Design Results for IL17RB

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 5 To Exon 7 (Pair 1)
Forward (413,21)GCTTCCCTGTAGAGCTGAACAAmplicon SizecDNA: 211 bpgenomic: 4,009
Reverse (623,23)TCTACTGTCTCCTCATTCTTCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.708 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops2.79 kcal/mol
Reverse Dimers-0.336 kcal/mol
Forward-Reverse Dimers-1.128 kcal/mol
Amplicon Folding-2.536 kcal/mol outside primersite
Amplicon SequenceGCTTCCCTGTAGAGCTGAACACAGTCTATTTCATTGGGGCCCATAATATTCCTAATGCAA
ATATGAATGAAGATGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACC
ACATAATGAAATATAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCA
CTGCTTGTAAGAAGAATGAGGAGACAGTAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)211413 - 623
Exon 5 To Exon 7 (Pair 2)
Forward (413,21)GCTTCCCTGTAGAGCTGAACAAmplicon SizecDNA: 197 bpgenomic: 3,995
Reverse (609,24)ATTCTTCTTACAAGCAGTGATGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.708 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.701 kcal/mol in 3' area
Reverse Dimers-1.292 kcal/mol
Forward-Reverse Dimers-2.258 kcal/mol
Amplicon Folding-2.536 kcal/mol outside primersite
Amplicon SequenceGCTTCCCTGTAGAGCTGAACACAGTCTATTTCATTGGGGCCCATAATATTCCTAATGCAA
ATATGAATGAAGATGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACC
ACATAATGAAATATAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCA
CTGCTTGTAAGAAGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)197413 - 609
Exon 5 To Exon 7 (Pair 3)
Forward (413,21)GCTTCCCTGTAGAGCTGAACAAmplicon SizecDNA: 281 bpgenomic: 4,079
Reverse (693,21)CCCGATGATAGTGCTGTGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.708 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.79 kcal/mol
Amplicon Folding-2.536 kcal/mol outside primersite
Amplicon SequenceGCTTCCCTGTAGAGCTGAACACAGTCTATTTCATTGGGGCCCATAATATTCCTAATGCAA
ATATGAATGAAGATGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACC
ACATAATGAAATATAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCA
CTGCTTGTAAGAAGAATGAGGAGACAGTAGAAGTGAACTTCACAACCACTCCCCTGGGAA
ACAGATACATGGCTCTTATCCAACACAGCACTATCATCGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)281413 - 693
Exon 5 To Exon 7 (Pair 4)
Forward (487,21)GGCCCTTCCATGTCTGTGAATAmplicon SizecDNA: 138 bpgenomic: 3,936
Reverse (624,23)TTCTACTGTCTCCTCATTCTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.276 kcal/mol
Forward Dimers-2.004 kcal/mol
Reverse Loops2.79 kcal/mol
Reverse Dimers-0.336 kcal/mol
Forward-Reverse Dimers-0.582 kcal/mol
Amplicon Folding-1.913 kcal/mol outside primersite
Amplicon SequenceGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACATAATGAAATAT
AAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTGCTTGTAAGAAG
AATGAGGAGACAGTAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)138487 - 624
Exon 5 To Exon 7 (Pair 5)
Forward (413,21)GCTTCCCTGTAGAGCTGAACAAmplicon SizecDNA: 278 bpgenomic: 4,076
Reverse (690,23)GATGATAGTGCTGTGTTGGATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.708 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.253 kcal/mol
Forward-Reverse Dimers-1.79 kcal/mol
Amplicon Folding-2.536 kcal/mol outside primersite
Amplicon SequenceGCTTCCCTGTAGAGCTGAACACAGTCTATTTCATTGGGGCCCATAATATTCCTAATGCAA
ATATGAATGAAGATGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACC
ACATAATGAAATATAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCA
CTGCTTGTAAGAAGAATGAGGAGACAGTAGAAGTGAACTTCACAACCACTCCCCTGGGAA
ACAGATACATGGCTCTTATCCAACACAGCACTATCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)278413 - 690
Exon 5 To Exon 7 (Pair 6)
Forward (413,21)GCTTCCCTGTAGAGCTGAACAAmplicon SizecDNA: 195 bpgenomic: 3,993
Reverse (607,23)TCTTCTTACAAGCAGTGATGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.708 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.639 kcal/mol in 3' area
Reverse Dimers-1.292 kcal/mol
Forward-Reverse Dimers-2.258 kcal/mol
Amplicon Folding-2.536 kcal/mol outside primersite
Amplicon SequenceGCTTCCCTGTAGAGCTGAACACAGTCTATTTCATTGGGGCCCATAATATTCCTAATGCAA
ATATGAATGAAGATGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACC
ACATAATGAAATATAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCA
CTGCTTGTAAGAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)195413 - 607
Exon 5 To Exon 7 (Pair 7)
Forward (486,21)TGGCCCTTCCATGTCTGTGAAAmplicon SizecDNA: 116 bpgenomic: 3,914
Reverse (601,22)TACAAGCAGTGATGTTCGGATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.705 kcal/mol
Forward Dimers-2.544 kcal/mol
Reverse Loops0.639 kcal/mol
Reverse Dimers-1.292 kcal/mol
Forward-Reverse Dimers-1.001 kcal/mol
Amplicon Folding-1.913 kcal/mol outside primersite
Amplicon SequenceTGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACATAATGAAATA
TAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTGCTTGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)116486 - 601
Exon 5 To Exon 7 (Pair 8)
Forward (486,21)TGGCCCTTCCATGTCTGTGAAAmplicon SizecDNA: 122 bpgenomic: 3,920
Reverse (607,23)TCTTCTTACAAGCAGTGATGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.705 kcal/mol
Forward Dimers-2.544 kcal/mol
Reverse Loops0.639 kcal/mol in 3' area
Reverse Dimers-1.292 kcal/mol
Forward-Reverse Dimers-1.001 kcal/mol
Amplicon Folding-1.913 kcal/mol outside primersite
Amplicon SequenceTGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACATAATGAAATA
TAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTGCTTGTAAGAA
