Design Results for IL6ST

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size90Maximal Amplicon Size115
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 5 To Exon 6 (Pair 1)
Forward (769,23)ACACTTGGAGACAAACTTCACTTAmplicon SizecDNA: 100 bpgenomic: 4,063
Reverse (868,21)ATCAACAGTGCATGAGGTGGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.374 kcal/mol
Forward Dimers-0.735 kcal/mol
Reverse Loops0.863 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-2.269 kcal/mol
Amplicon Folding-0.548 kcal/mol outside primersite
Amplicon SequenceACACTTGGAGACAAACTTCACTTTAAAATCTGAATGGGCAACACACAAGTTTGCTGATTG
CAAAGCAAAACGTGACACCCCCACCTCATGCACTGTTGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002184 (IL6ST)100769 - 868
NM_001190981 (IL6ST)100769 - 868
NM_175767 (IL6ST)100769 - 868
Exon 5 To Exon 6 (Pair 2)
Forward (768,22)CACACTTGGAGACAAACTTCACAmplicon SizecDNA: 103 bpgenomic: 4,066
Reverse (870,22)TAATCAACAGTGCATGAGGTGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.374 kcal/mol
Forward Dimers-0.735 kcal/mol
Reverse Loops0.863 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-2.269 kcal/mol
Amplicon Folding-0.548 kcal/mol outside primersite
Amplicon SequenceCACACTTGGAGACAAACTTCACTTTAAAATCTGAATGGGCAACACACAAGTTTGCTGATT
GCAAAGCAAAACGTGACACCCCCACCTCATGCACTGTTGATTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175767 (IL6ST)103768 - 870
NM_001190981 (IL6ST)103768 - 870
NM_002184 (IL6ST)103768 - 870
Exon 5 To Exon 6 (Pair 3)
Forward (769,23)ACACTTGGAGACAAACTTCACTTAmplicon SizecDNA: 102 bpgenomic: 4,065
Reverse (870,22)TAATCAACAGTGCATGAGGTGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.374 kcal/mol
Forward Dimers-0.735 kcal/mol
Reverse Loops0.863 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-2.269 kcal/mol
Amplicon Folding-0.548 kcal/mol outside primersite
Amplicon SequenceACACTTGGAGACAAACTTCACTTTAAAATCTGAATGGGCAACACACAAGTTTGCTGATTG
CAAAGCAAAACGTGACACCCCCACCTCATGCACTGTTGATTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002184 (IL6ST)102769 - 870
NM_175767 (IL6ST)102769 - 870
NM_001190981 (IL6ST)102769 - 870
Exon 5 To Exon 6 (Pair 4)
Forward (769,23)ACACTTGGAGACAAACTTCACTTAmplicon SizecDNA: 104 bpgenomic: 4,067
Reverse (872,23)AATAATCAACAGTGCATGAGGTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.374 kcal/mol
Forward Dimers-0.735 kcal/mol
Reverse Loops0.863 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-2.269 kcal/mol
Amplicon Folding-0.548 kcal/mol outside primersite
Amplicon SequenceACACTTGGAGACAAACTTCACTTTAAAATCTGAATGGGCAACACACAAGTTTGCTGATTG
CAAAGCAAAACGTGACACCCCCACCTCATGCACTGTTGATTATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175767 (IL6ST)104769 - 872
NM_001190981 (IL6ST)104769 - 872
NM_002184 (IL6ST)104769 - 872
Exon 5 To Exon 6 (Pair 5)
Forward (768,22)CACACTTGGAGACAAACTTCACAmplicon SizecDNA: 101 bpgenomic: 4,064
Reverse (868,21)ATCAACAGTGCATGAGGTGGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.374 kcal/mol
Forward Dimers-0.735 kcal/mol
Reverse Loops0.863 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-2.269 kcal/mol
Amplicon Folding-0.548 kcal/mol outside primersite
Amplicon SequenceCACACTTGGAGACAAACTTCACTTTAAAATCTGAATGGGCAACACACAAGTTTGCTGATT
GCAAAGCAAAACGTGACACCCCCACCTCATGCACTGTTGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002184 (IL6ST)101768 - 868
NM_001190981 (IL6ST)101768 - 868
NM_175767 (IL6ST)101768 - 868
Exon 5 To Exon 6 (Pair 6)
Forward (768,22)CACACTTGGAGACAAACTTCACAmplicon SizecDNA: 105 bpgenomic: 4,068
Reverse (872,23)AATAATCAACAGTGCATGAGGTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.374 kcal/mol
Forward Dimers-0.735 kcal/mol
Reverse Loops0.863 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-2.269 kcal/mol
