Design Results for Hamp

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size200
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size1000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 1 To Exon 2 (Pair 1)
Forward (106,19)CTCCTGCTCCTCCTCCTCCAmplicon SizecDNA: 79 bpgenomic: 2,200
Reverse (184,20)GCAGCTCTGCAAGTTGTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.577 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops0.189 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.777 kcal/mol outside primersite
Amplicon SequenceCTCCTGCTCCTCCTCCTCCTCGCCAGCCTGACCAGTGGCTCTGTTTTCCCACAACAGACG
GGACAACTTGCAGAGCTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021175 (HAMP)79105 - 183
Exon 1 To Exon 2 (Pair 2)
Forward (110,19)TGCTCCTCCTCCTCCTCGCAmplicon SizecDNA: 75 bpgenomic: 2,196
Reverse (184,20)GCAGCTCTGCAAGTTGTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.62 kcal/mol in 3' area
Forward Dimers0.016 kcal/mol in 3' area
Reverse Loops0.189 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.777 kcal/mol outside primersite
Amplicon SequenceTGCTCCTCCTCCTCCTCGCCAGCCTGACCAGTGGCTCTGTTTTCCCACAACAGACGGGAC
AACTTGCAGAGCTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021175 (HAMP)75109 - 183
Exon 1 To Exon 2 (Pair 3)
Forward (106,19)CTCCTGCTCCTCCTCCTCCAmplicon SizecDNA: 78 bpgenomic: 2,199
Reverse (183,20)CAGCTCTGCAAGTTGTCCCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.577 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.777 kcal/mol outside primersite
Amplicon SequenceCTCCTGCTCCTCCTCCTCCTCGCCAGCCTGACCAGTGGCTCTGTTTTCCCACAACAGACG
GGACAACTTGCAGAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021175 (HAMP)78105 - 182
Exon 1 To Exon 2 (Pair 4)
Forward (110,19)TGCTCCTCCTCCTCCTCGCAmplicon SizecDNA: 74 bpgenomic: 2,195
Reverse (183,20)CAGCTCTGCAAGTTGTCCCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.62 kcal/mol in 3' area
Forward Dimers0.016 kcal/mol in 3' area
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.777 kcal/mol outside primersite
Amplicon SequenceTGCTCCTCCTCCTCCTCGCCAGCCTGACCAGTGGCTCTGTTTTCCCACAACAGACGGGAC
AACTTGCAGAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021175 (HAMP)74109 - 182
Exon 1 To Exon 2 (Pair 5)
Forward (109,19)CTGCTCCTCCTCCTCCTCGAmplicon SizecDNA: 76 bpgenomic: 2,197
Reverse (184,20)GCAGCTCTGCAAGTTGTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops4.088 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops0.189 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.777 kcal/mol outside primersite
Amplicon SequenceCTGCTCCTCCTCCTCCTCGCCAGCCTGACCAGTGGCTCTGTTTTCCCACAACAGACGGGA
CAACTTGCAGAGCTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021175 (HAMP)76108 - 183
Exon 1 To Exon 2 (Pair 6)
Forward (109,19)CTGCTCCTCCTCCTCCTCGAmplicon SizecDNA: 75 bpgenomic: 2,196
Reverse (183,20)CAGCTCTGCAAGTTGTCCCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops4.088 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.777 kcal/mol outside primersite
Amplicon SequenceCTGCTCCTCCTCCTCCTCGCCAGCCTGACCAGTGGCTCTGTTTTCCCACAACAGACGGGA
CAACTTGCAGAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021175 (HAMP)75108 - 182
Exon 1 To Exon 2 (Pair 7)
Forward (108,19)CCTGCTCCTCCTCCTCCTCAmplicon SizecDNA: 76 bpgenomic: 2,197
Reverse (183,20)CAGCTCTGCAAGTTGTCCCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.577 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.375 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.777 kcal/mol outside primersite
Amplicon SequenceCCTGCTCCTCCTCCTCCTCGCCAGCCTGACCAGTGGCTCTGTTTTCCCACAACAGACGGG
ACAACTTGCAGAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021175 (HAMP)76107 - 182
Exon 1 To Exon 2 (Pair 8)
Forward (108,19)CCTGCTCCTCCTCCTCCTCAmplicon SizecDNA: 77 bpgenomic: 2,198
Reverse (184,20)GCAGCTCTGCAAGTTGTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.577 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops0.189 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.777 kcal/mol outside primersite
Amplicon SequenceCCTGCTCCTCCTCCTCCTCGCCAGCCTGACCAGTGGCTCTGTTTTCCCACAACAGACGGG
ACAACTTGCAGAGCTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021175 (HAMP)77107 - 183
 

See below for some more details.

Program Output:

Loading ...