GA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)122486 - 607
Exon 5 To Exon 7 (Pair 9)
Forward (486,21)TGGCCCTTCCATGTCTGTGAAAmplicon SizecDNA: 118 bpgenomic: 3,916
Reverse (603,22)CTTACAAGCAGTGATGTTCGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.705 kcal/mol
Forward Dimers-2.544 kcal/mol
Reverse Loops0.639 kcal/mol in 3' area
Reverse Dimers-1.292 kcal/mol
Forward-Reverse Dimers-1.001 kcal/mol
Amplicon Folding-1.913 kcal/mol outside primersite
Amplicon SequenceTGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACATAATGAAATA
TAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTGCTTGTAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)118486 - 603
Exon 5 To Exon 7 (Pair 10)
Forward (486,21)TGGCCCTTCCATGTCTGTGAAAmplicon SizecDNA: 137 bpgenomic: 3,935
Reverse (622,23)CTACTGTCTCCTCATTCTTCTTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.705 kcal/mol
Forward Dimers-2.544 kcal/mol
Reverse Loops2.79 kcal/mol
Reverse Dimers-0.336 kcal/mol
Forward-Reverse Dimers-0.582 kcal/mol
Amplicon Folding-1.913 kcal/mol outside primersite
Amplicon SequenceTGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACATAATGAAATA
TAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTGCTTGTAAGAA
GAATGAGGAGACAGTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)137486 - 622
Exon 5 To Exon 7 (Pair 11)
Forward (413,21)GCTTCCCTGTAGAGCTGAACAAmplicon SizecDNA: 217 bpgenomic: 4,015
Reverse (629,23)TTCACTTCTACTGTCTCCTCATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.708 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops2.072 kcal/mol
Reverse Dimers-0.336 kcal/mol
Forward-Reverse Dimers-1.128 kcal/mol
Amplicon Folding-2.536 kcal/mol outside primersite
Amplicon SequenceGCTTCCCTGTAGAGCTGAACACAGTCTATTTCATTGGGGCCCATAATATTCCTAATGCAA
ATATGAATGAAGATGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACC
ACATAATGAAATATAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCA
CTGCTTGTAAGAAGAATGAGGAGACAGTAGAAGTGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)217413 - 629
Exon 5 To Exon 7 (Pair 12)
Forward (414,21)CTTCCCTGTAGAGCTGAACACAmplicon SizecDNA: 216 bpgenomic: 4,014
Reverse (629,23)TTCACTTCTACTGTCTCCTCATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.266 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops2.072 kcal/mol
Reverse Dimers-0.336 kcal/mol
Forward-Reverse Dimers-1.128 kcal/mol
Amplicon Folding-2.536 kcal/mol outside primersite
Amplicon SequenceCTTCCCTGTAGAGCTGAACACAGTCTATTTCATTGGGGCCCATAATATTCCTAATGCAAA
TATGAATGAAGATGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCA
CATAATGAAATATAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCAC
TGCTTGTAAGAAGAATGAGGAGACAGTAGAAGTGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)216414 - 629
Exon 5 To Exon 7 (Pair 13)
Forward (416,21)TCCCTGTAGAGCTGAACACAGAmplicon SizecDNA: 194 bpgenomic: 3,992
Reverse (609,24)ATTCTTCTTACAAGCAGTGATGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.652 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.701 kcal/mol in 3' area
Reverse Dimers-1.292 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding-2.536 kcal/mol outside primersite
Amplicon SequenceTCCCTGTAGAGCTGAACACAGTCTATTTCATTGGGGCCCATAATATTCCTAATGCAAATA
TGAATGAAGATGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACA
TAATGAAATATAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTG
CTTGTAAGAAGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)194416 - 609
Exon 5 To Exon 7 (Pair 14)
Forward (416,21)TCCCTGTAGAGCTGAACACAGAmplicon SizecDNA: 189 bpgenomic: 3,987
Reverse (604,22)TCTTACAAGCAGTGATGTTCGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.652 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.639 kcal/mol in 3' area
Reverse Dimers-1.292 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding-2.536 kcal/mol outside primersite
Amplicon SequenceTCCCTGTAGAGCTGAACACAGTCTATTTCATTGGGGCCCATAATATTCCTAATGCAAATA
TGAATGAAGATGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACA
TAATGAAATATAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTG
CTTGTAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)189416 - 604
Exon 5 To Exon 7 (Pair 15)
Forward (486,21)TGGCCCTTCCATGTCTGTGAAAmplicon SizecDNA: 119 bpgenomic: 3,917
Reverse (604,22)TCTTACAAGCAGTGATGTTCGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.705 kcal/mol
Forward Dimers-2.544 kcal/mol
Reverse Loops0.639 kcal/mol in 3' area
Reverse Dimers-1.292 kcal/mol
Forward-Reverse Dimers-1.001 kcal/mol
Amplicon Folding-1.913 kcal/mol outside primersite
Amplicon SequenceTGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACATAATGAAATA
TAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTGCTTGTAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)119486 - 604
Exon 5 To Exon 7 (Pair 16)
Forward (416,21)TCCCTGTAGAGCTGAACACAGAmplicon SizecDNA: 192 bpgenomic: 3,990
Reverse (607,23)TCTTCTTACAAGCAGTGATGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.652 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.639 kcal/mol in 3' area
Reverse Dimers-1.292 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding-2.536 kcal/mol outside primersite
Amplicon SequenceTCCCTGTAGAGCTGAACACAGTCTATTTCATTGGGGCCCATAATATTCCTAATGCAAATA
TGAATGAAGATGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACA
TAATGAAATATAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTG
CTTGTAAGAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)192416 - 607
Exon 5 To Exon 7 (Pair 17)
