Design Results for IFNg

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size100

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 1 To Exon 2 (Pair 18)
Forward (19,24)TGAAGATCAGCTATTAGAAGAGAAAmplicon SizecDNA: 245 bpgenomic: 1,487
Reverse (263,22)GCTACATCTGAATGACCTGCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.092 kcal/mol
Forward Dimers-2.644 kcal/mol
Reverse Loops0.81 kcal/mol
Reverse Dimers-1.215 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding-1.992 kcal/mol outside primersite
Amplicon SequenceTGAAGATCAGCTATTAGAAGAGAAAGATCAGTTAAGTCCTTTGGACCTGATCAGCTTGAT
ACAAGAACTACTGATTTCAACTTCTTTGGCTTAATTCTCTCGGAAACGATGAAATATACA
AGTTATATCTTGGCTTTTCAGCTCTGCATCGTTTTGGGTTCTCTTGGCTGTTACTGCCAG
GACCCATATGTAAAAGAAGCAGAAAACCTTAAGAAATATTTTAATGCAGGTCATTCAGAT
GTAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000619 (IFNG)24519 - 263
Exon 1 To Exon 3 (Pair 2)
Forward (186,21)CTGTTACTGCCAGGACCCATAAmplicon SizecDNA: 210 bpgenomic: 1,547
Reverse (395,23)TGGATGCTCTGGTCATCTTTAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.776 kcal/mol
Forward Dimers-1.364 kcal/mol
Reverse Loops1.656 kcal/mol
Reverse Dimers-0.422 kcal/mol
Forward-Reverse Dimers-2 kcal/mol
Amplicon Folding0.277 kcal/mol inside primersite
Amplicon SequenceCTGTTACTGCCAGGACCCATATGTAAAAGAAGCAGAAAACCTTAAGAAATATTTTAATGC
AGGTCATTCAGATGTAGCGGATAATGGAACTCTTTTCTTAGGCATTTTGAAGAATTGGAA
AGAGGAGAGTGACAGAAAAATAATGCAGAGCCAAATTGTCTCCTTTTACTTCAAACTTTT
TAAAAACTTTAAAGATGACCAGAGCATCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000619 (IFNG)210186 - 395
Exon 1 To Exon 2 (Pair 17)
Forward (49,22)GTTAAGTCCTTTGGACCTGATCAmplicon SizecDNA: 215 bpgenomic: 1,457
Reverse (263,22)GCTACATCTGAATGACCTGCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.348 kcal/mol
Forward Dimers-1.284 kcal/mol
Reverse Loops0.81 kcal/mol
Reverse Dimers-1.215 kcal/mol
Forward-Reverse Dimers-1.025 kcal/mol
Amplicon Folding-1.992 kcal/mol outside primersite
Amplicon SequenceGTTAAGTCCTTTGGACCTGATCAGCTTGATACAAGAACTACTGATTTCAACTTCTTTGGC
TTAATTCTCTCGGAAACGATGAAATATACAAGTTATATCTTGGCTTTTCAGCTCTGCATC
GTTTTGGGTTCTCTTGGCTGTTACTGCCAGGACCCATATGTAAAAGAAGCAGAAAACCTT
AAGAAATATTTTAATGCAGGTCATTCAGATGTAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000619 (IFNG)21549 - 263
Exon 1 To Exon 2 (Pair 16)
Forward (18,23)CTGAAGATCAGCTATTAGAAGAGAmplicon SizecDNA: 246 bpgenomic: 1,488
Reverse (263,22)GCTACATCTGAATGACCTGCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.057 kcal/mol
Forward Dimers-2.644 kcal/mol
Reverse Loops0.81 kcal/mol
Reverse Dimers-1.215 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding-1.992 kcal/mol outside primersite
Amplicon SequenceCTGAAGATCAGCTATTAGAAGAGAAAGATCAGTTAAGTCCTTTGGACCTGATCAGCTTGA
TACAAGAACTACTGATTTCAACTTCTTTGGCTTAATTCTCTCGGAAACGATGAAATATAC
AAGTTATATCTTGGCTTTTCAGCTCTGCATCGTTTTGGGTTCTCTTGGCTGTTACTGCCA
