Dimers-1.273 kcal/mol
Forward-Reverse Dimers-2.063 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAACAACACGTGTT
TGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACGCTACCAGCATA
AC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1222972 - 3093
Exon 14 To Exon 15 (Pair 32)
Forward (3261,21)TGAAGTTCCTCATCAGCCCAGAmplicon SizecDNA: 79 bpgenomic: 13,816
Reverse (3339,23)GTGTTGTTTGTAAACATGCGGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.757 kcal/mol
Forward Dimers-0.406 kcal/mol
Reverse Loops0.828 kcal/mol in 3' area
Reverse Dimers-1.122 kcal/mol
Forward-Reverse Dimers-1.143 kcal/mol
Amplicon Folding0.483 kcal/mol inside primersite
Amplicon SequenceTGAAGTTCCTCATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACC
GCATGTTTACAAACAACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)792948 - 3026
Exon 14 To Exon 15 (Pair 33)
Forward (3211,21)TCACTCTACCTCCAGATCCAGAmplicon SizecDNA: 200 bpgenomic: 13,937
Reverse (3410,20)CGCGGTTATGCTGGTAGCGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.19 kcal/mol
Forward Dimers-0.65 kcal/mol
Reverse Loops0.737 kcal/mol in 3' area
Reverse Dimers-2.414 kcal/mol
Forward-Reverse Dimers-2.405 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTCACTCTACCTCCAGATCCAGGATCACGTTGCTGTTACAGTCTCCCCCCGTGAAGTTCCT
CATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTAC
AAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGA
ACGCTACCAGCATAACCGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)2002898 - 3097
Exon 14 To Exon 15 (Pair 34)
Forward (3211,21)TCACTCTACCTCCAGATCCAGAmplicon SizecDNA: 191 bpgenomic: 13,928
Reverse (3401,21)GCTGGTAGCGTTCAAAGTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.19 kcal/mol
Forward Dimers-0.65 kcal/mol
Reverse Loops1.261 kcal/mol
Reverse Dimers-0.575 kcal/mol
Forward-Reverse Dimers-2.405 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTCACTCTACCTCCAGATCCAGGATCACGTTGCTGTTACAGTCTCCCCCCGTGAAGTTCCT
CATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTAC
AAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGA
ACGCTACCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1912898 - 3088
Exon 14 To Exon 15 (Pair 35)
Forward (3284,22)TTCTTCACCGTGCTGCATTCTAAmplicon SizecDNA: 118 bpgenomic: 13,855
Reverse (3401,21)GCTGGTAGCGTTCAAAGTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.251 kcal/mol
Forward Dimers-2.138 kcal/mol
Reverse Loops1.261 kcal/mol
Reverse Dimers-0.575 kcal/mol
Forward-Reverse Dimers-1.679 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAACAACACGTGT
TTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACGCTACCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1182971 - 3088
Exon 14 To Exon 15 (Pair 36)
Forward (3266,21)TTCCTCATCAGCCCAGAGTTCAmplicon SizecDNA: 136 bpgenomic: 13,873
Reverse (3401,21)GCTGGTAGCGTTCAAAGTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol in 3' area
Forward Dimers-0.318 kcal/mol
Reverse Loops1.261 kcal/mol
Reverse Dimers-0.575 kcal/mol
Forward-Reverse Dimers-2.311 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTTCCTCATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATG
TTTACAAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCAC
TTTGAACGCTACCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1362953 - 3088
Exon 14 To Exon 15 (Pair 37)
Forward (3211,21)TCACTCTACCTCCAGATCCAGAmplicon SizecDNA: 190 bpgenomic: 13,927
Reverse (3400,21)CTGGTAGCGTTCAAAGTGGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.19 kcal/mol
Forward Dimers-0.65 kcal/mol
Reverse Loops2.285 kcal/mol in 3' area
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-2.199 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTCACTCTACCTCCAGATCCAGGATCACGTTGCTGTTACAGTCTCCCCCCGTGAAGTTCCT
CATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTAC
AAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGA
ACGCTACCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1902898 - 3087
Exon 14 To Exon 15 (Pair 38)
Forward (3277,20)CCCAGAGTTCTTCACCGTGCAmplicon SizecDNA: 125 bpgenomic: 13,862
Reverse (3401,21)GCTGGTAGCGTTCAAAGTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.289 kcal/mol
Forward Dimers-0.408 kcal/mol
Reverse Loops1.261 kcal/mol
Reverse Dimers-0.575 kcal/mol
Forward-Reverse Dimers-2.311 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAACAA
CACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACGCTA
CCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1252964 - 3088
Exon 14 To Exon 15 (Pair 39)
Forward (3266,21)TTCCTCATCAGCCCAGAGTTCAmplicon SizecDNA: 162 bpgenomic: 13,899
Reverse (3427,20)GAGGAATCCCACAAGGTCGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol in 3' area