Forward (487,21)GGCCCTTCCATGTCTGTGAATAmplicon SizecDNA: 118 bpgenomic: 3,916
Reverse (604,22)TCTTACAAGCAGTGATGTTCGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.276 kcal/mol
Forward Dimers-2.004 kcal/mol
Reverse Loops0.639 kcal/mol in 3' area
Reverse Dimers-1.292 kcal/mol
Forward-Reverse Dimers-1.001 kcal/mol
Amplicon Folding-1.913 kcal/mol outside primersite
Amplicon SequenceGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACATAATGAAATAT
AAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTGCTTGTAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)118487 - 604
Exon 5 To Exon 7 (Pair 18)
Forward (486,21)TGGCCCTTCCATGTCTGTGAAAmplicon SizecDNA: 204 bpgenomic: 4,002
Reverse (689,23)ATGATAGTGCTGTGTTGGATAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.705 kcal/mol
Forward Dimers-2.544 kcal/mol
Reverse Loops1.357 kcal/mol
Reverse Dimers-0.253 kcal/mol
Forward-Reverse Dimers-1.429 kcal/mol
Amplicon Folding-1.913 kcal/mol outside primersite
Amplicon SequenceTGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACATAATGAAATA
TAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTGCTTGTAAGAA
GAATGAGGAGACAGTAGAAGTGAACTTCACAACCACTCCCCTGGGAAACAGATACATGGC
TCTTATCCAACACAGCACTATCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)204486 - 689
Exon 5 To Exon 7 (Pair 19)
Forward (486,21)TGGCCCTTCCATGTCTGTGAAAmplicon SizecDNA: 138 bpgenomic: 3,936
Reverse (623,23)TCTACTGTCTCCTCATTCTTCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.705 kcal/mol
Forward Dimers-2.544 kcal/mol
Reverse Loops2.79 kcal/mol
Reverse Dimers-0.336 kcal/mol
Forward-Reverse Dimers-0.582 kcal/mol
Amplicon Folding-1.913 kcal/mol outside primersite
Amplicon SequenceTGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACATAATGAAATA
TAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTGCTTGTAAGAA
GAATGAGGAGACAGTAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)138486 - 623
Exon 5 To Exon 7 (Pair 20)
Forward (487,21)GGCCCTTCCATGTCTGTGAATAmplicon SizecDNA: 207 bpgenomic: 4,005
Reverse (693,21)CCCGATGATAGTGCTGTGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.276 kcal/mol
Forward Dimers-2.004 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.252 kcal/mol
Amplicon Folding-1.913 kcal/mol outside primersite
Amplicon SequenceGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACATAATGAAATAT
AAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTGCTTGTAAGAAG
AATGAGGAGACAGTAGAAGTGAACTTCACAACCACTCCCCTGGGAAACAGATACATGGCT
CTTATCCAACACAGCACTATCATCGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)207487 - 693
Exon 5 To Exon 7 (Pair 21)
Forward (413,21)GCTTCCCTGTAGAGCTGAACAAmplicon SizecDNA: 279 bpgenomic: 4,077
Reverse (691,22)CGATGATAGTGCTGTGTTGGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.708 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.574 kcal/mol
Forward-Reverse Dimers-1.79 kcal/mol
Amplicon Folding-2.536 kcal/mol outside primersite
Amplicon SequenceGCTTCCCTGTAGAGCTGAACACAGTCTATTTCATTGGGGCCCATAATATTCCTAATGCAA
ATATGAATGAAGATGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACC
ACATAATGAAATATAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCA
CTGCTTGTAAGAAGAATGAGGAGACAGTAGAAGTGAACTTCACAACCACTCCCCTGGGAA
ACAGATACATGGCTCTTATCCAACACAGCACTATCATCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)279413 - 691
Exon 5 To Exon 7 (Pair 22)
Forward (414,21)CTTCCCTGTAGAGCTGAACACAmplicon SizecDNA: 214 bpgenomic: 4,012
Reverse (627,22)CACTTCTACTGTCTCCTCATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.266 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops2.072 kcal/mol
Reverse Dimers-0.336 kcal/mol
Forward-Reverse Dimers-1.128 kcal/mol
Amplicon Folding-2.536 kcal/mol outside primersite
Amplicon SequenceCTTCCCTGTAGAGCTGAACACAGTCTATTTCATTGGGGCCCATAATATTCCTAATGCAAA
TATGAATGAAGATGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCA
CATAATGAAATATAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCAC
TGCTTGTAAGAAGAATGAGGAGACAGTAGAAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)214414 - 627
Exon 5 To Exon 7 (Pair 23)
Forward (487,21)GGCCCTTCCATGTCTGTGAATAmplicon SizecDNA: 137 bpgenomic: 3,935
Reverse (623,23)TCTACTGTCTCCTCATTCTTCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.276 kcal/mol
Forward Dimers-2.004 kcal/mol
Reverse Loops2.79 kcal/mol
Reverse Dimers-0.336 kcal/mol
Forward-Reverse Dimers-0.582 kcal/mol
Amplicon Folding-1.913 kcal/mol outside primersite
Amplicon SequenceGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACATAATGAAATAT
AAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTGCTTGTAAGAAG
AATGAGGAGACAGTAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)137487 - 623
Exon 5 To Exon 7 (Pair 24)
Forward (413,21)GCTTCCCTGTAGAGCTGAACAAmplicon SizecDNA: 280 bpgenomic: 4,078
Reverse (692,21)CCGATGATAGTGCTGTGTTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.708 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.79 kcal/mol
Amplicon Folding-2.536 kcal/mol outside primersite
Amplicon SequenceGCTTCCCTGTAGAGCTGAACACAGTCTATTTCATTGGGGCCCATAATATTCCTAATGCAA
ATATGAATGAAGATGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACC
ACATAATGAAATATAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCA
CTGCTTGTAAGAAGAATGAGGAGACAGTAGAAGTGAACTTCACAACCACTCCCCTGGGAA
ACAGATACATGGCTCTTATCCAACACAGCACTATCATCGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)280413 - 692
Exon 5 To Exon 7 (Pair 25)
Forward (486,21)TGGCCCTTCCATGTCTGTGAAAmplicon SizecDNA: 208 bpgenomic: 4,006
