Design Results for ITGA6

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 4 To Exon 6 (Pair 1)
Forward (826,22)CCGGGTACTTATAACTGGAAAGAmplicon SizecDNA: 189 bpgenomic: 3,450
Reverse (1014,22)ATCTGTATAGGAAACGCTGGTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.516 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops0.968 kcal/mol in 3' area
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.184 kcal/mol outside primersite
Amplicon SequenceCCGGGTACTTATAACTGGAAAGGGATTGTTCGTGTAGAGCAAAAGAATAACACTTTTTTT
GACATGAACATCTTTGAAGATGGGCCTTATGAAGTTGGTGGAGAGACTGAGCATGATGAA
AGTCTCGTTCCTGTTCCTGCTAACAGTTACTTAGGCCTGCTGTTTTTGACCAGCGTTTCC
TATACAGAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 4 To Exon 6 (Pair 2)
Forward (826,22)CCGGGTACTTATAACTGGAAAGAmplicon SizecDNA: 190 bpgenomic: 3,451
Reverse (1015,22)GATCTGTATAGGAAACGCTGGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.516 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.477 kcal/mol in 3' area
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.184 kcal/mol outside primersite
Amplicon SequenceCCGGGTACTTATAACTGGAAAGGGATTGTTCGTGTAGAGCAAAAGAATAACACTTTTTTT
GACATGAACATCTTTGAAGATGGGCCTTATGAAGTTGGTGGAGAGACTGAGCATGATGAA
AGTCTCGTTCCTGTTCCTGCTAACAGTTACTTAGGCCTGCTGTTTTTGACCAGCGTTTCC
TATACAGATC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 4 To Exon 6 (Pair 3)
Forward (826,22)CCGGGTACTTATAACTGGAAAGAmplicon SizecDNA: 187 bpgenomic: 3,448
Reverse (1012,22)CTGTATAGGAAACGCTGGTCAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.516 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops0.968 kcal/mol in 3' area
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.184 kcal/mol outside primersite
Amplicon SequenceCCGGGTACTTATAACTGGAAAGGGATTGTTCGTGTAGAGCAAAAGAATAACACTTTTTTT
GACATGAACATCTTTGAAGATGGGCCTTATGAAGTTGGTGGAGAGACTGAGCATGATGAA
AGTCTCGTTCCTGTTCCTGCTAACAGTTACTTAGGCCTGCTGTTTTTGACCAGCGTTTCC
TATACAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 4 To Exon 6 (Pair 4)
Forward (826,22)CCGGGTACTTATAACTGGAAAGAmplicon SizecDNA: 198 bpgenomic: 3,459
Reverse (1023,23)CTGATCAGGATCTGTATAGGAAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.516 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.582 kcal/mol
Reverse Dimers-2.908 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.184 kcal/mol outside primersite
Amplicon SequenceCCGGGTACTTATAACTGGAAAGGGATTGTTCGTGTAGAGCAAAAGAATAACACTTTTTTT
GACATGAACATCTTTGAAGATGGGCCTTATGAAGTTGGTGGAGAGACTGAGCATGATGAA
AGTCTCGTTCCTGTTCCTGCTAACAGTTACTTAGGCCTGCTGTTTTTGACCAGCGTTTCC
TATACAGATCCTGATCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 4 To Exon 6 (Pair 5)
Forward (826,22)CCGGGTACTTATAACTGGAAAGAmplicon SizecDNA: 188 bpgenomic: 3,449
Reverse (1013,22)TCTGTATAGGAAACGCTGGTCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.516 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops0.968 kcal/mol in 3' area
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.184 kcal/mol outside primersite
Amplicon SequenceCCGGGTACTTATAACTGGAAAGGGATTGTTCGTGTAGAGCAAAAGAATAACACTTTTTTT
GACATGAACATCTTTGAAGATGGGCCTTATGAAGTTGGTGGAGAGACTGAGCATGATGAA
AGTCTCGTTCCTGTTCCTGCTAACAGTTACTTAGGCCTGCTGTTTTTGACCAGCGTTTCC
TATACAGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 4 To Exon 6 (Pair 6)
Forward (826,22)CCGGGTACTTATAACTGGAAAGAmplicon SizecDNA: 197 bpgenomic: 3,458
Reverse (1022,23)TGATCAGGATCTGTATAGGAAACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.516 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.582 kcal/mol
Reverse Dimers-1.294 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.184 kcal/mol outside primersite
Amplicon SequenceCCGGGTACTTATAACTGGAAAGGGATTGTTCGTGTAGAGCAAAAGAATAACACTTTTTTT
GACATGAACATCTTTGAAGATGGGCCTTATGAAGTTGGTGGAGAGACTGAGCATGATGAA
AGTCTCGTTCCTGTTCCTGCTAACAGTTACTTAGGCCTGCTGTTTTTGACCAGCGTTTCC
TATACAGATCCTGATCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 9 To Exon 11 (Pair 1)
Forward (1515,21)AGCTCCGTATGATGACTTGGGAmplicon SizecDNA: 259 bpgenomic: 4,095
Reverse (1773,21)GCGGAGGTCAATTCTGTTAGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.855 kcal/mol
Forward Dimers-1.83 kcal/mol
Reverse Loops1.391 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.395 kcal/mol outside primersite
Amplicon SequenceAGCTCCGTATGATGACTTGGGAAAGGTTTTTATCTATCATGGATCTGCAAATGGAATAAA
TACCAAACCAACACAGGTTCTCAAGGGTATATCACCTTATTTTGGATATTCAATTGCTGG
AAACATGGACCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTC
AGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCC
TAACAGAATTGACCTCCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2591397 - 1655
NM_001079818 (ITGA6)2591397 - 1655
Exon 9 To Exon 11 (Pair 2)
Forward (1515,21)AGCTCCGTATGATGACTTGGGAmplicon SizecDNA: 260 bpgenomic: 4,096
Reverse (1774,21)GGCGGAGGTCAATTCTGTTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.855 kcal/mol
Forward Dimers-1.83 kcal/mol
Reverse Loops1.391 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.395 kcal/mol outside primersite
Amplicon SequenceAGCTCCGTATGATGACTTGGGAAAGGTTTTTATCTATCATGGATCTGCAAATGGAATAAA
TACCAAACCAACACAGGTTCTCAAGGGTATATCACCTTATTTTGGATATTCAATTGCTGG
AAACATGGACCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTC
AGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCC
TAACAGAATTGACCTCCGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2601397 - 1656
NM_001079818 (ITGA6)2601397 - 1656
Exon 9 To Exon 11 (Pair 3)
Forward (1514,21)GAGCTCCGTATGATGACTTGGAmplicon SizecDNA: 261 bpgenomic: 4,097
Reverse (1774,21)GGCGGAGGTCAATTCTGTTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.855 kcal/mol
Forward Dimers-2.956 kcal/mol
Reverse Loops1.391 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.395 kcal/mol outside primersite
Amplicon SequenceGAGCTCCGTATGATGACTTGGGAAAGGTTTTTATCTATCATGGATCTGCAAATGGAATAA
ATACCAAACCAACACAGGTTCTCAAGGGTATATCACCTTATTTTGGATATTCAATTGCTG
GAAACATGGACCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATT
CAGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTC
CTAACAGAATTGACCTCCGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2611396 - 1656
NM_001079818 (ITGA6)2611396 - 1656
Exon 9 To Exon 11 (Pair 4)
Forward (1514,21)GAGCTCCGTATGATGACTTGGAmplicon SizecDNA: 260 bpgenomic: 4,096
Reverse (1773,21)GCGGAGGTCAATTCTGTTAGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.855 kcal/mol
Forward Dimers-2.956 kcal/mol
Reverse Loops1.391 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.395 kcal/mol outside primersite
Amplicon SequenceGAGCTCCGTATGATGACTTGGGAAAGGTTTTTATCTATCATGGATCTGCAAATGGAATAA
ATACCAAACCAACACAGGTTCTCAAGGGTATATCACCTTATTTTGGATATTCAATTGCTG
GAAACATGGACCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATT
CAGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTC
CTAACAGAATTGACCTCCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2601396 - 1655
NM_001079818 (ITGA6)2601396 - 1655
Exon 9 To Exon 11 (Pair 5)
Forward (1514,21)GAGCTCCGTATGATGACTTGGAmplicon SizecDNA: 265 bpgenomic: 4,101
Reverse (1778,21)TTCTGGCGGAGGTCAATTCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.855 kcal/mol
Forward Dimers-2.956 kcal/mol
Reverse Loops1.391 kcal/mol in 3' area
Reverse Dimers-1.541 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.395 kcal/mol outside primersite
Amplicon SequenceGAGCTCCGTATGATGACTTGGGAAAGGTTTTTATCTATCATGGATCTGCAAATGGAATAA
ATACCAAACCAACACAGGTTCTCAAGGGTATATCACCTTATTTTGGATATTCAATTGCTG
GAAACATGGACCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATT
CAGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTC
CTAACAGAATTGACCTCCGCCAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2651396 - 1660
NM_001079818 (ITGA6)2651396 - 1660
Exon 9 To Exon 11 (Pair 6)
Forward (1515,21)AGCTCCGTATGATGACTTGGGAmplicon SizecDNA: 263 bpgenomic: 4,099
