Design Results for HMG20A

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size400

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 3 (Pair 1)
Forward (138,24)TTCTATAAAGCAAAGCTACACATCAmplicon SizecDNA: 146 bpgenomic: 10,738
Reverse (283,22)AGCCAGATCATTACTCTCCTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.913 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-1.296 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTTCTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAA
GAGAGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACG
GTTCCAAGGAGAGTAATGATCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)146137 - 282
Exon 2 To Exon 3 (Pair 2)
Forward (139,24)TCTATAAAGCAAAGCTACACATCAAmplicon SizecDNA: 150 bpgenomic: 10,742
Reverse (288,22)GTGGTAGCCAGATCATTACTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTCTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAG
AGAGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGG
TTCCAAGGAGAGTAATGATCTGGCTACCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)150138 - 287
Exon 2 To Exon 3 (Pair 3)
Forward (147,22)GCAAAGCTACACATCACTTGACAmplicon SizecDNA: 143 bpgenomic: 10,735
Reverse (289,22)AGTGGTAGCCAGATCATTACTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGATGG
AAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGG
AGAGTAATGATCTGGCTACCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)143146 - 288
Exon 2 To Exon 3 (Pair 4)
Forward (152,22)GCTACACATCACTTGACACCATAmplicon SizecDNA: 139 bpgenomic: 10,731
Reverse (290,22)CAGTGGTAGCCAGATCATTACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.353 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAAC
TTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGGAGAGT
AATGATCTGGCTACCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)139151 - 289
Exon 2 To Exon 3 (Pair 5)
Forward (142,24)ATAAAGCAAAGCTACACATCACTTAmplicon SizecDNA: 147 bpgenomic: 10,739
Reverse (288,22)GTGGTAGCCAGATCATTACTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGA
GATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTC
CAAGGAGAGTAATGATCTGGCTACCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)147141 - 287
Exon 2 To Exon 3 (Pair 6)
Forward (107,22)GTCTCTACAAGGAAGATAACGGAmplicon SizecDNA: 182 bpgenomic: 10,774
Reverse (288,22)GTGGTAGCCAGATCATTACTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.965 kcal/mol
Forward Dimers-0.479 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-1.183 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceGTCTCTACAAGGAAGATAACGGACTGTAAAATTCTATAAAGCAAAGCTACACATCACTTG
ACACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAACTTGATGACTAGCTCC
ACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGGAGAGTAATGATCTGGCTACC
AC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)182106 - 287
Exon 2 To Exon 3 (Pair 7)
Forward (145,23)AAGCAAAGCTACACATCACTTGAAmplicon SizecDNA: 144 bpgenomic: 10,736
Reverse (288,22)GTGGTAGCCAGATCATTACTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGAT
GGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAA
GGAGAGTAATGATCTGGCTACCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)144144 - 287
Exon 2 To Exon 3 (Pair 8)
Forward (144,23)AAAGCAAAGCTACACATCACTTGAmplicon SizecDNA: 123 bpgenomic: 10,715
Reverse (266,21)CCTTGGAACCGTCTTCATCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.464 kcal/mol
Reverse Dimers-0.668 kcal/mol
Forward-Reverse Dimers-0.783 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGA
TGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCA
AGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)123143 - 265
Exon 2 To Exon 3 (Pair 9)
Forward (139,24)TCTATAAAGCAAAGCTACACATCAAmplicon SizecDNA: 149 bpgenomic: 10,741
Reverse (287,22)TGGTAGCCAGATCATTACTCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTCTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAG
AGAGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGG
TTCCAAGGAGAGTAATGATCTGGCTACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)149138 - 286
Exon 2 To Exon 3 (Pair 10)
Forward (144,23)AAAGCAAAGCTACACATCACTTGAmplicon SizecDNA: 147 bpgenomic: 10,739
Reverse (290,22)CAGTGGTAGCCAGATCATTACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGA
TGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCA
AGGAGAGTAATGATCTGGCTACCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)147143 - 289
Exon 2 To Exon 3 (Pair 11)
Forward (138,24)TTCTATAAAGCAAAGCTACACATCAmplicon SizecDNA: 148 bpgenomic: 10,740
Reverse (285,22)GTAGCCAGATCATTACTCTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.913 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTTCTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAA
GAGAGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACG
GTTCCAAGGAGAGTAATGATCTGGCTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)148137 - 284
Exon 2 To Exon 3 (Pair 12)
Forward (109,22)CTCTACAAGGAAGATAACGGACAmplicon SizecDNA: 121 bpgenomic: 10,713
Reverse (229,22)GGTGGAGCTAGTCATCAAGTTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops1.754 kcal/mol
Reverse Dimers-2.822 kcal/mol
Forward-Reverse Dimers-0.94 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceCTCTACAAGGAAGATAACGGACTGTAAAATTCTATAAAGCAAAGCTACACATCACTTGAC
ACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAACTTGATGACTAGCTCCAC
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)121108 - 228
Exon 2 To Exon 3 (Pair 13)
Forward (139,24)TCTATAAAGCAAAGCTACACATCAAmplicon SizecDNA: 145 bpgenomic: 10,737