Reverse (693,21)CCCGATGATAGTGCTGTGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.705 kcal/mol
Forward Dimers-2.544 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.252 kcal/mol
Amplicon Folding-1.913 kcal/mol outside primersite
Amplicon SequenceTGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACATAATGAAATA
TAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTGCTTGTAAGAA
GAATGAGGAGACAGTAGAAGTGAACTTCACAACCACTCCCCTGGGAAACAGATACATGGC
TCTTATCCAACACAGCACTATCATCGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)208486 - 693
Exon 5 To Exon 7 (Pair 26)
Forward (413,21)GCTTCCCTGTAGAGCTGAACAAmplicon SizecDNA: 192 bpgenomic: 3,990
Reverse (604,22)TCTTACAAGCAGTGATGTTCGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.708 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.639 kcal/mol in 3' area
Reverse Dimers-1.292 kcal/mol
Forward-Reverse Dimers-2.258 kcal/mol
Amplicon Folding-2.536 kcal/mol outside primersite
Amplicon SequenceGCTTCCCTGTAGAGCTGAACACAGTCTATTTCATTGGGGCCCATAATATTCCTAATGCAA
ATATGAATGAAGATGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACC
ACATAATGAAATATAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCA
CTGCTTGTAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)192413 - 604
Exon 5 To Exon 7 (Pair 27)
Forward (487,21)GGCCCTTCCATGTCTGTGAATAmplicon SizecDNA: 121 bpgenomic: 3,919
Reverse (607,23)TCTTCTTACAAGCAGTGATGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.276 kcal/mol
Forward Dimers-2.004 kcal/mol
Reverse Loops0.639 kcal/mol in 3' area
Reverse Dimers-1.292 kcal/mol
Forward-Reverse Dimers-1.001 kcal/mol
Amplicon Folding-1.913 kcal/mol outside primersite
Amplicon SequenceGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACATAATGAAATAT
AAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTGCTTGTAAGAAG
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)121487 - 607
Exon 5 To Exon 7 (Pair 28)
Forward (413,21)GCTTCCCTGTAGAGCTGAACAAmplicon SizecDNA: 214 bpgenomic: 4,012
Reverse (626,23)ACTTCTACTGTCTCCTCATTCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.708 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops2.546 kcal/mol
Reverse Dimers-0.336 kcal/mol
Forward-Reverse Dimers-1.128 kcal/mol
Amplicon Folding-2.536 kcal/mol outside primersite
Amplicon SequenceGCTTCCCTGTAGAGCTGAACACAGTCTATTTCATTGGGGCCCATAATATTCCTAATGCAA
ATATGAATGAAGATGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACC
ACATAATGAAATATAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCA
CTGCTTGTAAGAAGAATGAGGAGACAGTAGAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)214413 - 626
Exon 5 To Exon 7 (Pair 29)
Forward (487,21)GGCCCTTCCATGTCTGTGAATAmplicon SizecDNA: 206 bpgenomic: 4,004
Reverse (692,21)CCGATGATAGTGCTGTGTTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.276 kcal/mol
Forward Dimers-2.004 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.252 kcal/mol
Amplicon Folding-1.913 kcal/mol outside primersite
Amplicon SequenceGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACATAATGAAATAT
AAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTGCTTGTAAGAAG
AATGAGGAGACAGTAGAAGTGAACTTCACAACCACTCCCCTGGGAAACAGATACATGGCT
CTTATCCAACACAGCACTATCATCGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)206487 - 692
Exon 5 To Exon 7 (Pair 30)
Forward (487,21)GGCCCTTCCATGTCTGTGAATAmplicon SizecDNA: 123 bpgenomic: 3,921
Reverse (609,24)ATTCTTCTTACAAGCAGTGATGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.276 kcal/mol
Forward Dimers-2.004 kcal/mol
Reverse Loops0.701 kcal/mol in 3' area
Reverse Dimers-1.292 kcal/mol
Forward-Reverse Dimers-1.001 kcal/mol
Amplicon Folding-1.913 kcal/mol outside primersite
Amplicon SequenceGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACATAATGAAATAT
AAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTGCTTGTAAGAAG
AAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)123487 - 609
Exon 5 To Exon 7 (Pair 31)
Forward (414,21)CTTCCCTGTAGAGCTGAACACAmplicon SizecDNA: 210 bpgenomic: 4,008
Reverse (623,23)TCTACTGTCTCCTCATTCTTCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.266 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops2.79 kcal/mol
Reverse Dimers-0.336 kcal/mol
Forward-Reverse Dimers-1.128 kcal/mol
Amplicon Folding-2.536 kcal/mol outside primersite
Amplicon SequenceCTTCCCTGTAGAGCTGAACACAGTCTATTTCATTGGGGCCCATAATATTCCTAATGCAAA
TATGAATGAAGATGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCA
CATAATGAAATATAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCAC
TGCTTGTAAGAAGAATGAGGAGACAGTAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)210414 - 623
Exon 5 To Exon 7 (Pair 32)
Forward (487,21)GGCCCTTCCATGTCTGTGAATAmplicon SizecDNA: 203 bpgenomic: 4,001
Reverse (689,23)ATGATAGTGCTGTGTTGGATAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.276 kcal/mol
Forward Dimers-2.004 kcal/mol
Reverse Loops1.357 kcal/mol
Reverse Dimers-0.253 kcal/mol
Forward-Reverse Dimers-1.429 kcal/mol
Amplicon Folding-1.913 kcal/mol outside primersite
Amplicon SequenceGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACATAATGAAATAT
AAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTGCTTGTAAGAAG
AATGAGGAGACAGTAGAAGTGAACTTCACAACCACTCCCCTGGGAAACAGATACATGGCT
CTTATCCAACACAGCACTATCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)203487 - 689
Exon 5 To Exon 7 (Pair 33)
Forward (413,21)GCTTCCCTGTAGAGCTGAACAAmplicon SizecDNA: 212 bpgenomic: 4,010