Reverse (1777,21)TCTGGCGGAGGTCAATTCTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.855 kcal/mol
Forward Dimers-1.83 kcal/mol
Reverse Loops1.391 kcal/mol in 3' area
Reverse Dimers-1.541 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.395 kcal/mol outside primersite
Amplicon SequenceAGCTCCGTATGATGACTTGGGAAAGGTTTTTATCTATCATGGATCTGCAAATGGAATAAA
TACCAAACCAACACAGGTTCTCAAGGGTATATCACCTTATTTTGGATATTCAATTGCTGG
AAACATGGACCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTC
AGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCC
TAACAGAATTGACCTCCGCCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2631397 - 1659
NM_001079818 (ITGA6)2631397 - 1659
Exon 9 To Exon 11 (Pair 7)
Forward (1514,21)GAGCTCCGTATGATGACTTGGAmplicon SizecDNA: 263 bpgenomic: 4,099
Reverse (1776,21)CTGGCGGAGGTCAATTCTGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.855 kcal/mol
Forward Dimers-2.956 kcal/mol
Reverse Loops1.391 kcal/mol in 3' area
Reverse Dimers-0.931 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.395 kcal/mol outside primersite
Amplicon SequenceGAGCTCCGTATGATGACTTGGGAAAGGTTTTTATCTATCATGGATCTGCAAATGGAATAA
ATACCAAACCAACACAGGTTCTCAAGGGTATATCACCTTATTTTGGATATTCAATTGCTG
GAAACATGGACCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATT
CAGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTC
CTAACAGAATTGACCTCCGCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2631396 - 1658
NM_001079818 (ITGA6)2631396 - 1658
Exon 9 To Exon 11 (Pair 8)
Forward (1515,21)AGCTCCGTATGATGACTTGGGAmplicon SizecDNA: 262 bpgenomic: 4,098
Reverse (1776,21)CTGGCGGAGGTCAATTCTGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.855 kcal/mol
Forward Dimers-1.83 kcal/mol
Reverse Loops1.391 kcal/mol in 3' area
Reverse Dimers-0.931 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.395 kcal/mol outside primersite
Amplicon SequenceAGCTCCGTATGATGACTTGGGAAAGGTTTTTATCTATCATGGATCTGCAAATGGAATAAA
TACCAAACCAACACAGGTTCTCAAGGGTATATCACCTTATTTTGGATATTCAATTGCTGG
AAACATGGACCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTC
AGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCC
TAACAGAATTGACCTCCGCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2621397 - 1658
NM_001079818 (ITGA6)2621397 - 1658
Exon 9 To Exon 11 (Pair 9)
Forward (1515,21)AGCTCCGTATGATGACTTGGGAmplicon SizecDNA: 264 bpgenomic: 4,100
Reverse (1778,21)TTCTGGCGGAGGTCAATTCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.855 kcal/mol
Forward Dimers-1.83 kcal/mol
Reverse Loops1.391 kcal/mol in 3' area
Reverse Dimers-1.541 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.395 kcal/mol outside primersite
Amplicon SequenceAGCTCCGTATGATGACTTGGGAAAGGTTTTTATCTATCATGGATCTGCAAATGGAATAAA
TACCAAACCAACACAGGTTCTCAAGGGTATATCACCTTATTTTGGATATTCAATTGCTGG
AAACATGGACCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTC
AGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCC
TAACAGAATTGACCTCCGCCAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2641397 - 1660
NM_001079818 (ITGA6)2641397 - 1660
Exon 9 To Exon 11 (Pair 10)
Forward (1514,21)GAGCTCCGTATGATGACTTGGAmplicon SizecDNA: 264 bpgenomic: 4,100
Reverse (1777,21)TCTGGCGGAGGTCAATTCTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.855 kcal/mol
Forward Dimers-2.956 kcal/mol
Reverse Loops1.391 kcal/mol in 3' area
Reverse Dimers-1.541 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.395 kcal/mol outside primersite
Amplicon SequenceGAGCTCCGTATGATGACTTGGGAAAGGTTTTTATCTATCATGGATCTGCAAATGGAATAA
ATACCAAACCAACACAGGTTCTCAAGGGTATATCACCTTATTTTGGATATTCAATTGCTG
GAAACATGGACCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATT
CAGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTC
CTAACAGAATTGACCTCCGCCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2641396 - 1659
NM_001079818 (ITGA6)2641396 - 1659
Exon 10 To Exon 13 (Pair 1)
Forward (1659,21)CTACCCTGATGTTGCTGTTGGAmplicon SizecDNA: 285 bpgenomic: 8,392
Reverse (1943,23)TTTCGAAACTGAACTCTTGAGGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops0.814 kcal/mol in 3' area
Reverse Dimers-2.492 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCC
TGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAA
AACAGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATATAC
TGCTAACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGAAAA
AGAAAGAAGAAAATCTGGGCTATCCTCAAGAGTTCAGTTTCGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001079818 (ITGA6)2851541 - 1825
NM_000210 (ITGA6)2851541 - 1825
Exon 10 To Exon 11 (Pair 1)
Forward (1670,21)TTGCTGTTGGTTCCCTCTCAGAmplicon SizecDNA: 109 bpgenomic: 3,236
Reverse (1778,21)TTCTGGCGGAGGTCAATTCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.391 kcal/mol in 3' area
Reverse Dimers-1.541 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAATA
TTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1091552 - 1660
NM_001079818 (ITGA6)1091552 - 1660
Exon 10 To Exon 13 (Pair 2)
Forward (1674,22)TGTTGGTTCCCTCTCAGATTCAAmplicon SizecDNA: 259 bpgenomic: 8,366
Reverse (1932,22)AACTCTTGAGGATAGCCCAGATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops0.814 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCA
GAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAAAACAGCGTGTGGGGC
GCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATATACTGCTAACCCCGCTGG
TTATAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGAAAAAGAAAGAAGAAAATC
TGGGCTATCCTCAAGAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2591556 - 1814
NM_001079818 (ITGA6)2591556 - 1814
Exon 10 To Exon 13 (Pair 3)
Forward (1639,23)ATGGACCTTGATCGAAATTCCTAAmplicon SizecDNA: 293 bpgenomic: 8,400
Reverse (1931,22)ACTCTTGAGGATAGCCCAGATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.871 kcal/mol
Forward Dimers-1.402 kcal/mol
Reverse Loops0.814 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceATGGACCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTA
ACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAAC
AGAATTGACCTCCGCCAGAAAACAGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTT
AAATCCTGTTTTGAATATACTGCTAACCCCGCTGGTTATAATCCTTCAATATCAATTGTG
GGCACACTTGAAGCTGAAAAAGAAAGAAGAAAATCTGGGCTATCCTCAAGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2931521 - 1813
NM_001079818 (ITGA6)2931521 - 1813
Exon 10 To Exon 13 (Pair 4)
Forward (1639,23)ATGGACCTTGATCGAAATTCCTAAmplicon SizecDNA: 292 bpgenomic: 8,399
Reverse (1930,22)CTCTTGAGGATAGCCCAGATTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.871 kcal/mol
Forward Dimers-1.402 kcal/mol
Reverse Loops1.001 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceATGGACCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTA
ACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAAC
AGAATTGACCTCCGCCAGAAAACAGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTT
AAATCCTGTTTTGAATATACTGCTAACCCCGCTGGTTATAATCCTTCAATATCAATTGTG
GGCACACTTGAAGCTGAAAAAGAAAGAAGAAAATCTGGGCTATCCTCAAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2921521 - 1812
NM_001079818 (ITGA6)2921521 - 1812
Exon 10 To Exon 13 (Pair 5)
Forward (1666,21)GATGTTGCTGTTGGTTCCCTCAmplicon SizecDNA: 265 bpgenomic: 8,372
Reverse (1930,22)CTCTTGAGGATAGCCCAGATTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol in 3' area
Forward Dimers0.044 kcal/mol
Reverse Loops1.001 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATT
AATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAAAACAGCG
TGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATATACTGCTAAC
CCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGAAAAAGAAAGA
AGAAAATCTGGGCTATCCTCAAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2651548 - 1812
NM_001079818 (ITGA6)2651548 - 1812
Exon 10 To Exon 13 (Pair 6)
Forward (1679,22)GTTCCCTCTCAGATTCAGTAACAmplicon SizecDNA: 252 bpgenomic: 8,359