Reverse (283,22)AGCCAGATCATTACTCTCCTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.913 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-1.296 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTCTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAG
AGAGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGG
TTCCAAGGAGAGTAATGATCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)145138 - 282
Exon 2 To Exon 3 (Pair 14)
Forward (109,22)CTCTACAAGGAAGATAACGGACAmplicon SizecDNA: 180 bpgenomic: 10,772
Reverse (288,22)GTGGTAGCCAGATCATTACTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-1.183 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceCTCTACAAGGAAGATAACGGACTGTAAAATTCTATAAAGCAAAGCTACACATCACTTGAC
ACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAACTTGATGACTAGCTCCAC
CCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGGAGAGTAATGATCTGGCTACCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)180108 - 287
Exon 2 To Exon 3 (Pair 15)
Forward (141,24)TATAAAGCAAAGCTACACATCACTAmplicon SizecDNA: 141 bpgenomic: 10,733
Reverse (281,22)CCAGATCATTACTCTCCTTGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.23 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-0.873 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAG
AGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTT
CCAAGGAGAGTAATGATCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)141140 - 280
Exon 2 To Exon 3 (Pair 16)
Forward (107,22)GTCTCTACAAGGAAGATAACGGAmplicon SizecDNA: 124 bpgenomic: 10,716
Reverse (230,21)GGGTGGAGCTAGTCATCAAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.965 kcal/mol
Forward Dimers-0.479 kcal/mol
Reverse Loops1.754 kcal/mol
Reverse Dimers-2.822 kcal/mol
Forward-Reverse Dimers-1.099 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceGTCTCTACAAGGAAGATAACGGACTGTAAAATTCTATAAAGCAAAGCTACACATCACTTG
ACACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAACTTGATGACTAGCTCC
ACCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)124106 - 229
Exon 2 To Exon 3 (Pair 17)
Forward (144,23)AAAGCAAAGCTACACATCACTTGAmplicon SizecDNA: 142 bpgenomic: 10,734
Reverse (285,22)GTAGCCAGATCATTACTCTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.913 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGA
TGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCA
AGGAGAGTAATGATCTGGCTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)142143 - 284
Exon 2 To Exon 3 (Pair 18)
Forward (151,22)AGCTACACATCACTTGACACCAAmplicon SizecDNA: 135 bpgenomic: 10,727
Reverse (285,22)GTAGCCAGATCATTACTCTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-1.696 kcal/mol
Reverse Loops1.913 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAA
CTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGGAGAG
TAATGATCTGGCTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)135150 - 284
Exon 2 To Exon 3 (Pair 19)
Forward (145,23)AAGCAAAGCTACACATCACTTGAAmplicon SizecDNA: 139 bpgenomic: 10,731
Reverse (283,22)AGCCAGATCATTACTCTCCTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.913 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-1.296 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGAT
GGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAA
GGAGAGTAATGATCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)139144 - 282
Exon 2 To Exon 3 (Pair 21)
Forward (147,22)GCAAAGCTACACATCACTTGACAmplicon SizecDNA: 141 bpgenomic: 10,733
Reverse (287,22)TGGTAGCCAGATCATTACTCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGATGG
AAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGG
AGAGTAATGATCTGGCTACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)141146 - 286
Exon 2 To Exon 3 (Pair 22)
Forward (145,23)AAGCAAAGCTACACATCACTTGAAmplicon SizecDNA: 146 bpgenomic: 10,738
Reverse (290,22)CAGTGGTAGCCAGATCATTACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGAT
GGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAA
GGAGAGTAATGATCTGGCTACCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)146144 - 289
Exon 2 To Exon 3 (Pair 23)
Forward (109,22)CTCTACAAGGAAGATAACGGACAmplicon SizecDNA: 125 bpgenomic: 10,717
Reverse (233,21)GTAGGGTGGAGCTAGTCATCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops1.754 kcal/mol in 3' area
Reverse Dimers-2.822 kcal/mol
Forward-Reverse Dimers-0.94 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceCTCTACAAGGAAGATAACGGACTGTAAAATTCTATAAAGCAAAGCTACACATCACTTGAC
ACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAACTTGATGACTAGCTCCAC
CCTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)125108 - 232
Exon 2 To Exon 3 (Pair 24)
Forward (150,22)AAGCTACACATCACTTGACACCAmplicon SizecDNA: 140 bpgenomic: 10,732
Reverse (289,22)AGTGGTAGCCAGATCATTACTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAA
ACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGGAGA
GTAATGATCTGGCTACCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)140149 - 288
Exon 2 To Exon 3 (Pair 25)
Forward (107,22)GTCTCTACAAGGAAGATAACGGAmplicon SizecDNA: 129 bpgenomic: 10,721
Reverse (235,20)CGGTAGGGTGGAGCTAGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.965 kcal/mol
Forward Dimers-0.479 kcal/mol
Reverse Loops1.754 kcal/mol in 3' area
Reverse Dimers-2.822 kcal/mol
Forward-Reverse Dimers-1.099 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceGTCTCTACAAGGAAGATAACGGACTGTAAAATTCTATAAAGCAAAGCTACACATCACTTG
ACACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAACTTGATGACTAGCTCC
ACCCTACCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)129106 - 234
Exon 2 To Exon 3 (Pair 26)
Forward (147,22)GCAAAGCTACACATCACTTGACAmplicon SizecDNA: 139 bpgenomic: 10,731
Reverse (285,22)GTAGCCAGATCATTACTCTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.913 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGATGG
AAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGG
AGAGTAATGATCTGGCTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)139146 - 284
Exon 2 To Exon 3 (Pair 27)
Forward (151,22)AGCTACACATCACTTGACACCAAmplicon SizecDNA: 137 bpgenomic: 10,729
Reverse (287,22)TGGTAGCCAGATCATTACTCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-1.696 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAA
CTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGGAGAG
TAATGATCTGGCTACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)137150 - 286
Exon 2 To Exon 3 (Pair 28)
Forward (145,23)AAGCAAAGCTACACATCACTTGAAmplicon SizecDNA: 143 bpgenomic: 10,735
Reverse (287,22)TGGTAGCCAGATCATTACTCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGAT
GGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAA
GGAGAGTAATGATCTGGCTACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)143144 - 286
Exon 2 To Exon 3 (Pair 29)
Forward (147,22)GCAAAGCTACACATCACTTGACAmplicon SizecDNA: 144 bpgenomic: 10,736
Reverse (290,22)CAGTGGTAGCCAGATCATTACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGATGG
AAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGG
AGAGTAATGATCTGGCTACCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)144146 - 289
Exon 2 To Exon 3 (Pair 30)
Forward (138,24)TTCTATAAAGCAAAGCTACACATCAmplicon SizecDNA: 153 bpgenomic: 10,745
Reverse (290,22)CAGTGGTAGCCAGATCATTACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTTCTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAA
GAGAGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACG
GTTCCAAGGAGAGTAATGATCTGGCTACCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)153137 - 289
Exon 2 To Exon 3 (Pair 31)
Forward (107,22)GTCTCTACAAGGAAGATAACGGAmplicon SizecDNA: 127 bpgenomic: 10,719
Reverse (233,21)GTAGGGTGGAGCTAGTCATCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.965 kcal/mol
Forward Dimers-0.479 kcal/mol
Reverse Loops1.754 kcal/mol in 3' area
Reverse Dimers-2.822 kcal/mol
Forward-Reverse Dimers-1.099 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceGTCTCTACAAGGAAGATAACGGACTGTAAAATTCTATAAAGCAAAGCTACACATCACTTG
ACACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAACTTGATGACTAGCTCC
ACCCTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)127106 - 232
Exon 2 To Exon 3 (Pair 32)
Forward (144,23)AAAGCAAAGCTACACATCACTTGAmplicon SizecDNA: 145 bpgenomic: 10,737
Reverse (288,22)GTGGTAGCCAGATCATTACTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGA
TGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCA
AGGAGAGTAATGATCTGGCTACCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)145143 - 287
Exon 2 To Exon 3 (Pair 33)
Forward (144,23)AAAGCAAAGCTACACATCACTTGAmplicon SizecDNA: 146 bpgenomic: 10,738
Reverse (289,22)AGTGGTAGCCAGATCATTACTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGA
TGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCA
AGGAGAGTAATGATCTGGCTACCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)146143 - 288
Exon 2 To Exon 3 (Pair 34)
Forward (141,24)TATAAAGCAAAGCTACACATCACTAmplicon SizecDNA: 145 bpgenomic: 10,737
Reverse (285,22)GTAGCCAGATCATTACTCTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.913 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAG
AGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTT
CCAAGGAGAGTAATGATCTGGCTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)145140 - 284
Exon 2 To Exon 3 (Pair 35)
Forward (141,24)TATAAAGCAAAGCTACACATCACTAmplicon SizecDNA: 149 bpgenomic: 10,741
Reverse (289,22)AGTGGTAGCCAGATCATTACTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAG
AGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTT
CCAAGGAGAGTAATGATCTGGCTACCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)149140 - 288
Exon 2 To Exon 3 (Pair 36)
Forward (138,24)TTCTATAAAGCAAAGCTACACATCAmplicon SizecDNA: 144 bpgenomic: 10,736
Reverse (281,22)CCAGATCATTACTCTCCTTGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.23 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-0.873 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTTCTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAA
GAGAGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACG
GTTCCAAGGAGAGTAATGATCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)144137 - 280
Exon 2 To Exon 3 (Pair 37)
Forward (142,24)ATAAAGCAAAGCTACACATCACTTAmplicon SizecDNA: 142 bpgenomic: 10,734
Reverse (283,22)AGCCAGATCATTACTCTCCTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.913 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-1.296 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGA
GATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTC
CAAGGAGAGTAATGATCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)142141 - 282
Exon 2 To Exon 3 (Pair 38)
Forward (151,22)AGCTACACATCACTTGACACCAAmplicon SizecDNA: 133 bpgenomic: 10,725
Reverse (283,22)AGCCAGATCATTACTCTCCTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-1.696 kcal/mol
Reverse Loops1.913 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-1.296 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAA
CTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGGAGAG
TAATGATCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)133150 - 282
Exon 2 To Exon 3 (Pair 39)
Forward (107,22)GTCTCTACAAGGAAGATAACGGAmplicon SizecDNA: 123 bpgenomic: 10,715
Reverse (229,22)GGTGGAGCTAGTCATCAAGTTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.965 kcal/mol
Forward Dimers-0.479 kcal/mol
Reverse Loops1.754 kcal/mol
Reverse Dimers-2.822 kcal/mol