Forward Dimers-0.318 kcal/mol
Reverse Loops1.035 kcal/mol
Reverse Dimers-1.286 kcal/mol
Forward-Reverse Dimers-2.483 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTTCCTCATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATG
TTTACAAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCAC
TTTGAACGCTACCAGCATAACCGCGACCTTGTGGGATTCCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1622953 - 3114
Exon 14 To Exon 15 (Pair 40)
Forward (3266,21)TTCCTCATCAGCCCAGAGTTCAmplicon SizecDNA: 135 bpgenomic: 13,872
Reverse (3400,21)CTGGTAGCGTTCAAAGTGGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol in 3' area
Forward Dimers-0.318 kcal/mol
Reverse Loops2.285 kcal/mol in 3' area
Reverse Dimers-0.214 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTTCCTCATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATG
TTTACAAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCAC
TTTGAACGCTACCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1352953 - 3087
Exon 14 To Exon 15 (Pair 41)
Forward (3211,21)TCACTCTACCTCCAGATCCAGAmplicon SizecDNA: 192 bpgenomic: 13,929
Reverse (3402,21)TGCTGGTAGCGTTCAAAGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.19 kcal/mol
Forward Dimers-0.65 kcal/mol
Reverse Loops0.815 kcal/mol
Reverse Dimers-1.021 kcal/mol
Forward-Reverse Dimers-2.405 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTCACTCTACCTCCAGATCCAGGATCACGTTGCTGTTACAGTCTCCCCCCGTGAAGTTCCT
CATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTAC
AAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGA
ACGCTACCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1922898 - 3089
Exon 14 To Exon 15 (Pair 42)
Forward (3267,21)TCCTCATCAGCCCAGAGTTCTAmplicon SizecDNA: 138 bpgenomic: 13,875
Reverse (3404,22)TATGCTGGTAGCGTTCAAAGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.794 kcal/mol in 3' area
Forward Dimers-0.318 kcal/mol
Reverse Loops0.563 kcal/mol
Reverse Dimers-1.273 kcal/mol
Forward-Reverse Dimers-2.409 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTCCTCATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGT
TTACAAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACT
TTGAACGCTACCAGCATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1382954 - 3091
Exon 14 To Exon 15 (Pair 43)
Forward (3276,20)GCCCAGAGTTCTTCACCGTGAmplicon SizecDNA: 127 bpgenomic: 13,864
Reverse (3402,21)TGCTGGTAGCGTTCAAAGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.289 kcal/mol
Forward Dimers-0.408 kcal/mol
Reverse Loops0.815 kcal/mol
Reverse Dimers-1.021 kcal/mol
Forward-Reverse Dimers-2.311 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAACA
ACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACGCT
ACCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1272963 - 3089
Exon 14 To Exon 15 (Pair 44)
Forward (3288,21)TCACCGTGCTGCATTCTAACCAmplicon SizecDNA: 115 bpgenomic: 13,852
Reverse (3402,21)TGCTGGTAGCGTTCAAAGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.251 kcal/mol
Forward Dimers-2.138 kcal/mol
Reverse Loops0.815 kcal/mol
Reverse Dimers-1.021 kcal/mol
Forward-Reverse Dimers-1.679 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAACAACACGTGTTTGA
AGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACGCTACCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1152975 - 3089
Exon 14 To Exon 15 (Pair 45)
Forward (3274,20)CAGCCCAGAGTTCTTCACCGAmplicon SizecDNA: 129 bpgenomic: 13,866
Reverse (3402,21)TGCTGGTAGCGTTCAAAGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.289 kcal/mol
Forward Dimers-0.408 kcal/mol
Reverse Loops0.815 kcal/mol
Reverse Dimers-1.021 kcal/mol
Forward-Reverse Dimers-2.311 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAA
CAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACG
CTACCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1292961 - 3089
Exon 14 To Exon 15 (Pair 46)
Forward (3262,21)GAAGTTCCTCATCAGCCCAGAAmplicon SizecDNA: 143 bpgenomic: 13,880
Reverse (3404,22)TATGCTGGTAGCGTTCAAAGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.757 kcal/mol
Forward Dimers-0.406 kcal/mol
Reverse Loops0.563 kcal/mol
Reverse Dimers-1.273 kcal/mol
Forward-Reverse Dimers-2.409 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceGAAGTTCCTCATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCG
CATGTTTACAAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCA
CCACTTTGAACGCTACCAGCATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1432949 - 3091
Exon 14 To Exon 15 (Pair 47)
Forward (3267,21)TCCTCATCAGCCCAGAGTTCTAmplicon SizecDNA: 136 bpgenomic: 13,873
Reverse (3402,21)TGCTGGTAGCGTTCAAAGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.794 kcal/mol in 3' area
Forward Dimers-0.318 kcal/mol