Reverse (624,23)TTCTACTGTCTCCTCATTCTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.708 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops2.79 kcal/mol
Reverse Dimers-0.336 kcal/mol
Forward-Reverse Dimers-1.128 kcal/mol
Amplicon Folding-2.536 kcal/mol outside primersite
Amplicon SequenceGCTTCCCTGTAGAGCTGAACACAGTCTATTTCATTGGGGCCCATAATATTCCTAATGCAA
ATATGAATGAAGATGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACC
ACATAATGAAATATAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCA
CTGCTTGTAAGAAGAATGAGGAGACAGTAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)212413 - 624
Exon 5 To Exon 7 (Pair 34)
Forward (413,21)GCTTCCCTGTAGAGCTGAACAAmplicon SizecDNA: 215 bpgenomic: 4,013
Reverse (627,22)CACTTCTACTGTCTCCTCATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.708 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops2.072 kcal/mol
Reverse Dimers-0.336 kcal/mol
Forward-Reverse Dimers-1.128 kcal/mol
Amplicon Folding-2.536 kcal/mol outside primersite
Amplicon SequenceGCTTCCCTGTAGAGCTGAACACAGTCTATTTCATTGGGGCCCATAATATTCCTAATGCAA
ATATGAATGAAGATGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACC
ACATAATGAAATATAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCA
CTGCTTGTAAGAAGAATGAGGAGACAGTAGAAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)215413 - 627
Exon 5 To Exon 7 (Pair 35)
Forward (486,21)TGGCCCTTCCATGTCTGTGAAAmplicon SizecDNA: 207 bpgenomic: 4,005
Reverse (692,21)CCGATGATAGTGCTGTGTTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.705 kcal/mol
Forward Dimers-2.544 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.252 kcal/mol
Amplicon Folding-1.913 kcal/mol outside primersite
Amplicon SequenceTGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACATAATGAAATA
TAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTGCTTGTAAGAA
GAATGAGGAGACAGTAGAAGTGAACTTCACAACCACTCCCCTGGGAAACAGATACATGGC
TCTTATCCAACACAGCACTATCATCGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)207486 - 692
Exon 5 To Exon 7 (Pair 36)
Forward (414,21)CTTCCCTGTAGAGCTGAACACAmplicon SizecDNA: 211 bpgenomic: 4,009
Reverse (624,23)TTCTACTGTCTCCTCATTCTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.266 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops2.79 kcal/mol
Reverse Dimers-0.336 kcal/mol
Forward-Reverse Dimers-1.128 kcal/mol
Amplicon Folding-2.536 kcal/mol outside primersite
Amplicon SequenceCTTCCCTGTAGAGCTGAACACAGTCTATTTCATTGGGGCCCATAATATTCCTAATGCAAA
TATGAATGAAGATGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCA
CATAATGAAATATAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCAC
TGCTTGTAAGAAGAATGAGGAGACAGTAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)211414 - 624
Exon 5 To Exon 7 (Pair 37)
Forward (486,21)TGGCCCTTCCATGTCTGTGAAAmplicon SizecDNA: 139 bpgenomic: 3,937
Reverse (624,23)TTCTACTGTCTCCTCATTCTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.705 kcal/mol
Forward Dimers-2.544 kcal/mol
Reverse Loops2.79 kcal/mol
Reverse Dimers-0.336 kcal/mol
Forward-Reverse Dimers-0.582 kcal/mol
Amplicon Folding-1.913 kcal/mol outside primersite
Amplicon SequenceTGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACATAATGAAATA
TAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTGCTTGTAAGAA
GAATGAGGAGACAGTAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)139486 - 624
Exon 5 To Exon 7 (Pair 38)
Forward (487,21)GGCCCTTCCATGTCTGTGAATAmplicon SizecDNA: 136 bpgenomic: 3,934
Reverse (622,23)CTACTGTCTCCTCATTCTTCTTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.276 kcal/mol
Forward Dimers-2.004 kcal/mol
Reverse Loops2.79 kcal/mol
Reverse Dimers-0.336 kcal/mol
Forward-Reverse Dimers-0.582 kcal/mol
Amplicon Folding-1.913 kcal/mol outside primersite
Amplicon SequenceGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACATAATGAAATAT
AAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTGCTTGTAAGAAG
AATGAGGAGACAGTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)136487 - 622
Exon 5 To Exon 7 (Pair 39)
Forward (414,21)CTTCCCTGTAGAGCTGAACACAmplicon SizecDNA: 196 bpgenomic: 3,994
Reverse (609,24)ATTCTTCTTACAAGCAGTGATGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.266 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.701 kcal/mol in 3' area
Reverse Dimers-1.292 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding-2.536 kcal/mol outside primersite
Amplicon SequenceCTTCCCTGTAGAGCTGAACACAGTCTATTTCATTGGGGCCCATAATATTCCTAATGCAAA
TATGAATGAAGATGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCA
CATAATGAAATATAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCAC
TGCTTGTAAGAAGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)196414 - 609
Exon 5 To Exon 7 (Pair 40)
Forward (486,21)TGGCCCTTCCATGTCTGTGAAAmplicon SizecDNA: 124 bpgenomic: 3,922
Reverse (609,24)ATTCTTCTTACAAGCAGTGATGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.705 kcal/mol
Forward Dimers-2.544 kcal/mol
Reverse Loops0.701 kcal/mol in 3' area
Reverse Dimers-1.292 kcal/mol
Forward-Reverse Dimers-1.001 kcal/mol
Amplicon Folding-1.913 kcal/mol outside primersite
Amplicon SequenceTGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACATAATGAAATA
TAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTGCTTGTAAGAA
GAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)124486 - 609
Exon 5 To Exon 7 (Pair 41)
Forward (487,21)GGCCCTTCCATGTCTGTGAATAmplicon SizecDNA: 115 bpgenomic: 3,913
Reverse (601,22)TACAAGCAGTGATGTTCGGATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.276 kcal/mol
Forward Dimers-2.004 kcal/mol
Reverse Loops0.639 kcal/mol