Reverse (1930,22)CTCTTGAGGATAGCCCAGATTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops1.001 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGAAAA
CCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAAAACAGCGTGTGGGGCGCCTA
GTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATATACTGCTAACCCCGCTGGTTATA
ATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGAAAAAGAAAGAAGAAAATCTGGGC
TATCCTCAAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2521561 - 1812
NM_001079818 (ITGA6)2521561 - 1812
Exon 10 To Exon 13 (Pair 7)
Forward (1645,22)CTTGATCGAAATTCCTACCCTGAmplicon SizecDNA: 299 bpgenomic: 8,406
Reverse (1943,23)TTTCGAAACTGAACTCTTGAGGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.871 kcal/mol
Forward Dimers-1.402 kcal/mol
Reverse Loops0.814 kcal/mol in 3' area
Reverse Dimers-2.492 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATT
TTCAGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATT
GACCTCCGCCAGAAAACAGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCC
TGTTTTGAATATACTGCTAACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCACA
CTTGAAGCTGAAAAAGAAAGAAGAAAATCTGGGCTATCCTCAAGAGTTCAGTTTCGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2991527 - 1825
NM_001079818 (ITGA6)2991527 - 1825
Exon 10 To Exon 11 (Pair 2)
Forward (1654,22)AATTCCTACCCTGATGTTGCTGAmplicon SizecDNA: 120 bpgenomic: 3,247
Reverse (1773,21)GCGGAGGTCAATTCTGTTAGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol
Forward Dimers-0.128 kcal/mol
Reverse Loops1.391 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCC
CGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1201536 - 1655
NM_001079818 (ITGA6)1201536 - 1655
Exon 10 To Exon 11 (Pair 3)
Forward (1666,21)GATGTTGCTGTTGGTTCCCTCAmplicon SizecDNA: 112 bpgenomic: 3,239
Reverse (1777,21)TCTGGCGGAGGTCAATTCTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol in 3' area
Forward Dimers0.044 kcal/mol
Reverse Loops1.391 kcal/mol in 3' area
Reverse Dimers-1.541 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATT
AATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1121548 - 1659
NM_001079818 (ITGA6)1121548 - 1659
Exon 10 To Exon 13 (Pair 8)
Forward (1677,22)TGGTTCCCTCTCAGATTCAGTAAmplicon SizecDNA: 265 bpgenomic: 8,372
Reverse (1941,23)TCGAAACTGAACTCTTGAGGATANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops0.814 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGAA
AACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAAAACAGCGTGTGGGGCGCC
TAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATATACTGCTAACCCCGCTGGTTA
TAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGAAAAAGAAAGAAGAAAATCTGG
GCTATCCTCAAGAGTTCAGTTTCGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2651559 - 1823
NM_001079818 (ITGA6)2651559 - 1823
Exon 10 To Exon 13 (Pair 9)
Forward (1656,22)TTCCTACCCTGATGTTGCTGTTAmplicon SizecDNA: 275 bpgenomic: 8,382
Reverse (1930,22)CTCTTGAGGATAGCCCAGATTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops1.001 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceTTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCG
GCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCA
GAAAACAGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATA
TACTGCTAACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGA
AAAAGAAAGAAGAAAATCTGGGCTATCCTCAAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2751538 - 1812
NM_001079818 (ITGA6)2751538 - 1812
Exon 10 To Exon 11 (Pair 4)
Forward (1646,23)TTGATCGAAATTCCTACCCTGATAmplicon SizecDNA: 128 bpgenomic: 3,255
Reverse (1773,21)GCGGAGGTCAATTCTGTTAGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.871 kcal/mol
Forward Dimers-1.402 kcal/mol
Reverse Loops1.391 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTT
TCAGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTG
ACCTCCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1281528 - 1655
NM_001079818 (ITGA6)1281528 - 1655
Exon 10 To Exon 13 (Pair 10)
Forward (1669,21)GTTGCTGTTGGTTCCCTCTCAAmplicon SizecDNA: 275 bpgenomic: 8,382
Reverse (1943,23)TTTCGAAACTGAACTCTTGAGGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops0.814 kcal/mol in 3' area
Reverse Dimers-2.492 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAAT
ATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAAAACAGCGTGT
GGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATATACTGCTAACCCC
GCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGAAAAAGAAAGAAGA
AAATCTGGGCTATCCTCAAGAGTTCAGTTTCGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2751551 - 1825
NM_001079818 (ITGA6)2751551 - 1825
Exon 10 To Exon 13 (Pair 11)
Forward (1670,21)TTGCTGTTGGTTCCCTCTCAGAmplicon SizecDNA: 261 bpgenomic: 8,368
Reverse (1930,22)CTCTTGAGGATAGCCCAGATTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.001 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAATA
TTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAAAACAGCGTGTG
GGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATATACTGCTAACCCCG
CTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGAAAAAGAAAGAAGAA
AATCTGGGCTATCCTCAAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2611552 - 1812
NM_001079818 (ITGA6)2611552 - 1812
Exon 10 To Exon 13 (Pair 12)
Forward (1656,22)TTCCTACCCTGATGTTGCTGTTAmplicon SizecDNA: 288 bpgenomic: 8,395
Reverse (1943,23)TTTCGAAACTGAACTCTTGAGGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops0.814 kcal/mol in 3' area
Reverse Dimers-2.492 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceTTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCG
GCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCA
GAAAACAGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATA
TACTGCTAACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGA
AAAAGAAAGAAGAAAATCTGGGCTATCCTCAAGAGTTCAGTTTCGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2881538 - 1825
NM_001079818 (ITGA6)2881538 - 1825
Exon 10 To Exon 11 (Pair 5)
Forward (1654,22)AATTCCTACCCTGATGTTGCTGAmplicon SizecDNA: 124 bpgenomic: 3,251
Reverse (1777,21)TCTGGCGGAGGTCAATTCTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol
Forward Dimers-0.128 kcal/mol
Reverse Loops1.391 kcal/mol in 3' area
Reverse Dimers-1.541 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCC
CGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGC
CAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1241536 - 1659
NM_001079818 (ITGA6)1241536 - 1659
Exon 10 To Exon 11 (Pair 6)
Forward (1643,22)ACCTTGATCGAAATTCCTACCCAmplicon SizecDNA: 132 bpgenomic: 3,259
Reverse (1774,21)GGCGGAGGTCAATTCTGTTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.871 kcal/mol
Forward Dimers-1.402 kcal/mol
Reverse Loops1.391 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceACCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTA
TTTTCAGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAA
TTGACCTCCGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1321525 - 1656
NM_001079818 (ITGA6)1321525 - 1656
Exon 10 To Exon 13 (Pair 13)
Forward (1662,21)CCCTGATGTTGCTGTTGGTTCAmplicon SizecDNA: 282 bpgenomic: 8,389
Reverse (1943,23)TTTCGAAACTGAACTCTTGAGGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.385 kcal/mol in 3' area
Forward Dimers0.044 kcal/mol
Reverse Loops0.814 kcal/mol in 3' area
Reverse Dimers-2.492 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceCCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGT
GATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAAAAC
AGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATATACTGC
TAACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGAAAAAGA
AAGAAGAAAATCTGGGCTATCCTCAAGAGTTCAGTTTCGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2821544 - 1825
NM_001079818 (ITGA6)2821544 - 1825
Exon 10 To Exon 11 (Pair 7)
