Design Results for ITGB1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 5 To Exon 7 (Pair 1)
Forward (673,22)CTCAAGCCAGAGGATATTACTCAmplicon SizecDNA: 285 bpgenomic: 3,826
Reverse (957,22)TGGTGTTGTGCTAATGTAAGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.235 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops2.083 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAGATCA
GGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGACCTC
TACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAGTCTT
GGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATTTGGC
TCATTTGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_033668 (ITGB1)285316 - 600
NM_133376 (ITGB1)285452 - 736
NM_002211 (ITGB1)285537 - 821
Exon 5 To Exon 7 (Pair 2)
Forward (676,23)AAGCCAGAGGATATTACTCAGATAmplicon SizecDNA: 272 bpgenomic: 3,813
Reverse (947,23)CTAATGTAAGGCATCACAGTCTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.235 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops0.501 kcal/mol
Reverse Dimers-0.65 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAGATCAGGG
GAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGACCTCTAC
TACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAGTCTTGGA
ACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATTTGGCTCA
TTTGTGGAAAAGACTGTGATGCCTTACATTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_033668 (ITGB1)272319 - 590
NM_133376 (ITGB1)272455 - 726
NM_002211 (ITGB1)272540 - 811
Exon 5 To Exon 7 (Pair 3)
Forward (676,23)AAGCCAGAGGATATTACTCAGATAmplicon SizecDNA: 282 bpgenomic: 3,823
Reverse (957,22)TGGTGTTGTGCTAATGTAAGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.235 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops2.083 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAGATCAGGG
GAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGACCTCTAC
TACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAGTCTTGGA
ACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATTTGGCTCA
TTTGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_033668 (ITGB1)282319 - 600
NM_133376 (ITGB1)282455 - 736
NM_002211 (ITGB1)282540 - 821
Exon 5 To Exon 7 (Pair 4)
Forward (672,22)GCTCAAGCCAGAGGATATTACTAmplicon SizecDNA: 287 bpgenomic: 3,828
Reverse (958,22)CTGGTGTTGTGCTAATGTAAGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.235 kcal/mol
Forward Dimers-1.118 kcal/mol
Reverse Loops2.432 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAGATC
AGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGACCT
CTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAGTCT
TGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATTTGG
CTCATTTGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_033668 (ITGB1)287315 - 601
NM_133376 (ITGB1)287451 - 737
NM_002211 (ITGB1)287536 - 822
Exon 5 To Exon 7 (Pair 5)
Forward (673,22)CTCAAGCCAGAGGATATTACTCAmplicon SizecDNA: 275 bpgenomic: 3,816
Reverse (947,23)CTAATGTAAGGCATCACAGTCTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.235 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops0.501 kcal/mol
Reverse Dimers-0.65 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAGATCA
GGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGACCTC
TACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAGTCTT
GGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATTTGGC
TCATTTGTGGAAAAGACTGTGATGCCTTACATTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_033668 (ITGB1)275316 - 590
NM_133376 (ITGB1)275452 - 726
NM_002211 (ITGB1)275537 - 811
Exon 5 To Exon 7 (Pair 6)
Forward (672,22)GCTCAAGCCAGAGGATATTACTAmplicon SizecDNA: 286 bpgenomic: 3,827
Reverse (957,22)TGGTGTTGTGCTAATGTAAGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.235 kcal/mol
Forward Dimers-1.118 kcal/mol
Reverse Loops2.083 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAGATC
AGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGACCT
CTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAGTCT
TGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATTTGG
CTCATTTGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_033668 (ITGB1)286315 - 600
NM_133376 (ITGB1)286451 - 736
NM_002211 (ITGB1)286536 - 821
Exon 5 To Exon 7 (Pair 7)
Forward (663,21)AGCAGAGAAGCTCAAGCCAGAAmplicon SizecDNA: 296 bpgenomic: 3,837
Reverse (958,22)CTGGTGTTGTGCTAATGTAAGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.422 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops2.432 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceAGCAGAGAAGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCG
ATTAAGATCAGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCC
CATTGACCTCTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGT
AAAAAGTCTTGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAAT
TGGATTTGGCTCATTTGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)296442 - 737
NM_033668 (ITGB1)296306 - 601
NM_002211 (ITGB1)296527 - 822
Exon 5 To Exon 7 (Pair 8)
Forward (669,22)GAAGCTCAAGCCAGAGGATATTAmplicon SizecDNA: 289 bpgenomic: 3,830