Reverse Dimers-1.292 kcal/mol
Forward-Reverse Dimers-1.001 kcal/mol
Amplicon Folding-1.913 kcal/mol outside primersite
Amplicon SequenceGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACATAATGAAATAT
AAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTGCTTGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)115487 - 601
Exon 5 To Exon 7 (Pair 42)
Forward (487,21)GGCCCTTCCATGTCTGTGAATAmplicon SizecDNA: 117 bpgenomic: 3,915
Reverse (603,22)CTTACAAGCAGTGATGTTCGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.276 kcal/mol
Forward Dimers-2.004 kcal/mol
Reverse Loops0.639 kcal/mol in 3' area
Reverse Dimers-1.292 kcal/mol
Forward-Reverse Dimers-1.001 kcal/mol
Amplicon Folding-1.913 kcal/mol outside primersite
Amplicon SequenceGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACATAATGAAATAT
AAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTGCTTGTAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)117487 - 603
Exon 5 To Exon 7 (Pair 43)
Forward (486,21)TGGCCCTTCCATGTCTGTGAAAmplicon SizecDNA: 136 bpgenomic: 3,934
Reverse (621,23)TACTGTCTCCTCATTCTTCTTACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.705 kcal/mol
Forward Dimers-2.544 kcal/mol
Reverse Loops2.79 kcal/mol
Reverse Dimers-0.336 kcal/mol
Forward-Reverse Dimers-0.582 kcal/mol
Amplicon Folding-1.913 kcal/mol outside primersite
Amplicon SequenceTGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACATAATGAAATA
TAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTGCTTGTAAGAA
GAATGAGGAGACAGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)136486 - 621
Exon 5 To Exon 7 (Pair 44)
Forward (487,21)GGCCCTTCCATGTCTGTGAATAmplicon SizecDNA: 135 bpgenomic: 3,933
Reverse (621,23)TACTGTCTCCTCATTCTTCTTACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.276 kcal/mol
Forward Dimers-2.004 kcal/mol
Reverse Loops2.79 kcal/mol
Reverse Dimers-0.336 kcal/mol
Forward-Reverse Dimers-0.582 kcal/mol
Amplicon Folding-1.913 kcal/mol outside primersite
Amplicon SequenceGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCACATAATGAAATAT
AAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCACTGCTTGTAAGAAG
AATGAGGAGACAGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)135487 - 621
Exon 5 To Exon 7 (Pair 45)
Forward (414,21)CTTCCCTGTAGAGCTGAACACAmplicon SizecDNA: 191 bpgenomic: 3,989
Reverse (604,22)TCTTACAAGCAGTGATGTTCGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.266 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.639 kcal/mol in 3' area
Reverse Dimers-1.292 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding-2.536 kcal/mol outside primersite
Amplicon SequenceCTTCCCTGTAGAGCTGAACACAGTCTATTTCATTGGGGCCCATAATATTCCTAATGCAAA
TATGAATGAAGATGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCA
CATAATGAAATATAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCAC
TGCTTGTAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)191414 - 604
Exon 5 To Exon 7 (Pair 46)
Forward (414,21)CTTCCCTGTAGAGCTGAACACAmplicon SizecDNA: 213 bpgenomic: 4,011
Reverse (626,23)ACTTCTACTGTCTCCTCATTCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.266 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops2.546 kcal/mol
Reverse Dimers-0.336 kcal/mol
Forward-Reverse Dimers-1.128 kcal/mol
Amplicon Folding-2.536 kcal/mol outside primersite
Amplicon SequenceCTTCCCTGTAGAGCTGAACACAGTCTATTTCATTGGGGCCCATAATATTCCTAATGCAAA
TATGAATGAAGATGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCA
CATAATGAAATATAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCAC
TGCTTGTAAGAAGAATGAGGAGACAGTAGAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)213414 - 626
Exon 5 To Exon 7 (Pair 47)
Forward (413,21)GCTTCCCTGTAGAGCTGAACAAmplicon SizecDNA: 277 bpgenomic: 4,075
Reverse (689,23)ATGATAGTGCTGTGTTGGATAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.708 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.357 kcal/mol
Reverse Dimers-0.253 kcal/mol
Forward-Reverse Dimers-1.79 kcal/mol
Amplicon Folding-2.536 kcal/mol outside primersite
Amplicon SequenceGCTTCCCTGTAGAGCTGAACACAGTCTATTTCATTGGGGCCCATAATATTCCTAATGCAA
ATATGAATGAAGATGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACC
ACATAATGAAATATAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCA
CTGCTTGTAAGAAGAATGAGGAGACAGTAGAAGTGAACTTCACAACCACTCCCCTGGGAA
ACAGATACATGGCTCTTATCCAACACAGCACTATCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)277413 - 689
Exon 5 To Exon 7 (Pair 48)
Forward (414,21)CTTCCCTGTAGAGCTGAACACAmplicon SizecDNA: 194 bpgenomic: 3,992
Reverse (607,23)TCTTCTTACAAGCAGTGATGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.266 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.639 kcal/mol in 3' area
Reverse Dimers-1.292 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding-2.536 kcal/mol outside primersite
Amplicon SequenceCTTCCCTGTAGAGCTGAACACAGTCTATTTCATTGGGGCCCATAATATTCCTAATGCAAA
TATGAATGAAGATGGCCCTTCCATGTCTGTGAATTTCACCTCACCAGGCTGCCTAGACCA
CATAATGAAATATAAAAAAAAGTGTGTCAAGGCCGGAAGCCTGTGGGATCCGAACATCAC
TGCTTGTAAGAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)194414 - 607
Exon 10 To Exon 11 (Pair 1)
Forward (913,20)CCTCTCCTCCTGCTGTCTCTAmplicon SizecDNA: 218 bpgenomic: 4,735
Reverse (1130,22)ATGACCTCACTTCTGCAATGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.483 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.474 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.402 kcal/mol outside primersite
Amplicon SequenceCCTCTCCTCCTGCTGTCTCTGCTGGTGGCCACATGGGTGCTGGTGGCAGGGATCTATCTA