Forward-Reverse Dimers-1.099 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceGTCTCTACAAGGAAGATAACGGACTGTAAAATTCTATAAAGCAAAGCTACACATCACTTG
ACACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAACTTGATGACTAGCTCC
ACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)123106 - 228
Exon 2 To Exon 3 (Pair 40)
Forward (109,22)CTCTACAAGGAAGATAACGGACAmplicon SizecDNA: 122 bpgenomic: 10,714
Reverse (230,21)GGGTGGAGCTAGTCATCAAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops1.754 kcal/mol
Reverse Dimers-2.822 kcal/mol
Forward-Reverse Dimers-0.94 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceCTCTACAAGGAAGATAACGGACTGTAAAATTCTATAAAGCAAAGCTACACATCACTTGAC
ACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAACTTGATGACTAGCTCCAC
CC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)122108 - 229
Exon 2 To Exon 3 (Pair 41)
Forward (147,22)GCAAAGCTACACATCACTTGACAmplicon SizecDNA: 142 bpgenomic: 10,734
Reverse (288,22)GTGGTAGCCAGATCATTACTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGATGG
AAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGG
AGAGTAATGATCTGGCTACCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)142146 - 287
Exon 2 To Exon 3 (Pair 42)
Forward (142,24)ATAAAGCAAAGCTACACATCACTTAmplicon SizecDNA: 146 bpgenomic: 10,738
Reverse (287,22)TGGTAGCCAGATCATTACTCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGA
GATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTC
CAAGGAGAGTAATGATCTGGCTACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)146141 - 286
Exon 2 To Exon 3 (Pair 43)
Forward (150,22)AAGCTACACATCACTTGACACCAmplicon SizecDNA: 134 bpgenomic: 10,726
Reverse (283,22)AGCCAGATCATTACTCTCCTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.913 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-1.296 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAA
ACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGGAGA
GTAATGATCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)134149 - 282
Exon 2 To Exon 3 (Pair 44)
Forward (141,24)TATAAAGCAAAGCTACACATCACTAmplicon SizecDNA: 148 bpgenomic: 10,740
Reverse (288,22)GTGGTAGCCAGATCATTACTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAG
AGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTT
CCAAGGAGAGTAATGATCTGGCTACCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)148140 - 287
Exon 2 To Exon 3 (Pair 45)
Forward (109,22)CTCTACAAGGAAGATAACGGACAmplicon SizecDNA: 127 bpgenomic: 10,719
Reverse (235,20)CGGTAGGGTGGAGCTAGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops1.754 kcal/mol in 3' area
Reverse Dimers-2.822 kcal/mol
Forward-Reverse Dimers-0.94 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceCTCTACAAGGAAGATAACGGACTGTAAAATTCTATAAAGCAAAGCTACACATCACTTGAC
ACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAACTTGATGACTAGCTCCAC
CCTACCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)127108 - 234
Exon 2 To Exon 3 (Pair 46)
Forward (142,24)ATAAAGCAAAGCTACACATCACTTAmplicon SizecDNA: 125 bpgenomic: 10,717
Reverse (266,21)CCTTGGAACCGTCTTCATCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.464 kcal/mol
Reverse Dimers-0.668 kcal/mol
Forward-Reverse Dimers-0.783 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGA
GATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTC
CAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)125141 - 265
Exon 2 To Exon 3 (Pair 47)
Forward (139,24)TCTATAAAGCAAAGCTACACATCAAmplicon SizecDNA: 152 bpgenomic: 10,744
Reverse (290,22)CAGTGGTAGCCAGATCATTACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTCTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAG
AGAGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGG
TTCCAAGGAGAGTAATGATCTGGCTACCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)152138 - 289
Exon 2 To Exon 3 (Pair 48)
Forward (145,23)AAGCAAAGCTACACATCACTTGAAmplicon SizecDNA: 141 bpgenomic: 10,733
Reverse (285,22)GTAGCCAGATCATTACTCTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.913 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGAT
GGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAA
GGAGAGTAATGATCTGGCTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)141144 - 284
Exon 2 To Exon 3 (Pair 49)
Forward (138,24)TTCTATAAAGCAAAGCTACACATCAmplicon SizecDNA: 150 bpgenomic: 10,742
Reverse (287,22)TGGTAGCCAGATCATTACTCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTTCTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAA
GAGAGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACG
GTTCCAAGGAGAGTAATGATCTGGCTACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)150137 - 286
Exon 2 To Exon 3 (Pair 50)
Forward (147,22)GCAAAGCTACACATCACTTGACAmplicon SizecDNA: 120 bpgenomic: 10,712
Reverse (266,21)CCTTGGAACCGTCTTCATCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.464 kcal/mol
Reverse Dimers-0.668 kcal/mol
Forward-Reverse Dimers-0.783 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGATGG
AAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)120146 - 265
Exon 2 To Exon 3 (Pair 51)
Forward (152,22)GCTACACATCACTTGACACCATAmplicon SizecDNA: 134 bpgenomic: 10,726
Reverse (285,22)GTAGCCAGATCATTACTCTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops1.913 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-1.767 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAAC
TTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGGAGAGT
AATGATCTGGCTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)134151 - 284
Exon 2 To Exon 3 (Pair 52)
Forward (109,22)CTCTACAAGGAAGATAACGGACAmplicon SizecDNA: 179 bpgenomic: 10,771
Reverse (287,22)TGGTAGCCAGATCATTACTCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-1.183 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceCTCTACAAGGAAGATAACGGACTGTAAAATTCTATAAAGCAAAGCTACACATCACTTGAC
ACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAACTTGATGACTAGCTCCAC
CCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGGAGAGTAATGATCTGGCTACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)179108 - 286
Exon 2 To Exon 3 (Pair 54)
Forward (150,22)AAGCTACACATCACTTGACACCAmplicon SizecDNA: 136 bpgenomic: 10,728
Reverse (285,22)GTAGCCAGATCATTACTCTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.913 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAA
ACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGGAGA
GTAATGATCTGGCTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)136149 - 284
Exon 2 To Exon 3 (Pair 55)
Forward (142,24)ATAAAGCAAAGCTACACATCACTTAmplicon SizecDNA: 149 bpgenomic: 10,741
Reverse (290,22)CAGTGGTAGCCAGATCATTACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGA
GATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTC
CAAGGAGAGTAATGATCTGGCTACCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)149141 - 289
Exon 2 To Exon 3 (Pair 56)
Forward (141,24)TATAAAGCAAAGCTACACATCACTAmplicon SizecDNA: 126 bpgenomic: 10,718
Reverse (266,21)CCTTGGAACCGTCTTCATCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.464 kcal/mol
Reverse Dimers-0.668 kcal/mol
Forward-Reverse Dimers-0.783 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAG
AGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTT
CCAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)126140 - 265
Exon 2 To Exon 3 (Pair 57)
Forward (152,22)GCTACACATCACTTGACACCATAmplicon SizecDNA: 132 bpgenomic: 10,724
Reverse (283,22)AGCCAGATCATTACTCTCCTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops1.913 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-1.105 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAAC
TTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGGAGAGT
AATGATCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)132151 - 282
Exon 2 To Exon 3 (Pair 58)
Forward (139,24)TCTATAAAGCAAAGCTACACATCAAmplicon SizecDNA: 128 bpgenomic: 10,720
Reverse (266,21)CCTTGGAACCGTCTTCATCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.464 kcal/mol
Reverse Dimers-0.668 kcal/mol
Forward-Reverse Dimers-0.783 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTCTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAG
AGAGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGG
TTCCAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)128138 - 265
Exon 2 To Exon 3 (Pair 59)
Forward (107,22)GTCTCTACAAGGAAGATAACGGAmplicon SizecDNA: 125 bpgenomic: 10,717
Reverse (231,21)AGGGTGGAGCTAGTCATCAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.965 kcal/mol
Forward Dimers-0.479 kcal/mol
Reverse Loops1.754 kcal/mol
Reverse Dimers-2.822 kcal/mol
Forward-Reverse Dimers-1.099 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceGTCTCTACAAGGAAGATAACGGACTGTAAAATTCTATAAAGCAAAGCTACACATCACTTG
ACACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAACTTGATGACTAGCTCC
ACCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)125106 - 230
Exon 2 To Exon 3 (Pair 60)
Forward (150,22)AAGCTACACATCACTTGACACCAmplicon SizecDNA: 139 bpgenomic: 10,731
Reverse (288,22)GTGGTAGCCAGATCATTACTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAA
ACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGGAGA
GTAATGATCTGGCTACCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)139149 - 287
Exon 2 To Exon 3 (Pair 61)
Forward (139,24)TCTATAAAGCAAAGCTACACATCAAmplicon SizecDNA: 143 bpgenomic: 10,735
Reverse (281,22)CCAGATCATTACTCTCCTTGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.23 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-0.873 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTCTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAG
AGAGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGG
TTCCAAGGAGAGTAATGATCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)143138 - 280
Exon 2 To Exon 3 (Pair 62)
Forward (141,24)TATAAAGCAAAGCTACACATCACTAmplicon SizecDNA: 150 bpgenomic: 10,742
Reverse (290,22)CAGTGGTAGCCAGATCATTACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAG
AGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTT
CCAAGGAGAGTAATGATCTGGCTACCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)150140 - 289
Exon 2 To Exon 3 (Pair 63)
Forward (138,24)TTCTATAAAGCAAAGCTACACATCAmplicon SizecDNA: 151 bpgenomic: 10,743
Reverse (288,22)GTGGTAGCCAGATCATTACTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTTCTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAA
GAGAGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACG
GTTCCAAGGAGAGTAATGATCTGGCTACCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)151137 - 287
Exon 2 To Exon 3 (Pair 64)
Forward (144,23)AAAGCAAAGCTACACATCACTTGAmplicon SizecDNA: 144 bpgenomic: 10,736
Reverse (287,22)TGGTAGCCAGATCATTACTCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGA
TGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCA
AGGAGAGTAATGATCTGGCTACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)144143 - 286
Exon 2 To Exon 3 (Pair 65)
Forward (109,22)CTCTACAAGGAAGATAACGGACAmplicon SizecDNA: 123 bpgenomic: 10,715
Reverse (231,21)AGGGTGGAGCTAGTCATCAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops1.754 kcal/mol
Reverse Dimers-2.822 kcal/mol
Forward-Reverse Dimers-0.94 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceCTCTACAAGGAAGATAACGGACTGTAAAATTCTATAAAGCAAAGCTACACATCACTTGAC
ACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAACTTGATGACTAGCTCCAC
CCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)123108 - 230