Amplicon Folding-0.548 kcal/mol outside primersite
Amplicon SequenceCACACTTGGAGACAAACTTCACTTTAAAATCTGAATGGGCAACACACAAGTTTGCTGATT
GCAAAGCAAAACGTGACACCCCCACCTCATGCACTGTTGATTATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002184 (IL6ST)105768 - 872
NM_001190981 (IL6ST)105768 - 872
NM_175767 (IL6ST)105768 - 872
Exon 5 To Exon 6 (Pair 7)
Forward (772,24)CTTGGAGACAAACTTCACTTTAAAAmplicon SizecDNA: 97 bpgenomic: 4,060
Reverse (868,21)ATCAACAGTGCATGAGGTGGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.374 kcal/mol
Forward Dimers-0.735 kcal/mol
Reverse Loops0.863 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-2.032 kcal/mol
Amplicon Folding-0.548 kcal/mol outside primersite
Amplicon SequenceCTTGGAGACAAACTTCACTTTAAAATCTGAATGGGCAACACACAAGTTTGCTGATTGCAA
AGCAAAACGTGACACCCCCACCTCATGCACTGTTGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001190981 (IL6ST)97772 - 868
NM_002184 (IL6ST)97772 - 868
NM_175767 (IL6ST)97772 - 868
Exon 5 To Exon 6 (Pair 8)
Forward (772,24)CTTGGAGACAAACTTCACTTTAAAAmplicon SizecDNA: 99 bpgenomic: 4,062
Reverse (870,22)TAATCAACAGTGCATGAGGTGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.374 kcal/mol
Forward Dimers-0.735 kcal/mol
Reverse Loops0.863 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-2.032 kcal/mol
Amplicon Folding-0.548 kcal/mol outside primersite
Amplicon SequenceCTTGGAGACAAACTTCACTTTAAAATCTGAATGGGCAACACACAAGTTTGCTGATTGCAA
AGCAAAACGTGACACCCCCACCTCATGCACTGTTGATTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002184 (IL6ST)99772 - 870
NM_001190981 (IL6ST)99772 - 870
NM_175767 (IL6ST)99772 - 870
Exon 5 To Exon 6 (Pair 9)
Forward (772,24)CTTGGAGACAAACTTCACTTTAAAAmplicon SizecDNA: 101 bpgenomic: 4,064
Reverse (872,23)AATAATCAACAGTGCATGAGGTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.374 kcal/mol
Forward Dimers-0.735 kcal/mol
Reverse Loops0.863 kcal/mol
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-2.032 kcal/mol
Amplicon Folding-0.548 kcal/mol outside primersite
Amplicon SequenceCTTGGAGACAAACTTCACTTTAAAATCTGAATGGGCAACACACAAGTTTGCTGATTGCAA
AGCAAAACGTGACACCCCCACCTCATGCACTGTTGATTATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175767 (IL6ST)101772 - 872
NM_001190981 (IL6ST)101772 - 872
NM_002184 (IL6ST)101772 - 872
Exon 15 To Exon 16 (Pair 1)
Forward (2157,21)GGGAAGGATGGTCCAGAATTCAmplicon SizecDNA: 112 bpgenomic: 3,986
Reverse (2268,22)CTCCCAGAAGAGTTGTCAATAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.817 kcal/mol
Forward Dimers-1.346 kcal/mol
Reverse Loops1.88 kcal/mol
Reverse Dimers-0.174 kcal/mol
Forward-Reverse Dimers-2.127 kcal/mol
Amplicon Folding0.74 kcal/mol outside primersite
Amplicon SequenceGGGAAGGATGGTCCAGAATTCACTTTTACTACCCCAAAGTTTGCTCAAGGAGAAATTGAA
GCCATAGTCGTGCCTGTTTGCTTAGCATTCCTATTGACAACTCTTCTGGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175767 (IL6ST)1122028 - 2139
NM_001190981 (IL6ST)1121928 - 2039
NM_002184 (IL6ST)1122111 - 2222
Exon 15 To Exon 16 (Pair 2)
Forward (2133,22)ATGGCAGCATACACAGATGAAGAmplicon SizecDNA: 92 bpgenomic: 3,966
Reverse (2224,23)ACTATGGCTTCAATTTCTCCTTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.041 kcal/mol in 3' area
Forward Dimers-1.395 kcal/mol
Reverse Loops2.011 kcal/mol
Reverse Dimers-0.884 kcal/mol
Forward-Reverse Dimers-2.1 kcal/mol
Amplicon Folding0.788 kcal/mol outside primersite
Amplicon SequenceATGGCAGCATACACAGATGAAGGTGGGAAGGATGGTCCAGAATTCACTTTTACTACCCCA
AAGTTTGCTCAAGGAGAAATTGAAGCCATAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175767 (IL6ST)922004 - 2095
NM_001190981 (IL6ST)921904 - 1995
NM_002184 (IL6ST)922087 - 2178
 

See below for some more details.

Program Output:

Loading ...