GGACCCATATGTAAAAGAAGCAGAAAACCTTAAGAAATATTTTAATGCAGGTCATTCAGA
TGTAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000619 (IFNG)24618 - 263
Exon 1 To Exon 2 (Pair 15)
Forward (76,24)GATACAAGAACTACTGATTTCAACAmplicon SizecDNA: 188 bpgenomic: 1,430
Reverse (263,22)GCTACATCTGAATGACCTGCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.115 kcal/mol
Forward Dimers-0.65 kcal/mol
Reverse Loops0.81 kcal/mol
Reverse Dimers-1.215 kcal/mol
Forward-Reverse Dimers-0.968 kcal/mol
Amplicon Folding-1.992 kcal/mol outside primersite
Amplicon SequenceGATACAAGAACTACTGATTTCAACTTCTTTGGCTTAATTCTCTCGGAAACGATGAAATAT
ACAAGTTATATCTTGGCTTTTCAGCTCTGCATCGTTTTGGGTTCTCTTGGCTGTTACTGC
CAGGACCCATATGTAAAAGAAGCAGAAAACCTTAAGAAATATTTTAATGCAGGTCATTCA
GATGTAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000619 (IFNG)18876 - 263
Exon 1 To Exon 2 (Pair 14)
Forward (33,24)TAGAAGAGAAAGATCAGTTAAGTCAmplicon SizecDNA: 231 bpgenomic: 1,473
Reverse (263,22)GCTACATCTGAATGACCTGCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops0.81 kcal/mol
Reverse Dimers-1.215 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding-1.992 kcal/mol outside primersite
Amplicon SequenceTAGAAGAGAAAGATCAGTTAAGTCCTTTGGACCTGATCAGCTTGATACAAGAACTACTGA
TTTCAACTTCTTTGGCTTAATTCTCTCGGAAACGATGAAATATACAAGTTATATCTTGGC
TTTTCAGCTCTGCATCGTTTTGGGTTCTCTTGGCTGTTACTGCCAGGACCCATATGTAAA
AGAAGCAGAAAACCTTAAGAAATATTTTAATGCAGGTCATTCAGATGTAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000619 (IFNG)23133 - 263
Exon 1 To Exon 2 (Pair 13)
Forward (23,24)GATCAGCTATTAGAAGAGAAAGATAmplicon SizecDNA: 241 bpgenomic: 1,483
Reverse (263,22)GCTACATCTGAATGACCTGCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.663 kcal/mol
Forward Dimers-2.644 kcal/mol
Reverse Loops0.81 kcal/mol
Reverse Dimers-1.215 kcal/mol
Forward-Reverse Dimers-1.475 kcal/mol
Amplicon Folding-1.992 kcal/mol outside primersite
Amplicon SequenceGATCAGCTATTAGAAGAGAAAGATCAGTTAAGTCCTTTGGACCTGATCAGCTTGATACAA
GAACTACTGATTTCAACTTCTTTGGCTTAATTCTCTCGGAAACGATGAAATATACAAGTT
ATATCTTGGCTTTTCAGCTCTGCATCGTTTTGGGTTCTCTTGGCTGTTACTGCCAGGACC
CATATGTAAAAGAAGCAGAAAACCTTAAGAAATATTTTAATGCAGGTCATTCAGATGTAG
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000619 (IFNG)24123 - 263
Exon 1 To Exon 2 (Pair 12)
Forward (20,24)GAAGATCAGCTATTAGAAGAGAAAAmplicon SizecDNA: 244 bpgenomic: 1,486
Reverse (263,22)GCTACATCTGAATGACCTGCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.092 kcal/mol
Forward Dimers-2.644 kcal/mol
Reverse Loops0.81 kcal/mol
Reverse Dimers-1.215 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding-1.992 kcal/mol outside primersite
Amplicon SequenceGAAGATCAGCTATTAGAAGAGAAAGATCAGTTAAGTCCTTTGGACCTGATCAGCTTGATA
CAAGAACTACTGATTTCAACTTCTTTGGCTTAATTCTCTCGGAAACGATGAAATATACAA
GTTATATCTTGGCTTTTCAGCTCTGCATCGTTTTGGGTTCTCTTGGCTGTTACTGCCAGG
ACCCATATGTAAAAGAAGCAGAAAACCTTAAGAAATATTTTAATGCAGGTCATTCAGATG
TAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000619 (IFNG)24420 - 263
Exon 1 To Exon 3 (Pair 1)
Forward (185,20)GCTGTTACTGCCAGGACCCAAmplicon SizecDNA: 211 bpgenomic: 1,548
Reverse (395,23)TGGATGCTCTGGTCATCTTTAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.776 kcal/mol
Forward Dimers-1.364 kcal/mol
Reverse Loops1.656 kcal/mol
Reverse Dimers-0.422 kcal/mol
Forward-Reverse Dimers-2 kcal/mol
Amplicon Folding0.277 kcal/mol inside primersite
Amplicon SequenceGCTGTTACTGCCAGGACCCATATGTAAAAGAAGCAGAAAACCTTAAGAAATATTTTAATG
CAGGTCATTCAGATGTAGCGGATAATGGAACTCTTTTCTTAGGCATTTTGAAGAATTGGA
AAGAGGAGAGTGACAGAAAAATAATGCAGAGCCAAATTGTCTCCTTTTACTTCAAACTTT
TTAAAAACTTTAAAGATGACCAGAGCATCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000619 (IFNG)211185 - 395
Exon 1 To Exon 2 (Pair 11)
Forward (71,24)AGCTTGATACAAGAACTACTGATTAmplicon SizecDNA: 193 bpgenomic: 1,435
Reverse (263,22)GCTACATCTGAATGACCTGCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.492 kcal/mol
Forward Dimers-2.072 kcal/mol
Reverse Loops0.81 kcal/mol
Reverse Dimers-1.215 kcal/mol
Forward-Reverse Dimers-1.001 kcal/mol
Amplicon Folding-1.992 kcal/mol outside primersite
Amplicon SequenceAGCTTGATACAAGAACTACTGATTTCAACTTCTTTGGCTTAATTCTCTCGGAAACGATGA
AATATACAAGTTATATCTTGGCTTTTCAGCTCTGCATCGTTTTGGGTTCTCTTGGCTGTT
ACTGCCAGGACCCATATGTAAAAGAAGCAGAAAACCTTAAGAAATATTTTAATGCAGGTC
ATTCAGATGTAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000619 (IFNG)19371 - 263
Exon 1 To Exon 2 (Pair 10)
Forward (67,23)GATCAGCTTGATACAAGAACTACAmplicon SizecDNA: 197 bpgenomic: 1,439
Reverse (263,22)GCTACATCTGAATGACCTGCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.492 kcal/mol
Forward Dimers-2.77 kcal/mol
Reverse Loops0.81 kcal/mol
Reverse Dimers-1.215 kcal/mol
Forward-Reverse Dimers-1.475 kcal/mol
Amplicon Folding-1.992 kcal/mol outside primersite
Amplicon SequenceGATCAGCTTGATACAAGAACTACTGATTTCAACTTCTTTGGCTTAATTCTCTCGGAAACG
ATGAAATATACAAGTTATATCTTGGCTTTTCAGCTCTGCATCGTTTTGGGTTCTCTTGGC
TGTTACTGCCAGGACCCATATGTAAAAGAAGCAGAAAACCTTAAGAAATATTTTAATGCA
GGTCATTCAGATGTAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000619 (IFNG)19767 - 263
Exon 1 To Exon 2 (Pair 9)
Forward (36,24)AAGAGAAAGATCAGTTAAGTCCTTAmplicon SizecDNA: 228 bpgenomic: 1,470
Reverse (263,22)GCTACATCTGAATGACCTGCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops0.81 kcal/mol
Reverse Dimers-1.215 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding-1.992 kcal/mol outside primersite
Amplicon SequenceAAGAGAAAGATCAGTTAAGTCCTTTGGACCTGATCAGCTTGATACAAGAACTACTGATTT
CAACTTCTTTGGCTTAATTCTCTCGGAAACGATGAAATATACAAGTTATATCTTGGCTTT
TCAGCTCTGCATCGTTTTGGGTTCTCTTGGCTGTTACTGCCAGGACCCATATGTAAAAGA
AGCAGAAAACCTTAAGAAATATTTTAATGCAGGTCATTCAGATGTAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000619 (IFNG)22836 - 263
Exon 1 To Exon 2 (Pair 8)
Forward (70,23)CAGCTTGATACAAGAACTACTGAAmplicon SizecDNA: 194 bpgenomic: 1,436