Forward (1678,22)GGTTCCCTCTCAGATTCAGTAAAmplicon SizecDNA: 96 bpgenomic: 3,223
Reverse (1773,21)GCGGAGGTCAATTCTGTTAGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops1.391 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGAAA
ACCATCACAGTAACTCCTAACAGAATTGACCTCCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)961560 - 1655
NM_001079818 (ITGA6)961560 - 1655
Exon 10 To Exon 13 (Pair 14)
Forward (1679,22)GTTCCCTCTCAGATTCAGTAACAmplicon SizecDNA: 254 bpgenomic: 8,361
Reverse (1932,22)AACTCTTGAGGATAGCCCAGATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops0.814 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGAAAA
CCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAAAACAGCGTGTGGGGCGCCTA
GTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATATACTGCTAACCCCGCTGGTTATA
ATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGAAAAAGAAAGAAGAAAATCTGGGC
TATCCTCAAGAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2541561 - 1814
NM_001079818 (ITGA6)2541561 - 1814
Exon 10 To Exon 13 (Pair 15)
Forward (1677,22)TGGTTCCCTCTCAGATTCAGTAAmplicon SizecDNA: 255 bpgenomic: 8,362
Reverse (1931,22)ACTCTTGAGGATAGCCCAGATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops0.814 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGAA
AACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAAAACAGCGTGTGGGGCGCC
TAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATATACTGCTAACCCCGCTGGTTA
TAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGAAAAAGAAAGAAGAAAATCTGG
GCTATCCTCAAGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2551559 - 1813
NM_001079818 (ITGA6)2551559 - 1813
Exon 10 To Exon 13 (Pair 16)
Forward (1646,23)TTGATCGAAATTCCTACCCTGATAmplicon SizecDNA: 297 bpgenomic: 8,404
Reverse (1942,23)TTCGAAACTGAACTCTTGAGGATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.871 kcal/mol
Forward Dimers-1.402 kcal/mol
Reverse Loops0.814 kcal/mol in 3' area
Reverse Dimers-1.69 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTT
TCAGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTG
ACCTCCGCCAGAAAACAGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCT
GTTTTGAATATACTGCTAACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCACAC
TTGAAGCTGAAAAAGAAAGAAGAAAATCTGGGCTATCCTCAAGAGTTCAGTTTCGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2971528 - 1824
NM_001079818 (ITGA6)2971528 - 1824
Exon 10 To Exon 11 (Pair 8)
Forward (1678,22)GGTTCCCTCTCAGATTCAGTAAAmplicon SizecDNA: 101 bpgenomic: 3,228
Reverse (1778,21)TTCTGGCGGAGGTCAATTCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops1.391 kcal/mol in 3' area
Reverse Dimers-1.541 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGAAA
ACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1011560 - 1660
NM_001079818 (ITGA6)1011560 - 1660
Exon 10 To Exon 11 (Pair 9)
Forward (1645,22)CTTGATCGAAATTCCTACCCTGAmplicon SizecDNA: 129 bpgenomic: 3,256
Reverse (1773,21)GCGGAGGTCAATTCTGTTAGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.871 kcal/mol
Forward Dimers-1.402 kcal/mol
Reverse Loops1.391 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATT
TTCAGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATT
GACCTCCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1291527 - 1655
NM_001079818 (ITGA6)1291527 - 1655
Exon 10 To Exon 11 (Pair 10)
Forward (1664,21)CTGATGTTGCTGTTGGTTCCCAmplicon SizecDNA: 113 bpgenomic: 3,240
Reverse (1776,21)CTGGCGGAGGTCAATTCTGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.15 kcal/mol in 3' area
Forward Dimers0.044 kcal/mol
Reverse Loops1.391 kcal/mol in 3' area
Reverse Dimers-0.931 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGA
TTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1131546 - 1658
NM_001079818 (ITGA6)1131546 - 1658
Exon 10 To Exon 13 (Pair 17)
Forward (1668,21)TGTTGCTGTTGGTTCCCTCTCAmplicon SizecDNA: 264 bpgenomic: 8,371
Reverse (1931,22)ACTCTTGAGGATAGCCCAGATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops0.814 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceTGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAA
TATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAAAACAGCGTG
TGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATATACTGCTAACCC
CGCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGAAAAAGAAAGAAG
AAAATCTGGGCTATCCTCAAGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2641550 - 1813
NM_001079818 (ITGA6)2641550 - 1813
Exon 10 To Exon 13 (Pair 18)
Forward (1655,22)ATTCCTACCCTGATGTTGCTGTAmplicon SizecDNA: 276 bpgenomic: 8,383
Reverse (1930,22)CTCTTGAGGATAGCCCAGATTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops1.001 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCC
GGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCC
AGAAAACAGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAAT
ATACTGCTAACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTG
AAAAAGAAAGAAGAAAATCTGGGCTATCCTCAAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2761537 - 1812
NM_001079818 (ITGA6)2761537 - 1812
Exon 10 To Exon 11 (Pair 11)
Forward (1668,21)TGTTGCTGTTGGTTCCCTCTCAmplicon SizecDNA: 111 bpgenomic: 3,238
Reverse (1778,21)TTCTGGCGGAGGTCAATTCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops1.391 kcal/mol in 3' area
Reverse Dimers-1.541 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceTGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAA
TATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1111550 - 1660
NM_001079818 (ITGA6)1111550 - 1660
Exon 10 To Exon 13 (Pair 19)
Forward (1646,23)TTGATCGAAATTCCTACCCTGATAmplicon SizecDNA: 298 bpgenomic: 8,405
Reverse (1943,23)TTTCGAAACTGAACTCTTGAGGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.871 kcal/mol
Forward Dimers-1.402 kcal/mol
Reverse Loops0.814 kcal/mol in 3' area
Reverse Dimers-2.492 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTT
TCAGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTG
ACCTCCGCCAGAAAACAGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCT
GTTTTGAATATACTGCTAACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCACAC
TTGAAGCTGAAAAAGAAAGAAGAAAATCTGGGCTATCCTCAAGAGTTCAGTTTCGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2981528 - 1825
NM_001079818 (ITGA6)2981528 - 1825
Exon 10 To Exon 13 (Pair 20)
Forward (1652,22)GAAATTCCTACCCTGATGTTGCAmplicon SizecDNA: 290 bpgenomic: 8,397
Reverse (1941,23)TCGAAACTGAACTCTTGAGGATANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol in 3' area
Forward Dimers-1.026 kcal/mol
Reverse Loops0.814 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGAT
CCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCC
GCCAGAAAACAGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTG
AATATACTGCTAACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAAG
CTGAAAAAGAAAGAAGAAAATCTGGGCTATCCTCAAGAGTTCAGTTTCGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2901534 - 1823
NM_001079818 (ITGA6)2901534 - 1823
Exon 10 To Exon 13 (Pair 21)
Forward (1658,21)CCTACCCTGATGTTGCTGTTGAmplicon SizecDNA: 286 bpgenomic: 8,393
Reverse (1943,23)TTTCGAAACTGAACTCTTGAGGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops0.814 kcal/mol in 3' area
Reverse Dimers-2.492 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGC
CTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGA
AAACAGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATATA
CTGCTAACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGAAA
AAGAAAGAAGAAAATCTGGGCTATCCTCAAGAGTTCAGTTTCGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2861540 - 1825
NM_001079818 (ITGA6)2861540 - 1825
Exon 10 To Exon 13 (Pair 22)
Forward (1638,22)CATGGACCTTGATCGAAATTCCAmplicon SizecDNA: 295 bpgenomic: 8,402
Reverse (1932,22)AACTCTTGAGGATAGCCCAGATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.871 kcal/mol in 3' area