Reverse Loops0.815 kcal/mol
Reverse Dimers-1.021 kcal/mol
Forward-Reverse Dimers-2.409 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTCCTCATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGT
TTACAAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACT
TTGAACGCTACCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1362954 - 3089
Exon 14 To Exon 15 (Pair 48)
Forward (3211,21)TCACTCTACCTCCAGATCCAGAmplicon SizecDNA: 197 bpgenomic: 13,934
Reverse (3407,22)GGTTATGCTGGTAGCGTTCAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.19 kcal/mol
Forward Dimers-0.65 kcal/mol
Reverse Loops0.563 kcal/mol
Reverse Dimers-1.273 kcal/mol
Forward-Reverse Dimers-2.405 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTCACTCTACCTCCAGATCCAGGATCACGTTGCTGTTACAGTCTCCCCCCGTGAAGTTCCT
CATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTAC
AAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGA
ACGCTACCAGCATAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1972898 - 3094
Exon 14 To Exon 15 (Pair 49)
Forward (3272,21)ATCAGCCCAGAGTTCTTCACCAmplicon SizecDNA: 139 bpgenomic: 13,876
Reverse (3410,20)CGCGGTTATGCTGGTAGCGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.289 kcal/mol
Forward Dimers-0.408 kcal/mol
Reverse Loops0.737 kcal/mol in 3' area
Reverse Dimers-2.414 kcal/mol
Forward-Reverse Dimers-2.311 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACA
AACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAA
CGCTACCAGCATAACCGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1392959 - 3097
Exon 14 To Exon 15 (Pair 50)
Forward (3262,21)GAAGTTCCTCATCAGCCCAGAAmplicon SizecDNA: 78 bpgenomic: 13,815
Reverse (3339,23)GTGTTGTTTGTAAACATGCGGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.757 kcal/mol
Forward Dimers-0.406 kcal/mol
Reverse Loops0.828 kcal/mol in 3' area
Reverse Dimers-1.122 kcal/mol
Forward-Reverse Dimers-1.143 kcal/mol
Amplicon Folding0.483 kcal/mol inside primersite
Amplicon SequenceGAAGTTCCTCATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCG
CATGTTTACAAACAACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)782949 - 3026
Exon 14 To Exon 15 (Pair 51)
Forward (3267,21)TCCTCATCAGCCCAGAGTTCTAmplicon SizecDNA: 144 bpgenomic: 13,881
Reverse (3410,20)CGCGGTTATGCTGGTAGCGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.794 kcal/mol in 3' area
Forward Dimers-0.318 kcal/mol
Reverse Loops0.737 kcal/mol in 3' area
Reverse Dimers-2.414 kcal/mol
Forward-Reverse Dimers-2.409 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTCCTCATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGT
TTACAAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACT
TTGAACGCTACCAGCATAACCGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1442954 - 3097
Exon 14 To Exon 15 (Pair 52)
Forward (3288,21)TCACCGTGCTGCATTCTAACCAmplicon SizecDNA: 117 bpgenomic: 13,854
Reverse (3404,22)TATGCTGGTAGCGTTCAAAGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.251 kcal/mol
Forward Dimers-2.138 kcal/mol
Reverse Loops0.563 kcal/mol
Reverse Dimers-1.273 kcal/mol
Forward-Reverse Dimers-2.063 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTACAAACAACACGTGTTTGA
AGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGAACGCTACCAGCATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1172975 - 3091
Exon 14 To Exon 15 (Pair 53)
Forward (3211,21)TCACTCTACCTCCAGATCCAGAmplicon SizecDNA: 194 bpgenomic: 13,931
Reverse (3404,22)TATGCTGGTAGCGTTCAAAGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.19 kcal/mol
Forward Dimers-0.65 kcal/mol
Reverse Loops0.563 kcal/mol
Reverse Dimers-1.273 kcal/mol
Forward-Reverse Dimers-2.405 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTCACTCTACCTCCAGATCCAGGATCACGTTGCTGTTACAGTCTCCCCCCGTGAAGTTCCT
CATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGTTTAC
AAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACTTTGA
ACGCTACCAGCATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1942898 - 3091
Exon 14 To Exon 15 (Pair 54)
Forward (3267,21)TCCTCATCAGCCCAGAGTTCTAmplicon SizecDNA: 140 bpgenomic: 13,877
Reverse (3406,22)GTTATGCTGGTAGCGTTCAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.794 kcal/mol in 3' area
Forward Dimers-0.318 kcal/mol
Reverse Loops0.563 kcal/mol
Reverse Dimers-1.273 kcal/mol
Forward-Reverse Dimers-2.409 kcal/mol
Amplicon Folding-2.422 kcal/mol outside primersite
Amplicon SequenceTCCTCATCAGCCCAGAGTTCTTCACCGTGCTGCATTCTAACCCTAGTGCCTACCGCATGT
TTACAAACAACACGTGTTTGAAGCACATGATCACCAAAGTCCGGAGGGACACCCACCACT
TTGAACGCTACCAGCATAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_020760 (HECW2)1402954 - 3093
 

See below for some more details.

Program Output:

Loading ...