Reverse (263,22)GCTACATCTGAATGACCTGCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.492 kcal/mol
Forward Dimers-2.77 kcal/mol
Reverse Loops0.81 kcal/mol
Reverse Dimers-1.215 kcal/mol
Forward-Reverse Dimers-1.475 kcal/mol
Amplicon Folding-1.992 kcal/mol outside primersite
Amplicon SequenceCAGCTTGATACAAGAACTACTGATTTCAACTTCTTTGGCTTAATTCTCTCGGAAACGATG
AAATATACAAGTTATATCTTGGCTTTTCAGCTCTGCATCGTTTTGGGTTCTCTTGGCTGT
TACTGCCAGGACCCATATGTAAAAGAAGCAGAAAACCTTAAGAAATATTTTAATGCAGGT
CATTCAGATGTAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000619 (IFNG)19470 - 263
Exon 1 To Exon 2 (Pair 6)
Forward (69,23)TCAGCTTGATACAAGAACTACTGAmplicon SizecDNA: 195 bpgenomic: 1,437
Reverse (263,22)GCTACATCTGAATGACCTGCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.492 kcal/mol
Forward Dimers-2.77 kcal/mol
Reverse Loops0.81 kcal/mol
Reverse Dimers-1.215 kcal/mol
Forward-Reverse Dimers-1.475 kcal/mol
Amplicon Folding-1.992 kcal/mol outside primersite
Amplicon SequenceTCAGCTTGATACAAGAACTACTGATTTCAACTTCTTTGGCTTAATTCTCTCGGAAACGAT
GAAATATACAAGTTATATCTTGGCTTTTCAGCTCTGCATCGTTTTGGGTTCTCTTGGCTG
TTACTGCCAGGACCCATATGTAAAAGAAGCAGAAAACCTTAAGAAATATTTTAATGCAGG
TCATTCAGATGTAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000619 (IFNG)19569 - 263
Exon 1 To Exon 2 (Pair 7)
Forward (21,24)AAGATCAGCTATTAGAAGAGAAAGAmplicon SizecDNA: 243 bpgenomic: 1,485
Reverse (263,22)GCTACATCTGAATGACCTGCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.092 kcal/mol
Forward Dimers-2.644 kcal/mol
Reverse Loops0.81 kcal/mol
Reverse Dimers-1.215 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding-1.992 kcal/mol outside primersite
Amplicon SequenceAAGATCAGCTATTAGAAGAGAAAGATCAGTTAAGTCCTTTGGACCTGATCAGCTTGATAC
AAGAACTACTGATTTCAACTTCTTTGGCTTAATTCTCTCGGAAACGATGAAATATACAAG
TTATATCTTGGCTTTTCAGCTCTGCATCGTTTTGGGTTCTCTTGGCTGTTACTGCCAGGA
CCCATATGTAAAAGAAGCAGAAAACCTTAAGAAATATTTTAATGCAGGTCATTCAGATGT
AGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000619 (IFNG)24321 - 263
Exon 1 To Exon 2 (Pair 5)
Forward (22,24)AGATCAGCTATTAGAAGAGAAAGAAmplicon SizecDNA: 242 bpgenomic: 1,484
Reverse (263,22)GCTACATCTGAATGACCTGCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.633 kcal/mol
Forward Dimers-2.644 kcal/mol
Reverse Loops0.81 kcal/mol
Reverse Dimers-1.215 kcal/mol
Forward-Reverse Dimers-1.475 kcal/mol
Amplicon Folding-1.992 kcal/mol outside primersite
Amplicon SequenceAGATCAGCTATTAGAAGAGAAAGATCAGTTAAGTCCTTTGGACCTGATCAGCTTGATACA
AGAACTACTGATTTCAACTTCTTTGGCTTAATTCTCTCGGAAACGATGAAATATACAAGT
TATATCTTGGCTTTTCAGCTCTGCATCGTTTTGGGTTCTCTTGGCTGTTACTGCCAGGAC
CCATATGTAAAAGAAGCAGAAAACCTTAAGAAATATTTTAATGCAGGTCATTCAGATGTA
GC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000619 (IFNG)24222 - 263
Exon 1 To Exon 2 (Pair 4)
Forward (13,24)ATCATCTGAAGATCAGCTATTAGAAmplicon SizecDNA: 251 bpgenomic: 1,493