ATGTGGAGGCACGAAAGGATCAAGAAGACTTCCTTTTCTACCACCACACTACTGCCCCCC
ATTAAGGTTCTTGTGGTTTACCCATCTGAAATATGTTTCCATCACACAATTTGTTACTTC
ACTGAATTTCTTCAAAACCATTGCAGAAGTGAGGTCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)218913 - 1130
Exon 10 To Exon 11 (Pair 2)
Forward (915,20)TCTCCTCCTGCTGTCTCTGCAmplicon SizecDNA: 115 bpgenomic: 4,632
Reverse (1029,20)GGGCAGTAGTGTGGTGGTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.139 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops1.586 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-2.011 kcal/mol outside primersite
Amplicon SequenceTCTCCTCCTGCTGTCTCTGCTGGTGGCCACATGGGTGCTGGTGGCAGGGATCTATCTAAT
GTGGAGGCACGAAAGGATCAAGAAGACTTCCTTTTCTACCACCACACTACTGCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)115915 - 1029
Exon 10 To Exon 11 (Pair 3)
Forward (916,20)CTCCTCCTGCTGTCTCTGCTAmplicon SizecDNA: 215 bpgenomic: 4,732
Reverse (1130,22)ATGACCTCACTTCTGCAATGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.987 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol in 3' area
Reverse Loops1.474 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.402 kcal/mol outside primersite
Amplicon SequenceCTCCTCCTGCTGTCTCTGCTGGTGGCCACATGGGTGCTGGTGGCAGGGATCTATCTAATG
TGGAGGCACGAAAGGATCAAGAAGACTTCCTTTTCTACCACCACACTACTGCCCCCCATT
AAGGTTCTTGTGGTTTACCCATCTGAAATATGTTTCCATCACACAATTTGTTACTTCACT
GAATTTCTTCAAAACCATTGCAGAAGTGAGGTCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)215916 - 1130
Exon 10 To Exon 11 (Pair 4)
Forward (914,20)CTCTCCTCCTGCTGTCTCTGAmplicon SizecDNA: 217 bpgenomic: 4,734
Reverse (1130,22)ATGACCTCACTTCTGCAATGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops3.179 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops1.474 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.402 kcal/mol outside primersite
Amplicon SequenceCTCTCCTCCTGCTGTCTCTGCTGGTGGCCACATGGGTGCTGGTGGCAGGGATCTATCTAA
TGTGGAGGCACGAAAGGATCAAGAAGACTTCCTTTTCTACCACCACACTACTGCCCCCCA
TTAAGGTTCTTGTGGTTTACCCATCTGAAATATGTTTCCATCACACAATTTGTTACTTCA
CTGAATTTCTTCAAAACCATTGCAGAAGTGAGGTCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)217914 - 1130
Exon 10 To Exon 11 (Pair 5)
Forward (909,19)GCTGCCTCTCCTCCTGCTGAmplicon SizecDNA: 225 bpgenomic: 4,742
Reverse (1133,22)AGGATGACCTCACTTCTGCAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.987 kcal/mol in 3' area
Forward Dimers-0.39 kcal/mol
Reverse Loops0.419 kcal/mol
Reverse Dimers-1.516 kcal/mol
Forward-Reverse Dimers-1.806 kcal/mol
Amplicon Folding-2.402 kcal/mol outside primersite
Amplicon SequenceGCTGCCTCTCCTCCTGCTGTCTCTGCTGGTGGCCACATGGGTGCTGGTGGCAGGGATCTA
TCTAATGTGGAGGCACGAAAGGATCAAGAAGACTTCCTTTTCTACCACCACACTACTGCC
CCCCATTAAGGTTCTTGTGGTTTACCCATCTGAAATATGTTTCCATCACACAATTTGTTA
CTTCACTGAATTTCTTCAAAACCATTGCAGAAGTGAGGTCATCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)225909 - 1133
Exon 10 To Exon 11 (Pair 6)
Forward (917,20)TCCTCCTGCTGTCTCTGCTGAmplicon SizecDNA: 217 bpgenomic: 4,734
Reverse (1133,22)AGGATGACCTCACTTCTGCAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.987 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol in 3' area
Reverse Loops0.419 kcal/mol
Reverse Dimers-1.516 kcal/mol
Forward-Reverse Dimers-1.737 kcal/mol
Amplicon Folding-2.402 kcal/mol outside primersite
Amplicon SequenceTCCTCCTGCTGTCTCTGCTGGTGGCCACATGGGTGCTGGTGGCAGGGATCTATCTAATGT
GGAGGCACGAAAGGATCAAGAAGACTTCCTTTTCTACCACCACACTACTGCCCCCCATTA
AGGTTCTTGTGGTTTACCCATCTGAAATATGTTTCCATCACACAATTTGTTACTTCACTG
AATTTCTTCAAAACCATTGCAGAAGTGAGGTCATCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)217917 - 1133
Exon 10 To Exon 11 (Pair 7)
Forward (915,20)TCTCCTCCTGCTGTCTCTGCAmplicon SizecDNA: 219 bpgenomic: 4,736
Reverse (1133,22)AGGATGACCTCACTTCTGCAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.139 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops0.419 kcal/mol
Reverse Dimers-1.516 kcal/mol
Forward-Reverse Dimers-1.737 kcal/mol
Amplicon Folding-2.402 kcal/mol outside primersite
Amplicon SequenceTCTCCTCCTGCTGTCTCTGCTGGTGGCCACATGGGTGCTGGTGGCAGGGATCTATCTAAT
GTGGAGGCACGAAAGGATCAAGAAGACTTCCTTTTCTACCACCACACTACTGCCCCCCAT
TAAGGTTCTTGTGGTTTACCCATCTGAAATATGTTTCCATCACACAATTTGTTACTTCAC
TGAATTTCTTCAAAACCATTGCAGAAGTGAGGTCATCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)219915 - 1133
Exon 10 To Exon 11 (Pair 8)
Forward (914,20)CTCTCCTCCTGCTGTCTCTGAmplicon SizecDNA: 116 bpgenomic: 4,633
Reverse (1029,20)GGGCAGTAGTGTGGTGGTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops3.179 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops1.586 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-2.011 kcal/mol outside primersite
Amplicon SequenceCTCTCCTCCTGCTGTCTCTGCTGGTGGCCACATGGGTGCTGGTGGCAGGGATCTATCTAA
TGTGGAGGCACGAAAGGATCAAGAAGACTTCCTTTTCTACCACCACACTACTGCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)116914 - 1029
Exon 10 To Exon 11 (Pair 9)
Forward (911,20)TGCCTCTCCTCCTGCTGTCTAmplicon SizecDNA: 223 bpgenomic: 4,740
Reverse (1133,22)AGGATGACCTCACTTCTGCAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.987 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops0.419 kcal/mol
Reverse Dimers-1.516 kcal/mol
Forward-Reverse Dimers-1.806 kcal/mol
Amplicon Folding-2.402 kcal/mol outside primersite
Amplicon SequenceTGCCTCTCCTCCTGCTGTCTCTGCTGGTGGCCACATGGGTGCTGGTGGCAGGGATCTATC
TAATGTGGAGGCACGAAAGGATCAAGAAGACTTCCTTTTCTACCACCACACTACTGCCCC
CCATTAAGGTTCTTGTGGTTTACCCATCTGAAATATGTTTCCATCACACAATTTGTTACT