Exon 2 To Exon 3 (Pair 66)
Forward (150,22)AAGCTACACATCACTTGACACCAmplicon SizecDNA: 138 bpgenomic: 10,730
Reverse (287,22)TGGTAGCCAGATCATTACTCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAA
ACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGGAGA
GTAATGATCTGGCTACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)138149 - 286
Exon 2 To Exon 3 (Pair 67)
Forward (145,23)AAGCAAAGCTACACATCACTTGAAmplicon SizecDNA: 122 bpgenomic: 10,714
Reverse (266,21)CCTTGGAACCGTCTTCATCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.464 kcal/mol
Reverse Dimers-0.668 kcal/mol
Forward-Reverse Dimers-0.783 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGAT
GGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAA
GG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)122144 - 265
Exon 2 To Exon 3 (Pair 68)
Forward (139,24)TCTATAAAGCAAAGCTACACATCAAmplicon SizecDNA: 147 bpgenomic: 10,739
Reverse (285,22)GTAGCCAGATCATTACTCTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.913 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTCTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAG
AGAGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGG
TTCCAAGGAGAGTAATGATCTGGCTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)147138 - 284
Exon 2 To Exon 3 (Pair 69)
Forward (109,22)CTCTACAAGGAAGATAACGGACAmplicon SizecDNA: 182 bpgenomic: 10,774
Reverse (290,22)CAGTGGTAGCCAGATCATTACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-1.183 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceCTCTACAAGGAAGATAACGGACTGTAAAATTCTATAAAGCAAAGCTACACATCACTTGAC
ACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAACTTGATGACTAGCTCCAC
CCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGGAGAGTAATGATCTGGCTACCAC
TG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)182108 - 289
Exon 2 To Exon 3 (Pair 70)
Forward (147,22)GCAAAGCTACACATCACTTGACAmplicon SizecDNA: 119 bpgenomic: 10,711
Reverse (265,21)CTTGGAACCGTCTTCATCTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.464 kcal/mol
Reverse Dimers-0.668 kcal/mol
Forward-Reverse Dimers-0.783 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGATGG
AAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)119146 - 264
Exon 2 To Exon 3 (Pair 72)
Forward (141,24)TATAAAGCAAAGCTACACATCACTAmplicon SizecDNA: 147 bpgenomic: 10,739
Reverse (287,22)TGGTAGCCAGATCATTACTCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAG
AGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTT
CCAAGGAGAGTAATGATCTGGCTACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)147140 - 286
Exon 2 To Exon 3 (Pair 73)
Forward (147,22)GCAAAGCTACACATCACTTGACAmplicon SizecDNA: 137 bpgenomic: 10,729
Reverse (283,22)AGCCAGATCATTACTCTCCTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.913 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-1.296 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGATGG
AAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGG
AGAGTAATGATCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)137146 - 282
Exon 2 To Exon 3 (Pair 74)
Forward (144,23)AAAGCAAAGCTACACATCACTTGAmplicon SizecDNA: 140 bpgenomic: 10,732
Reverse (283,22)AGCCAGATCATTACTCTCCTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.913 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-1.296 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGA
TGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCA
AGGAGAGTAATGATCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)140143 - 282
Exon 2 To Exon 3 (Pair 75)
Forward (151,22)AGCTACACATCACTTGACACCAAmplicon SizecDNA: 140 bpgenomic: 10,732
Reverse (290,22)CAGTGGTAGCCAGATCATTACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-1.696 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAA
CTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGGAGAG
TAATGATCTGGCTACCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)140150 - 289
Exon 2 To Exon 3 (Pair 76)
Forward (139,24)TCTATAAAGCAAAGCTACACATCAAmplicon SizecDNA: 151 bpgenomic: 10,743
Reverse (289,22)AGTGGTAGCCAGATCATTACTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTCTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAG
AGAGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGG
TTCCAAGGAGAGTAATGATCTGGCTACCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)151138 - 288
Exon 2 To Exon 3 (Pair 77)
Forward (145,23)AAGCAAAGCTACACATCACTTGAAmplicon SizecDNA: 145 bpgenomic: 10,737
Reverse (289,22)AGTGGTAGCCAGATCATTACTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGAT
GGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAA
GGAGAGTAATGATCTGGCTACCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)145144 - 288
Exon 2 To Exon 3 (Pair 78)
Forward (141,24)TATAAAGCAAAGCTACACATCACTAmplicon SizecDNA: 143 bpgenomic: 10,735
Reverse (283,22)AGCCAGATCATTACTCTCCTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.913 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-1.296 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAG
AGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTT
CCAAGGAGAGTAATGATCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)143140 - 282
Exon 2 To Exon 3 (Pair 79)
Forward (142,24)ATAAAGCAAAGCTACACATCACTTAmplicon SizecDNA: 148 bpgenomic: 10,740
Reverse (289,22)AGTGGTAGCCAGATCATTACTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGA
GATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTC
CAAGGAGAGTAATGATCTGGCTACCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)148141 - 288
Exon 2 To Exon 3 (Pair 80)
Forward (138,24)TTCTATAAAGCAAAGCTACACATCAmplicon SizecDNA: 129 bpgenomic: 10,721