Forward Dimers-1.402 kcal/mol
Reverse Loops0.814 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceCATGGACCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGT
AACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAA
CAGAATTGACCTCCGCCAGAAAACAGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGT
TAAATCCTGTTTTGAATATACTGCTAACCCCGCTGGTTATAATCCTTCAATATCAATTGT
GGGCACACTTGAAGCTGAAAAAGAAAGAAGAAAATCTGGGCTATCCTCAAGAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2951520 - 1814
NM_001079818 (ITGA6)2951520 - 1814
Exon 10 To Exon 13 (Pair 23)
Forward (1652,22)GAAATTCCTACCCTGATGTTGCAmplicon SizecDNA: 281 bpgenomic: 8,388
Reverse (1932,22)AACTCTTGAGGATAGCCCAGATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol in 3' area
Forward Dimers-1.026 kcal/mol
Reverse Loops0.814 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGAT
CCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCC
GCCAGAAAACAGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTG
AATATACTGCTAACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAAG
CTGAAAAAGAAAGAAGAAAATCTGGGCTATCCTCAAGAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2811534 - 1814
NM_001079818 (ITGA6)2811534 - 1814
Exon 10 To Exon 13 (Pair 24)
Forward (1651,22)CGAAATTCCTACCCTGATGTTGAmplicon SizecDNA: 293 bpgenomic: 8,400
Reverse (1943,23)TTTCGAAACTGAACTCTTGAGGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol in 3' area
Forward Dimers-1.026 kcal/mol
Reverse Loops0.814 kcal/mol in 3' area
Reverse Dimers-2.492 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGA
TCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTC
CGCCAGAAAACAGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTT
GAATATACTGCTAACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAA
GCTGAAAAAGAAAGAAGAAAATCTGGGCTATCCTCAAGAGTTCAGTTTCGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2931533 - 1825
NM_001079818 (ITGA6)2931533 - 1825
Exon 10 To Exon 13 (Pair 25)
Forward (1654,22)AATTCCTACCCTGATGTTGCTGAmplicon SizecDNA: 279 bpgenomic: 8,386
Reverse (1932,22)AACTCTTGAGGATAGCCCAGATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol
Forward Dimers-0.128 kcal/mol
Reverse Loops0.814 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCC
CGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGC
CAGAAAACAGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAA
TATACTGCTAACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAAGCT
GAAAAAGAAAGAAGAAAATCTGGGCTATCCTCAAGAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2791536 - 1814
NM_001079818 (ITGA6)2791536 - 1814
Exon 10 To Exon 11 (Pair 12)
Forward (1651,22)CGAAATTCCTACCCTGATGTTGAmplicon SizecDNA: 127 bpgenomic: 3,254
Reverse (1777,21)TCTGGCGGAGGTCAATTCTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol in 3' area
Forward Dimers-1.026 kcal/mol
Reverse Loops1.391 kcal/mol in 3' area
Reverse Dimers-1.541 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGA
TCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTC
CGCCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1271533 - 1659
NM_001079818 (ITGA6)1271533 - 1659
Exon 10 To Exon 11 (Pair 13)
Forward (1649,23)ATCGAAATTCCTACCCTGATGTTAmplicon SizecDNA: 126 bpgenomic: 3,253
Reverse (1774,21)GGCGGAGGTCAATTCTGTTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol in 3' area
Forward Dimers-1.402 kcal/mol
Reverse Loops1.391 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCA
GATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACC
TCCGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1261531 - 1656
NM_001079818 (ITGA6)1261531 - 1656
Exon 10 To Exon 13 (Pair 26)
Forward (1651,22)CGAAATTCCTACCCTGATGTTGAmplicon SizecDNA: 280 bpgenomic: 8,387
Reverse (1930,22)CTCTTGAGGATAGCCCAGATTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol in 3' area
Forward Dimers-1.026 kcal/mol
Reverse Loops1.001 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGA
TCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTC
CGCCAGAAAACAGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTT
GAATATACTGCTAACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAA
GCTGAAAAAGAAAGAAGAAAATCTGGGCTATCCTCAAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2801533 - 1812
NM_001079818 (ITGA6)2801533 - 1812
Exon 10 To Exon 13 (Pair 27)
Forward (1676,22)TTGGTTCCCTCTCAGATTCAGTAmplicon SizecDNA: 255 bpgenomic: 8,362
Reverse (1930,22)CTCTTGAGGATAGCCCAGATTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops1.001 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGA
AAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAAAACAGCGTGTGGGGCGC
CTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATATACTGCTAACCCCGCTGGTT
ATAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGAAAAAGAAAGAAGAAAATCTG
GGCTATCCTCAAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2551558 - 1812
NM_001079818 (ITGA6)2551558 - 1812
Exon 10 To Exon 11 (Pair 14)
Forward (1652,22)GAAATTCCTACCCTGATGTTGCAmplicon SizecDNA: 123 bpgenomic: 3,250
Reverse (1774,21)GGCGGAGGTCAATTCTGTTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol in 3' area
Forward Dimers-1.026 kcal/mol
Reverse Loops1.391 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGAT
CCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCC
GCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1231534 - 1656
NM_001079818 (ITGA6)1231534 - 1656
Exon 10 To Exon 11 (Pair 15)
Forward (1666,21)GATGTTGCTGTTGGTTCCCTCAmplicon SizecDNA: 109 bpgenomic: 3,236
Reverse (1774,21)GGCGGAGGTCAATTCTGTTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol in 3' area
Forward Dimers0.044 kcal/mol
Reverse Loops1.391 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATT
AATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1091548 - 1656
NM_001079818 (ITGA6)1091548 - 1656
Exon 10 To Exon 13 (Pair 28)
Forward (1669,21)GTTGCTGTTGGTTCCCTCTCAAmplicon SizecDNA: 263 bpgenomic: 8,370
Reverse (1931,22)ACTCTTGAGGATAGCCCAGATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops0.814 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAAT
ATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAAAACAGCGTGT
GGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATATACTGCTAACCCC
GCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGAAAAAGAAAGAAGA
AAATCTGGGCTATCCTCAAGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2631551 - 1813
NM_001079818 (ITGA6)2631551 - 1813
Exon 10 To Exon 11 (Pair 16)
Forward (1655,22)ATTCCTACCCTGATGTTGCTGTAmplicon SizecDNA: 123 bpgenomic: 3,250
Reverse (1777,21)TCTGGCGGAGGTCAATTCTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops1.391 kcal/mol in 3' area
Reverse Dimers-1.541 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCC
GGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCC
AGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1231537 - 1659
NM_001079818 (ITGA6)1231537 - 1659
Exon 10 To Exon 13 (Pair 29)
Forward (1668,21)TGTTGCTGTTGGTTCCCTCTCAmplicon SizecDNA: 276 bpgenomic: 8,383
Reverse (1943,23)TTTCGAAACTGAACTCTTGAGGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops0.814 kcal/mol in 3' area
Reverse Dimers-2.492 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceTGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAA
TATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAAAACAGCGTG
TGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATATACTGCTAACCC
CGCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGAAAAAGAAAGAAG
AAAATCTGGGCTATCCTCAAGAGTTCAGTTTCGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2761550 - 1825
NM_001079818 (ITGA6)2761550 - 1825
Exon 10 To Exon 13 (Pair 30)
Forward (1663,21)CCTGATGTTGCTGTTGGTTCCAmplicon SizecDNA: 280 bpgenomic: 8,387