Reverse (263,22)GCTACATCTGAATGACCTGCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.752 kcal/mol
Forward Dimers-2.644 kcal/mol
Reverse Loops0.81 kcal/mol
Reverse Dimers-1.215 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding-1.992 kcal/mol outside primersite
Amplicon SequenceATCATCTGAAGATCAGCTATTAGAAGAGAAAGATCAGTTAAGTCCTTTGGACCTGATCAG
CTTGATACAAGAACTACTGATTTCAACTTCTTTGGCTTAATTCTCTCGGAAACGATGAAA
TATACAAGTTATATCTTGGCTTTTCAGCTCTGCATCGTTTTGGGTTCTCTTGGCTGTTAC
TGCCAGGACCCATATGTAAAAGAAGCAGAAAACCTTAAGAAATATTTTAATGCAGGTCAT
TCAGATGTAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000619 (IFNG)25113 - 263
Exon 1 To Exon 2 (Pair 3)
Forward (16,24)ATCTGAAGATCAGCTATTAGAAGAAmplicon SizecDNA: 248 bpgenomic: 1,490
Reverse (263,22)GCTACATCTGAATGACCTGCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.752 kcal/mol
Forward Dimers-2.644 kcal/mol
Reverse Loops0.81 kcal/mol
Reverse Dimers-1.215 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding-1.992 kcal/mol outside primersite
Amplicon SequenceATCTGAAGATCAGCTATTAGAAGAGAAAGATCAGTTAAGTCCTTTGGACCTGATCAGCTT
GATACAAGAACTACTGATTTCAACTTCTTTGGCTTAATTCTCTCGGAAACGATGAAATAT
ACAAGTTATATCTTGGCTTTTCAGCTCTGCATCGTTTTGGGTTCTCTTGGCTGTTACTGC
CAGGACCCATATGTAAAAGAAGCAGAAAACCTTAAGAAATATTTTAATGCAGGTCATTCA
GATGTAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000619 (IFNG)24816 - 263
Exon 1 To Exon 2 (Pair 2)
Forward (35,23)GAAGAGAAAGATCAGTTAAGTCCAmplicon SizecDNA: 229 bpgenomic: 1,471
Reverse (263,22)GCTACATCTGAATGACCTGCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.751 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops0.81 kcal/mol
Reverse Dimers-1.215 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding-1.992 kcal/mol outside primersite
Amplicon SequenceGAAGAGAAAGATCAGTTAAGTCCTTTGGACCTGATCAGCTTGATACAAGAACTACTGATT
TCAACTTCTTTGGCTTAATTCTCTCGGAAACGATGAAATATACAAGTTATATCTTGGCTT
TTCAGCTCTGCATCGTTTTGGGTTCTCTTGGCTGTTACTGCCAGGACCCATATGTAAAAG
AAGCAGAAAACCTTAAGAAATATTTTAATGCAGGTCATTCAGATGTAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000619 (IFNG)22935 - 263
Exon 1 To Exon 2 (Pair 1)
Forward (14,24)TCATCTGAAGATCAGCTATTAGAAAmplicon SizecDNA: 250 bpgenomic: 1,492
Reverse (263,22)GCTACATCTGAATGACCTGCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.752 kcal/mol
Forward Dimers-2.644 kcal/mol
Reverse Loops0.81 kcal/mol
Reverse Dimers-1.215 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding-1.992 kcal/mol outside primersite
Amplicon SequenceTCATCTGAAGATCAGCTATTAGAAGAGAAAGATCAGTTAAGTCCTTTGGACCTGATCAGC
TTGATACAAGAACTACTGATTTCAACTTCTTTGGCTTAATTCTCTCGGAAACGATGAAAT
ATACAAGTTATATCTTGGCTTTTCAGCTCTGCATCGTTTTGGGTTCTCTTGGCTGTTACT
GCCAGGACCCATATGTAAAAGAAGCAGAAAACCTTAAGAAATATTTTAATGCAGGTCATT
CAGATGTAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000619 (IFNG)25014 - 263
 

See below for some more details.

Program Output:

Loading ...