Reverse (266,21)CCTTGGAACCGTCTTCATCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.464 kcal/mol
Reverse Dimers-0.668 kcal/mol
Forward-Reverse Dimers-0.783 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTTCTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAA
GAGAGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACG
GTTCCAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)129137 - 265
Exon 2 To Exon 3 (Pair 81)
Forward (151,22)AGCTACACATCACTTGACACCAAmplicon SizecDNA: 138 bpgenomic: 10,730
Reverse (288,22)GTGGTAGCCAGATCATTACTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-1.696 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAA
CTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGGAGAG
TAATGATCTGGCTACCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)138150 - 287
Exon 2 To Exon 3 (Pair 82)
Forward (142,24)ATAAAGCAAAGCTACACATCACTTAmplicon SizecDNA: 144 bpgenomic: 10,736
Reverse (285,22)GTAGCCAGATCATTACTCTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.913 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGA
GATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTC
CAAGGAGAGTAATGATCTGGCTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)144141 - 284
Exon 2 To Exon 3 (Pair 83)
Forward (107,22)GTCTCTACAAGGAAGATAACGGAmplicon SizecDNA: 181 bpgenomic: 10,773
Reverse (287,22)TGGTAGCCAGATCATTACTCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.965 kcal/mol
Forward Dimers-0.479 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-1.183 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceGTCTCTACAAGGAAGATAACGGACTGTAAAATTCTATAAAGCAAAGCTACACATCACTTG
ACACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAACTTGATGACTAGCTCC
ACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGGAGAGTAATGATCTGGCTACC
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)181106 - 286
Exon 2 To Exon 3 (Pair 84)
Forward (150,22)AAGCTACACATCACTTGACACCAmplicon SizecDNA: 141 bpgenomic: 10,733
Reverse (290,22)CAGTGGTAGCCAGATCATTACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAA
ACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGGAGA
GTAATGATCTGGCTACCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)141149 - 289
Exon 2 To Exon 3 (Pair 85)
Forward (150,22)AAGCTACACATCACTTGACACCAmplicon SizecDNA: 132 bpgenomic: 10,724
Reverse (281,22)CCAGATCATTACTCTCCTTGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.23 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-1.105 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAA
ACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGGAGA
GTAATGATCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)132149 - 280
Exon 2 To Exon 3 (Pair 86)
Forward (138,24)TTCTATAAAGCAAAGCTACACATCAmplicon SizecDNA: 152 bpgenomic: 10,744
Reverse (289,22)AGTGGTAGCCAGATCATTACTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTTCTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAA
GAGAGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACG
GTTCCAAGGAGAGTAATGATCTGGCTACCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)152137 - 288
Exon 2 To Exon 3 (Pair 87)
Forward (151,22)AGCTACACATCACTTGACACCAAmplicon SizecDNA: 139 bpgenomic: 10,731
Reverse (289,22)AGTGGTAGCCAGATCATTACTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-1.696 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAA
CTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGGAGAG
TAATGATCTGGCTACCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)139150 - 288
Exon 2 To Exon 3 (Pair 1)
Forward (138,24)TTCTATAAAGCAAAGCTACACATCAmplicon SizecDNA: 146 bpgenomic: 10,738
Reverse (283,22)AGCCAGATCATTACTCTCCTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.913 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-1.296 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTTCTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAA
GAGAGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACG
GTTCCAAGGAGAGTAATGATCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)146137 - 282
Exon 2 To Exon 3 (Pair 2)
Forward (139,24)TCTATAAAGCAAAGCTACACATCAAmplicon SizecDNA: 150 bpgenomic: 10,742
Reverse (288,22)GTGGTAGCCAGATCATTACTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTCTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAG
AGAGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGG
TTCCAAGGAGAGTAATGATCTGGCTACCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)150138 - 287
Exon 2 To Exon 3 (Pair 3)
Forward (147,22)GCAAAGCTACACATCACTTGACAmplicon SizecDNA: 143 bpgenomic: 10,735
Reverse (289,22)AGTGGTAGCCAGATCATTACTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGATGG
AAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGG
AGAGTAATGATCTGGCTACCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)143146 - 288
Exon 2 To Exon 3 (Pair 4)
Forward (152,22)GCTACACATCACTTGACACCATAmplicon SizecDNA: 139 bpgenomic: 10,731
Reverse (290,22)CAGTGGTAGCCAGATCATTACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.353 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAAC
TTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGGAGAGT
AATGATCTGGCTACCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)139151 - 289
Exon 2 To Exon 3 (Pair 5)
Forward (142,24)ATAAAGCAAAGCTACACATCACTTAmplicon SizecDNA: 147 bpgenomic: 10,739
Reverse (288,22)GTGGTAGCCAGATCATTACTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGA
GATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTC
CAAGGAGAGTAATGATCTGGCTACCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)147141 - 287
Exon 2 To Exon 3 (Pair 6)
Forward (107,22)GTCTCTACAAGGAAGATAACGGAmplicon SizecDNA: 182 bpgenomic: 10,774