Reverse (1942,23)TTCGAAACTGAACTCTTGAGGATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.385 kcal/mol in 3' area
Forward Dimers0.044 kcal/mol
Reverse Loops0.814 kcal/mol in 3' area
Reverse Dimers-1.69 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTG
ATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAAAACA
GCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATATACTGCT
AACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGAAAAAGAA
AGAAGAAAATCTGGGCTATCCTCAAGAGTTCAGTTTCGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2801545 - 1824
NM_001079818 (ITGA6)2801545 - 1824
Exon 10 To Exon 11 (Pair 17)
Forward (1642,22)GACCTTGATCGAAATTCCTACCAmplicon SizecDNA: 132 bpgenomic: 3,259
Reverse (1773,21)GCGGAGGTCAATTCTGTTAGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.871 kcal/mol
Forward Dimers-1.402 kcal/mol
Reverse Loops1.391 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceGACCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACT
ATTTTCAGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGA
ATTGACCTCCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1321524 - 1655
NM_001079818 (ITGA6)1321524 - 1655
Exon 10 To Exon 11 (Pair 18)
Forward (1651,22)CGAAATTCCTACCCTGATGTTGAmplicon SizecDNA: 124 bpgenomic: 3,251
Reverse (1774,21)GGCGGAGGTCAATTCTGTTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol in 3' area
Forward Dimers-1.026 kcal/mol
Reverse Loops1.391 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGA
TCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTC
CGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1241533 - 1656
NM_001079818 (ITGA6)1241533 - 1656
Exon 10 To Exon 13 (Pair 31)
Forward (1662,21)CCCTGATGTTGCTGTTGGTTCAmplicon SizecDNA: 269 bpgenomic: 8,376
Reverse (1930,22)CTCTTGAGGATAGCCCAGATTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.385 kcal/mol in 3' area
Forward Dimers0.044 kcal/mol
Reverse Loops1.001 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceCCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGT
GATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAAAAC
AGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATATACTGC
TAACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGAAAAAGA
AAGAAGAAAATCTGGGCTATCCTCAAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2691544 - 1812
NM_001079818 (ITGA6)2691544 - 1812
Exon 10 To Exon 11 (Pair 19)
Forward (1662,21)CCCTGATGTTGCTGTTGGTTCAmplicon SizecDNA: 115 bpgenomic: 3,242
Reverse (1776,21)CTGGCGGAGGTCAATTCTGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.385 kcal/mol in 3' area
Forward Dimers0.044 kcal/mol
Reverse Loops1.391 kcal/mol in 3' area
Reverse Dimers-0.931 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceCCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGT
GATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1151544 - 1658
NM_001079818 (ITGA6)1151544 - 1658
Exon 10 To Exon 11 (Pair 20)
Forward (1645,22)CTTGATCGAAATTCCTACCCTGAmplicon SizecDNA: 134 bpgenomic: 3,261
Reverse (1778,21)TTCTGGCGGAGGTCAATTCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.871 kcal/mol
Forward Dimers-1.402 kcal/mol
Reverse Loops1.391 kcal/mol in 3' area
Reverse Dimers-1.541 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATT
TTCAGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATT
GACCTCCGCCAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1341527 - 1660
NM_001079818 (ITGA6)1341527 - 1660
Exon 10 To Exon 13 (Pair 32)
Forward (1643,22)ACCTTGATCGAAATTCCTACCCAmplicon SizecDNA: 299 bpgenomic: 8,406
Reverse (1941,23)TCGAAACTGAACTCTTGAGGATANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.871 kcal/mol
Forward Dimers-1.402 kcal/mol
Reverse Loops0.814 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceACCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTA
TTTTCAGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAA
TTGACCTCCGCCAGAAAACAGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAAT
CCTGTTTTGAATATACTGCTAACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCA
CACTTGAAGCTGAAAAAGAAAGAAGAAAATCTGGGCTATCCTCAAGAGTTCAGTTTCGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2991525 - 1823
NM_001079818 (ITGA6)2991525 - 1823
Exon 10 To Exon 13 (Pair 33)
Forward (1644,22)CCTTGATCGAAATTCCTACCCTAmplicon SizecDNA: 287 bpgenomic: 8,394
Reverse (1930,22)CTCTTGAGGATAGCCCAGATTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.871 kcal/mol
Forward Dimers-1.402 kcal/mol
Reverse Loops1.001 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceCCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTAT
TTTCAGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAAT
TGACCTCCGCCAGAAAACAGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATC
CTGTTTTGAATATACTGCTAACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCAC
ACTTGAAGCTGAAAAAGAAAGAAGAAAATCTGGGCTATCCTCAAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2871526 - 1812
NM_001079818 (ITGA6)2871526 - 1812
Exon 10 To Exon 11 (Pair 21)
Forward (1666,21)GATGTTGCTGTTGGTTCCCTCAmplicon SizecDNA: 113 bpgenomic: 3,240
Reverse (1778,21)TTCTGGCGGAGGTCAATTCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol in 3' area
Forward Dimers0.044 kcal/mol
Reverse Loops1.391 kcal/mol in 3' area
Reverse Dimers-1.541 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATT
AATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1131548 - 1660
NM_001079818 (ITGA6)1131548 - 1660
Exon 10 To Exon 11 (Pair 22)
Forward (1679,22)GTTCCCTCTCAGATTCAGTAACAmplicon SizecDNA: 100 bpgenomic: 3,227
Reverse (1778,21)TTCTGGCGGAGGTCAATTCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops1.391 kcal/mol in 3' area
Reverse Dimers-1.541 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGAAAA
CCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 10 To Exon 13 (Pair 34)
Forward (1649,23)ATCGAAATTCCTACCCTGATGTTAmplicon SizecDNA: 294 bpgenomic: 8,401
Reverse (1942,23)TTCGAAACTGAACTCTTGAGGATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol in 3' area
Forward Dimers-1.402 kcal/mol
Reverse Loops0.814 kcal/mol in 3' area
Reverse Dimers-1.69 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCA
GATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACC
TCCGCCAGAAAACAGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTT
TTGAATATACTGCTAACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTG
AAGCTGAAAAAGAAAGAAGAAAATCTGGGCTATCCTCAAGAGTTCAGTTTCGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2941531 - 1824
NM_001079818 (ITGA6)2941531 - 1824
Exon 10 To Exon 11 (Pair 23)
Forward (1676,22)TTGGTTCCCTCTCAGATTCAGTAmplicon SizecDNA: 99 bpgenomic: 3,226
Reverse (1774,21)GGCGGAGGTCAATTCTGTTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops1.391 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGA
AAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)991558 - 1656
NM_001079818 (ITGA6)991558 - 1656
Exon 10 To Exon 11 (Pair 24)
Forward (1649,23)ATCGAAATTCCTACCCTGATGTTAmplicon SizecDNA: 128 bpgenomic: 3,255
Reverse (1776,21)CTGGCGGAGGTCAATTCTGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol in 3' area
Forward Dimers-1.402 kcal/mol
Reverse Loops1.391 kcal/mol in 3' area
Reverse Dimers-0.931 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCA
GATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACC
TCCGCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1281531 - 1658
NM_001079818 (ITGA6)1281531 - 1658
Exon 10 To Exon 13 (Pair 35)
Forward (1668,21)TGTTGCTGTTGGTTCCCTCTCAmplicon SizecDNA: 263 bpgenomic: 8,370
Reverse (1930,22)CTCTTGAGGATAGCCCAGATTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops1.001 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceTGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAA
TATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAAAACAGCGTG
TGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATATACTGCTAACCC
CGCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGAAAAAGAAAGAAG
AAAATCTGGGCTATCCTCAAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2631550 - 1812
NM_001079818 (ITGA6)2631550 - 1812
Exon 10 To Exon 13 (Pair 36)
Forward (1666,21)GATGTTGCTGTTGGTTCCCTCAmplicon SizecDNA: 278 bpgenomic: 8,385
Reverse (1943,23)TTTCGAAACTGAACTCTTGAGGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol in 3' area
Forward Dimers0.044 kcal/mol
Reverse Loops0.814 kcal/mol in 3' area
Reverse Dimers-2.492 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATT
AATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAAAACAGCG
TGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATATACTGCTAAC
CCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGAAAAAGAAAGA
AGAAAATCTGGGCTATCCTCAAGAGTTCAGTTTCGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2781548 - 1825
NM_001079818 (ITGA6)2781548 - 1825
Exon 10 To Exon 13 (Pair 37)
Forward (1674,22)TGTTGGTTCCCTCTCAGATTCAAmplicon SizecDNA: 257 bpgenomic: 8,364
Reverse (1930,22)CTCTTGAGGATAGCCCAGATTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops1.001 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCA
GAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAAAACAGCGTGTGGGGC
GCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATATACTGCTAACCCCGCTGG
TTATAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGAAAAAGAAAGAAGAAAATC
TGGGCTATCCTCAAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2571556 - 1812
NM_001079818 (ITGA6)2571556 - 1812
Exon 10 To Exon 13 (Pair 38)
Forward (1641,22)GGACCTTGATCGAAATTCCTACAmplicon SizecDNA: 301 bpgenomic: 8,408
Reverse (1941,23)TCGAAACTGAACTCTTGAGGATANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.871 kcal/mol
Forward Dimers-1.402 kcal/mol
Reverse Loops0.814 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceGGACCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAAC
TATTTTCAGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAG
AATTGACCTCCGCCAGAAAACAGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAA
ATCCTGTTTTGAATATACTGCTAACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGG
CACACTTGAAGCTGAAAAAGAAAGAAGAAAATCTGGGCTATCCTCAAGAGTTCAGTTTCG
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)3011523 - 1823
NM_001079818 (ITGA6)3011523 - 1823
Exon 10 To Exon 13 (Pair 39)
Forward (1678,22)GGTTCCCTCTCAGATTCAGTAAAmplicon SizecDNA: 266 bpgenomic: 8,373
Reverse (1943,23)TTTCGAAACTGAACTCTTGAGGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops0.814 kcal/mol in 3' area
Reverse Dimers-2.492 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGAAA
ACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAAAACAGCGTGTGGGGCGCCT
AGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATATACTGCTAACCCCGCTGGTTAT
AATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGAAAAAGAAAGAAGAAAATCTGGG
CTATCCTCAAGAGTTCAGTTTCGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2661560 - 1825
NM_001079818 (ITGA6)2661560 - 1825
Exon 10 To Exon 11 (Pair 25)
Forward (1668,21)TGTTGCTGTTGGTTCCCTCTCAmplicon SizecDNA: 106 bpgenomic: 3,233
Reverse (1773,21)GCGGAGGTCAATTCTGTTAGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops1.391 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceTGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAA
TATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1061550 - 1655
NM_001079818 (ITGA6)1061550 - 1655
Exon 10 To Exon 13 (Pair 40)
Forward (1656,22)TTCCTACCCTGATGTTGCTGTTAmplicon SizecDNA: 286 bpgenomic: 8,393
Reverse (1941,23)TCGAAACTGAACTCTTGAGGATANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops0.814 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceTTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCG
GCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCA
GAAAACAGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATA
TACTGCTAACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGA
AAAAGAAAGAAGAAAATCTGGGCTATCCTCAAGAGTTCAGTTTCGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2861538 - 1823
NM_001079818 (ITGA6)2861538 - 1823
Exon 10 To Exon 11 (Pair 26)
Forward (1646,23)TTGATCGAAATTCCTACCCTGATAmplicon SizecDNA: 133 bpgenomic: 3,260
Reverse (1778,21)TTCTGGCGGAGGTCAATTCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.871 kcal/mol
Forward Dimers-1.402 kcal/mol
Reverse Loops1.391 kcal/mol in 3' area
Reverse Dimers-1.541 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTT
TCAGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTG
ACCTCCGCCAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1331528 - 1660
NM_001079818 (ITGA6)1331528 - 1660
Exon 10 To Exon 13 (Pair 41)
Forward (1676,22)TTGGTTCCCTCTCAGATTCAGTAmplicon SizecDNA: 267 bpgenomic: 8,374
Reverse (1942,23)TTCGAAACTGAACTCTTGAGGATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops0.814 kcal/mol in 3' area
Reverse Dimers-1.69 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGA
AAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAAAACAGCGTGTGGGGCGC
CTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATATACTGCTAACCCCGCTGGTT
ATAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGAAAAAGAAAGAAGAAAATCTG
GGCTATCCTCAAGAGTTCAGTTTCGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2671558 - 1824
NM_001079818 (ITGA6)2671558 - 1824
Exon 10 To Exon 11 (Pair 27)
Forward (1674,22)TGTTGGTTCCCTCTCAGATTCAAmplicon SizecDNA: 103 bpgenomic: 3,230
Reverse (1776,21)CTGGCGGAGGTCAATTCTGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops1.391 kcal/mol in 3' area
Reverse Dimers-0.931 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCA
GAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1031556 - 1658
NM_001079818 (ITGA6)1031556 - 1658
Exon 10 To Exon 13 (Pair 42)
Forward (1678,22)GGTTCCCTCTCAGATTCAGTAAAmplicon SizecDNA: 254 bpgenomic: 8,361
Reverse (1931,22)ACTCTTGAGGATAGCCCAGATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops0.814 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGAAA
ACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAAAACAGCGTGTGGGGCGCCT
AGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATATACTGCTAACCCCGCTGGTTAT
AATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGAAAAAGAAAGAAGAAAATCTGGG
CTATCCTCAAGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2541560 - 1813
NM_001079818 (ITGA6)2541560 - 1813
Exon 10 To Exon 11 (Pair 28)
Forward (1656,22)TTCCTACCCTGATGTTGCTGTTAmplicon SizecDNA: 123 bpgenomic: 3,250
Reverse (1778,21)TTCTGGCGGAGGTCAATTCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops1.391 kcal/mol in 3' area
Reverse Dimers-1.541 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceTTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCG
GCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCA
GAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1231538 - 1660
NM_001079818 (ITGA6)1231538 - 1660
Exon 10 To Exon 13 (Pair 43)
Forward (1642,22)GACCTTGATCGAAATTCCTACCAmplicon SizecDNA: 289 bpgenomic: 8,396
Reverse (1930,22)CTCTTGAGGATAGCCCAGATTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.871 kcal/mol
Forward Dimers-1.402 kcal/mol
Reverse Loops1.001 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceGACCTTGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACT
ATTTTCAGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGA
ATTGACCTCCGCCAGAAAACAGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAA
TCCTGTTTTGAATATACTGCTAACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGGC
ACACTTGAAGCTGAAAAAGAAAGAAGAAAATCTGGGCTATCCTCAAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2891524 - 1812
NM_001079818 (ITGA6)2891524 - 1812
Exon 10 To Exon 11 (Pair 29)