TCACTGAATTTCTTCAAAACCATTGCAGAAGTGAGGTCATCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)223911 - 1133
Exon 10 To Exon 11 (Pair 10)
Forward (917,20)TCCTCCTGCTGTCTCTGCTGAmplicon SizecDNA: 214 bpgenomic: 4,731
Reverse (1130,22)ATGACCTCACTTCTGCAATGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.987 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol in 3' area
Reverse Loops1.474 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.402 kcal/mol outside primersite
Amplicon SequenceTCCTCCTGCTGTCTCTGCTGGTGGCCACATGGGTGCTGGTGGCAGGGATCTATCTAATGT
GGAGGCACGAAAGGATCAAGAAGACTTCCTTTTCTACCACCACACTACTGCCCCCCATTA
AGGTTCTTGTGGTTTACCCATCTGAAATATGTTTCCATCACACAATTTGTTACTTCACTG
AATTTCTTCAAAACCATTGCAGAAGTGAGGTCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)214917 - 1130
Exon 10 To Exon 11 (Pair 11)
Forward (916,20)CTCCTCCTGCTGTCTCTGCTAmplicon SizecDNA: 218 bpgenomic: 4,735
Reverse (1133,22)AGGATGACCTCACTTCTGCAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.987 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol in 3' area
Reverse Loops0.419 kcal/mol
Reverse Dimers-1.516 kcal/mol
Forward-Reverse Dimers-1.737 kcal/mol
Amplicon Folding-2.402 kcal/mol outside primersite
Amplicon SequenceCTCCTCCTGCTGTCTCTGCTGGTGGCCACATGGGTGCTGGTGGCAGGGATCTATCTAATG
TGGAGGCACGAAAGGATCAAGAAGACTTCCTTTTCTACCACCACACTACTGCCCCCCATT
AAGGTTCTTGTGGTTTACCCATCTGAAATATGTTTCCATCACACAATTTGTTACTTCACT
GAATTTCTTCAAAACCATTGCAGAAGTGAGGTCATCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)218916 - 1133
Exon 10 To Exon 11 (Pair 12)
Forward (914,20)CTCTCCTCCTGCTGTCTCTGAmplicon SizecDNA: 220 bpgenomic: 4,737
Reverse (1133,22)AGGATGACCTCACTTCTGCAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops3.179 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops0.419 kcal/mol
Reverse Dimers-1.516 kcal/mol
Forward-Reverse Dimers-1.737 kcal/mol
Amplicon Folding-2.402 kcal/mol outside primersite
Amplicon SequenceCTCTCCTCCTGCTGTCTCTGCTGGTGGCCACATGGGTGCTGGTGGCAGGGATCTATCTAA
TGTGGAGGCACGAAAGGATCAAGAAGACTTCCTTTTCTACCACCACACTACTGCCCCCCA
TTAAGGTTCTTGTGGTTTACCCATCTGAAATATGTTTCCATCACACAATTTGTTACTTCA
CTGAATTTCTTCAAAACCATTGCAGAAGTGAGGTCATCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)220914 - 1133
Exon 10 To Exon 11 (Pair 13)
Forward (911,20)TGCCTCTCCTCCTGCTGTCTAmplicon SizecDNA: 119 bpgenomic: 4,636
Reverse (1029,20)GGGCAGTAGTGTGGTGGTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.987 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.586 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-2.32 kcal/mol
Amplicon Folding-2.011 kcal/mol outside primersite
Amplicon SequenceTGCCTCTCCTCCTGCTGTCTCTGCTGGTGGCCACATGGGTGCTGGTGGCAGGGATCTATC
TAATGTGGAGGCACGAAAGGATCAAGAAGACTTCCTTTTCTACCACCACACTACTGCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)119911 - 1029
Exon 10 To Exon 11 (Pair 14)
Forward (911,20)TGCCTCTCCTCCTGCTGTCTAmplicon SizecDNA: 220 bpgenomic: 4,737
Reverse (1130,22)ATGACCTCACTTCTGCAATGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.987 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.474 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.402 kcal/mol outside primersite
Amplicon SequenceTGCCTCTCCTCCTGCTGTCTCTGCTGGTGGCCACATGGGTGCTGGTGGCAGGGATCTATC
TAATGTGGAGGCACGAAAGGATCAAGAAGACTTCCTTTTCTACCACCACACTACTGCCCC
CCATTAAGGTTCTTGTGGTTTACCCATCTGAAATATGTTTCCATCACACAATTTGTTACT
TCACTGAATTTCTTCAAAACCATTGCAGAAGTGAGGTCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)220911 - 1130
Exon 10 To Exon 11 (Pair 15)
Forward (915,20)TCTCCTCCTGCTGTCTCTGCAmplicon SizecDNA: 216 bpgenomic: 4,733
Reverse (1130,22)ATGACCTCACTTCTGCAATGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.139 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops1.474 kcal/mol in 3' area
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-2.402 kcal/mol outside primersite
Amplicon SequenceTCTCCTCCTGCTGTCTCTGCTGGTGGCCACATGGGTGCTGGTGGCAGGGATCTATCTAAT
GTGGAGGCACGAAAGGATCAAGAAGACTTCCTTTTCTACCACCACACTACTGCCCCCCAT
TAAGGTTCTTGTGGTTTACCCATCTGAAATATGTTTCCATCACACAATTTGTTACTTCAC
TGAATTTCTTCAAAACCATTGCAGAAGTGAGGTCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)216915 - 1130
Exon 10 To Exon 11 (Pair 16)
Forward (913,20)CCTCTCCTCCTGCTGTCTCTAmplicon SizecDNA: 221 bpgenomic: 4,738
Reverse (1133,22)AGGATGACCTCACTTCTGCAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.483 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops0.419 kcal/mol
Reverse Dimers-1.516 kcal/mol
Forward-Reverse Dimers-1.737 kcal/mol
Amplicon Folding-2.402 kcal/mol outside primersite
Amplicon SequenceCCTCTCCTCCTGCTGTCTCTGCTGGTGGCCACATGGGTGCTGGTGGCAGGGATCTATCTA
ATGTGGAGGCACGAAAGGATCAAGAAGACTTCCTTTTCTACCACCACACTACTGCCCCCC
ATTAAGGTTCTTGTGGTTTACCCATCTGAAATATGTTTCCATCACACAATTTGTTACTTC
ACTGAATTTCTTCAAAACCATTGCAGAAGTGAGGTCATCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)221913 - 1133
Exon 10 To Exon 11 (Pair 17)
Forward (913,20)CCTCTCCTCCTGCTGTCTCTAmplicon SizecDNA: 117 bpgenomic: 4,634
Reverse (1029,20)GGGCAGTAGTGTGGTGGTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.483 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.586 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-2.011 kcal/mol outside primersite
Amplicon SequenceCCTCTCCTCCTGCTGTCTCTGCTGGTGGCCACATGGGTGCTGGTGGCAGGGATCTATCTA
ATGTGGAGGCACGAAAGGATCAAGAAGACTTCCTTTTCTACCACCACACTACTGCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018725 (IL17RB)117913 - 1029
 

See below for some more details.

Program Output:

Loading ...