Reverse (288,22)GTGGTAGCCAGATCATTACTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.965 kcal/mol
Forward Dimers-0.479 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-1.183 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceGTCTCTACAAGGAAGATAACGGACTGTAAAATTCTATAAAGCAAAGCTACACATCACTTG
ACACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAACTTGATGACTAGCTCC
ACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGGAGAGTAATGATCTGGCTACC
AC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)182106 - 287
Exon 2 To Exon 3 (Pair 7)
Forward (145,23)AAGCAAAGCTACACATCACTTGAAmplicon SizecDNA: 144 bpgenomic: 10,736
Reverse (288,22)GTGGTAGCCAGATCATTACTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGAT
GGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAA
GGAGAGTAATGATCTGGCTACCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)144144 - 287
Exon 2 To Exon 3 (Pair 8)
Forward (144,23)AAAGCAAAGCTACACATCACTTGAmplicon SizecDNA: 123 bpgenomic: 10,715
Reverse (266,21)CCTTGGAACCGTCTTCATCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.464 kcal/mol
Reverse Dimers-0.668 kcal/mol
Forward-Reverse Dimers-0.783 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGA
TGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCA
AGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)123143 - 265
Exon 2 To Exon 3 (Pair 9)
Forward (139,24)TCTATAAAGCAAAGCTACACATCAAmplicon SizecDNA: 149 bpgenomic: 10,741
Reverse (287,22)TGGTAGCCAGATCATTACTCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTCTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAG
AGAGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGG
TTCCAAGGAGAGTAATGATCTGGCTACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)149138 - 286
Exon 2 To Exon 3 (Pair 10)
Forward (144,23)AAAGCAAAGCTACACATCACTTGAmplicon SizecDNA: 147 bpgenomic: 10,739
Reverse (290,22)CAGTGGTAGCCAGATCATTACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.385 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAGAGA
TGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCA
AGGAGAGTAATGATCTGGCTACCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)147143 - 289
Exon 2 To Exon 3 (Pair 11)
Forward (138,24)TTCTATAAAGCAAAGCTACACATCAmplicon SizecDNA: 148 bpgenomic: 10,740
Reverse (285,22)GTAGCCAGATCATTACTCTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.913 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTTCTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAA
GAGAGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACG
GTTCCAAGGAGAGTAATGATCTGGCTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)148137 - 284
Exon 2 To Exon 3 (Pair 12)
Forward (109,22)CTCTACAAGGAAGATAACGGACAmplicon SizecDNA: 121 bpgenomic: 10,713
Reverse (229,22)GGTGGAGCTAGTCATCAAGTTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops1.754 kcal/mol
Reverse Dimers-2.822 kcal/mol
Forward-Reverse Dimers-0.94 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceCTCTACAAGGAAGATAACGGACTGTAAAATTCTATAAAGCAAAGCTACACATCACTTGAC
ACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAACTTGATGACTAGCTCCAC
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)121108 - 228
Exon 2 To Exon 3 (Pair 13)
Forward (139,24)TCTATAAAGCAAAGCTACACATCAAmplicon SizecDNA: 145 bpgenomic: 10,737
Reverse (283,22)AGCCAGATCATTACTCTCCTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.913 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-1.296 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTCTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAG
AGAGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGG
TTCCAAGGAGAGTAATGATCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)145138 - 282
Exon 2 To Exon 3 (Pair 14)
Forward (109,22)CTCTACAAGGAAGATAACGGACAmplicon SizecDNA: 180 bpgenomic: 10,772
Reverse (288,22)GTGGTAGCCAGATCATTACTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.014 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops1.427 kcal/mol
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-1.183 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceCTCTACAAGGAAGATAACGGACTGTAAAATTCTATAAAGCAAAGCTACACATCACTTGAC
ACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAACTTGATGACTAGCTCCAC
CCTACCGCCCCTTTTTGCAGATGAAGACGGTTCCAAGGAGAGTAATGATCTGGCTACCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)180108 - 287
Exon 2 To Exon 3 (Pair 15)
Forward (141,24)TATAAAGCAAAGCTACACATCACTAmplicon SizecDNA: 141 bpgenomic: 10,733
Reverse (281,22)CCAGATCATTACTCTCCTTGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.278 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.23 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-0.873 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceTATAAAGCAAAGCTACACATCACTTGACACCATACACCATCTTGGTTACATAATGAAGAG
AGATGGAAAACTTGATGACTAGCTCCACCCTACCGCCCCTTTTTGCAGATGAAGACGGTT
CCAAGGAGAGTAATGATCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)141140 - 280
Exon 2 To Exon 3 (Pair 16)
Forward (107,22)GTCTCTACAAGGAAGATAACGGAmplicon SizecDNA: 124 bpgenomic: 10,716
Reverse (230,21)GGGTGGAGCTAGTCATCAAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.965 kcal/mol
Forward Dimers-0.479 kcal/mol
Reverse Loops1.754 kcal/mol
Reverse Dimers-2.822 kcal/mol
Forward-Reverse Dimers-1.099 kcal/mol
Amplicon Folding-0.542 kcal/mol outside primersite
Amplicon SequenceGTCTCTACAAGGAAGATAACGGACTGTAAAATTCTATAAAGCAAAGCTACACATCACTTG
ACACCATACACCATCTTGGTTACATAATGAAGAGAGATGGAAAACTTGATGACTAGCTCC
ACCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018200 (HMG20A)124106 - 229
 

See below for some more details.

Program Output:

Loading ...