Forward (1669,21)GTTGCTGTTGGTTCCCTCTCAAmplicon SizecDNA: 108 bpgenomic: 3,235
Reverse (1776,21)CTGGCGGAGGTCAATTCTGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.391 kcal/mol in 3' area
Reverse Dimers-0.931 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAAT
ATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1081551 - 1658
NM_001079818 (ITGA6)1081551 - 1658
Exon 10 To Exon 11 (Pair 30)
Forward (1669,21)GTTGCTGTTGGTTCCCTCTCAAmplicon SizecDNA: 106 bpgenomic: 3,233
Reverse (1774,21)GGCGGAGGTCAATTCTGTTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops1.391 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAAT
ATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1061551 - 1656
NM_001079818 (ITGA6)1061551 - 1656
Exon 10 To Exon 13 (Pair 44)
Forward (1664,21)CTGATGTTGCTGTTGGTTCCCAmplicon SizecDNA: 278 bpgenomic: 8,385
Reverse (1941,23)TCGAAACTGAACTCTTGAGGATANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.15 kcal/mol in 3' area
Forward Dimers0.044 kcal/mol
Reverse Loops0.814 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGA
TTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAAAACAG
CGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATATACTGCTA
ACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGAAAAAGAAA
GAAGAAAATCTGGGCTATCCTCAAGAGTTCAGTTTCGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2781546 - 1823
NM_001079818 (ITGA6)2781546 - 1823
Exon 10 To Exon 13 (Pair 45)
Forward (1654,22)AATTCCTACCCTGATGTTGCTGAmplicon SizecDNA: 289 bpgenomic: 8,396
Reverse (1942,23)TTCGAAACTGAACTCTTGAGGATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol
Forward Dimers-0.128 kcal/mol
Reverse Loops0.814 kcal/mol in 3' area
Reverse Dimers-1.69 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCC
CGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGC
CAGAAAACAGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAA
TATACTGCTAACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAAGCT
GAAAAAGAAAGAAGAAAATCTGGGCTATCCTCAAGAGTTCAGTTTCGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2891536 - 1824
NM_001079818 (ITGA6)2891536 - 1824
Exon 10 To Exon 11 (Pair 31)
Forward (1654,22)AATTCCTACCCTGATGTTGCTGAmplicon SizecDNA: 123 bpgenomic: 3,250
Reverse (1776,21)CTGGCGGAGGTCAATTCTGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol
Forward Dimers-0.128 kcal/mol
Reverse Loops1.391 kcal/mol in 3' area
Reverse Dimers-0.931 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCC
CGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGC
CAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1231536 - 1658
NM_001079818 (ITGA6)1231536 - 1658
Exon 10 To Exon 13 (Pair 46)
Forward (1656,22)TTCCTACCCTGATGTTGCTGTTAmplicon SizecDNA: 276 bpgenomic: 8,383
Reverse (1931,22)ACTCTTGAGGATAGCCCAGATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops0.814 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceTTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCG
GCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCA
GAAAACAGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATA
TACTGCTAACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGA
AAAAGAAAGAAGAAAATCTGGGCTATCCTCAAGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2761538 - 1813
NM_001079818 (ITGA6)2761538 - 1813
Exon 10 To Exon 13 (Pair 47)
Forward (1655,22)ATTCCTACCCTGATGTTGCTGTAmplicon SizecDNA: 289 bpgenomic: 8,396
Reverse (1943,23)TTTCGAAACTGAACTCTTGAGGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops0.814 kcal/mol in 3' area
Reverse Dimers-2.492 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCC
GGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCC
AGAAAACAGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAAT
ATACTGCTAACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTG
AAAAAGAAAGAAGAAAATCTGGGCTATCCTCAAGAGTTCAGTTTCGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2891537 - 1825
NM_001079818 (ITGA6)2891537 - 1825
Exon 10 To Exon 13 (Pair 48)
Forward (1652,22)GAAATTCCTACCCTGATGTTGCAmplicon SizecDNA: 279 bpgenomic: 8,386
Reverse (1930,22)CTCTTGAGGATAGCCCAGATTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol in 3' area
Forward Dimers-1.026 kcal/mol
Reverse Loops1.001 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGAT
CCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCC
GCCAGAAAACAGCGTGTGGGGCGCCTAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTG
AATATACTGCTAACCCCGCTGGTTATAATCCTTCAATATCAATTGTGGGCACACTTGAAG
CTGAAAAAGAAAGAAGAAAATCTGGGCTATCCTCAAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2791534 - 1812
NM_001079818 (ITGA6)2791534 - 1812
Exon 10 To Exon 11 (Pair 32)
Forward (1664,21)CTGATGTTGCTGTTGGTTCCCAmplicon SizecDNA: 114 bpgenomic: 3,241
Reverse (1777,21)TCTGGCGGAGGTCAATTCTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.15 kcal/mol in 3' area
Forward Dimers0.044 kcal/mol
Reverse Loops1.391 kcal/mol in 3' area
Reverse Dimers-1.541 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGA
TTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1141546 - 1659
NM_001079818 (ITGA6)1141546 - 1659
Exon 10 To Exon 13 (Pair 49)
Forward (1679,22)GTTCCCTCTCAGATTCAGTAACAmplicon SizecDNA: 253 bpgenomic: 8,360
Reverse (1931,22)ACTCTTGAGGATAGCCCAGATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops0.814 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGAAAA
CCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAAAACAGCGTGTGGGGCGCCTA
GTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATATACTGCTAACCCCGCTGGTTATA
ATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGAAAAAGAAAGAAGAAAATCTGGGC
TATCCTCAAGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2531561 - 1813
NM_001079818 (ITGA6)2531561 - 1813
Exon 10 To Exon 13 (Pair 50)
Forward (1677,22)TGGTTCCCTCTCAGATTCAGTAAmplicon SizecDNA: 256 bpgenomic: 8,363
Reverse (1932,22)AACTCTTGAGGATAGCCCAGATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.875 kcal/mol
Forward Dimers-0.412 kcal/mol
Reverse Loops0.814 kcal/mol
Reverse Dimers-1.234 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-1.317 kcal/mol outside primersite
Amplicon SequenceTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCCGGCCTGTGATTAATATTCAGAA
AACCATCACAGTAACTCCTAACAGAATTGACCTCCGCCAGAAAACAGCGTGTGGGGCGCC
TAGTGGGATATGCCTCCAGGTTAAATCCTGTTTTGAATATACTGCTAACCCCGCTGGTTA
TAATCCTTCAATATCAATTGTGGGCACACTTGAAGCTGAAAAAGAAAGAAGAAAATCTGG
GCTATCCTCAAGAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)2561559 - 1814
NM_001079818 (ITGA6)2561559 - 1814
Exon 10 To Exon 11 (Pair 33)
Forward (1648,22)GATCGAAATTCCTACCCTGATGAmplicon SizecDNA: 126 bpgenomic: 3,253
Reverse (1773,21)GCGGAGGTCAATTCTGTTAGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.871 kcal/mol
Forward Dimers-1.402 kcal/mol
Reverse Loops1.391 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceGATCGAAATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTC
AGATCCCGGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGAC
CTCCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1261530 - 1655
NM_001079818 (ITGA6)1261530 - 1655
Exon 10 To Exon 11 (Pair 34)
Forward (1655,22)ATTCCTACCCTGATGTTGCTGTAmplicon SizecDNA: 122 bpgenomic: 3,249
Reverse (1776,21)CTGGCGGAGGTCAATTCTGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.998 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops1.391 kcal/mol in 3' area
Reverse Dimers-0.931 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceATTCCTACCCTGATGTTGCTGTTGGTTCCCTCTCAGATTCAGTAACTATTTTCAGATCCC
GGCCTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAACAGAATTGACCTCCGCC
AG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000210 (ITGA6)1221537 - 1658
NM_001079818 (ITGA6)1221537 - 1658
 

See below for some more details.

Program Output:

Loading ...