Reverse (957,22)TGGTGTTGTGCTAATGTAAGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.049 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops2.083 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceGAAGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAG
ATCAGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGA
CCTCTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAG
TCTTGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATT
TGGCTCATTTGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)289448 - 736
NM_033668 (ITGB1)289312 - 600
NM_002211 (ITGB1)289533 - 821
Exon 5 To Exon 7 (Pair 9)
Forward (671,22)AGCTCAAGCCAGAGGATATTACAmplicon SizecDNA: 288 bpgenomic: 3,829
Reverse (958,22)CTGGTGTTGTGCTAATGTAAGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.049 kcal/mol
Forward Dimers-1.83 kcal/mol
Reverse Loops2.432 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceAGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAGAT
CAGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGACC
TCTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAGTC
TTGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATTTG
GCTCATTTGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)288450 - 737
NM_033668 (ITGB1)288314 - 601
NM_002211 (ITGB1)288535 - 822
Exon 5 To Exon 7 (Pair 10)
Forward (676,23)AAGCCAGAGGATATTACTCAGATAmplicon SizecDNA: 283 bpgenomic: 3,824
Reverse (958,22)CTGGTGTTGTGCTAATGTAAGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.235 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops2.432 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAGATCAGGG
GAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGACCTCTAC
TACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAGTCTTGGA
ACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATTTGGCTCA
TTTGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)283455 - 737
NM_033668 (ITGB1)283319 - 601
NM_002211 (ITGB1)283540 - 822
Exon 5 To Exon 7 (Pair 11)
Forward (673,22)CTCAAGCCAGAGGATATTACTCAmplicon SizecDNA: 286 bpgenomic: 3,827
Reverse (958,22)CTGGTGTTGTGCTAATGTAAGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.235 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops2.432 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAGATCA
GGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGACCTC
TACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAGTCTT
GGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATTTGGC
TCATTTGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)286452 - 737
NM_033668 (ITGB1)286316 - 601
NM_002211 (ITGB1)286537 - 822
Exon 5 To Exon 7 (Pair 12)
Forward (678,22)GCCAGAGGATATTACTCAGATCAmplicon SizecDNA: 281 bpgenomic: 3,822
Reverse (958,22)CTGGTGTTGTGCTAATGTAAGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.235 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops2.432 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAGATCAGGGGA
GCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGACCTCTACTA
CCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAGTCTTGGAAC
AGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATTTGGCTCATT
TGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)281457 - 737
NM_033668 (ITGB1)281321 - 601
NM_002211 (ITGB1)281542 - 822
Exon 5 To Exon 7 (Pair 13)
Forward (678,22)GCCAGAGGATATTACTCAGATCAmplicon SizecDNA: 280 bpgenomic: 3,821
Reverse (957,22)TGGTGTTGTGCTAATGTAAGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.235 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops2.083 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAGATCAGGGGA
GCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGACCTCTACTA
CCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAGTCTTGGAAC
AGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATTTGGCTCATT
TGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)280457 - 736
NM_033668 (ITGB1)280321 - 600
NM_002211 (ITGB1)280542 - 821
Exon 5 To Exon 7 (Pair 14)
Forward (675,22)CAAGCCAGAGGATATTACTCAGAmplicon SizecDNA: 283 bpgenomic: 3,824
Reverse (957,22)TGGTGTTGTGCTAATGTAAGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.235 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops2.083 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAGATCAGG
GGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGACCTCTA
CTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAGTCTTGG
AACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATTTGGCTC
ATTTGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)283454 - 736
NM_033668 (ITGB1)283318 - 600
NM_002211 (ITGB1)283539 - 821
Exon 5 To Exon 7 (Pair 15)
Forward (668,22)AGAAGCTCAAGCCAGAGGATATAmplicon SizecDNA: 291 bpgenomic: 3,832
Reverse (958,22)CTGGTGTTGTGCTAATGTAAGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.049 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops2.432 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceAGAAGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAA
GATCAGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTG
ACCTCTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAA
GTCTTGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGAT
TTGGCTCATTTGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)291447 - 737
NM_033668 (ITGB1)291311 - 601
NM_002211 (ITGB1)291532 - 822
Exon 5 To Exon 7 (Pair 16)
Forward (669,22)GAAGCTCAAGCCAGAGGATATTAmplicon SizecDNA: 290 bpgenomic: 3,831
Reverse (958,22)CTGGTGTTGTGCTAATGTAAGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.049 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops2.432 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceGAAGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAG
ATCAGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGA
CCTCTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAG
TCTTGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATT
TGGCTCATTTGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)290448 - 737
NM_033668 (ITGB1)290312 - 601
NM_002211 (ITGB1)290533 - 822
Exon 5 To Exon 7 (Pair 17)
Forward (663,21)AGCAGAGAAGCTCAAGCCAGAAmplicon SizecDNA: 295 bpgenomic: 3,836
Reverse (957,22)TGGTGTTGTGCTAATGTAAGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.422 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops2.083 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceAGCAGAGAAGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCG
ATTAAGATCAGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCC
CATTGACCTCTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGT
AAAAAGTCTTGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAAT
TGGATTTGGCTCATTTGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)295442 - 736
NM_033668 (ITGB1)295306 - 600
NM_002211 (ITGB1)295527 - 821
Exon 5 To Exon 7 (Pair 18)
Forward (667,21)GAGAAGCTCAAGCCAGAGGATAmplicon SizecDNA: 291 bpgenomic: 3,832
Reverse (957,22)TGGTGTTGTGCTAATGTAAGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.049 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops2.083 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceGAGAAGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTA
AGATCAGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATT
GACCTCTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAA
AGTCTTGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGA
TTTGGCTCATTTGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)291446 - 736
NM_033668 (ITGB1)291310 - 600
NM_002211 (ITGB1)291531 - 821
Exon 5 To Exon 7 (Pair 19)
Forward (668,22)AGAAGCTCAAGCCAGAGGATATAmplicon SizecDNA: 290 bpgenomic: 3,831
Reverse (957,22)TGGTGTTGTGCTAATGTAAGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.049 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops2.083 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceAGAAGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAA
GATCAGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTG
ACCTCTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAA
GTCTTGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGAT
TTGGCTCATTTGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)290447 - 736
NM_033668 (ITGB1)290311 - 600
NM_002211 (ITGB1)290532 - 821
Exon 5 To Exon 7 (Pair 20)
Forward (669,22)GAAGCTCAAGCCAGAGGATATTAmplicon SizecDNA: 279 bpgenomic: 3,820
Reverse (947,23)CTAATGTAAGGCATCACAGTCTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.049 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops0.501 kcal/mol
Reverse Dimers-0.65 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceGAAGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAG
ATCAGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGA
CCTCTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAG
TCTTGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATT
TGGCTCATTTGTGGAAAAGACTGTGATGCCTTACATTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)279448 - 726
NM_033668 (ITGB1)279312 - 590
NM_002211 (ITGB1)279533 - 811
Exon 5 To Exon 7 (Pair 21)
Forward (675,22)CAAGCCAGAGGATATTACTCAGAmplicon SizecDNA: 284 bpgenomic: 3,825
Reverse (958,22)CTGGTGTTGTGCTAATGTAAGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.235 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops2.432 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAGATCAGG
GGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGACCTCTA
CTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAGTCTTGG
AACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATTTGGCTC
ATTTGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)284454 - 737
NM_033668 (ITGB1)284318 - 601
NM_002211 (ITGB1)284539 - 822
Exon 5 To Exon 7 (Pair 22)
Forward (666,21)AGAGAAGCTCAAGCCAGAGGAAmplicon SizecDNA: 282 bpgenomic: 3,823
Reverse (947,23)CTAATGTAAGGCATCACAGTCTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.049 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops0.501 kcal/mol
Reverse Dimers-0.65 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceAGAGAAGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATT
AAGATCAGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCAT
TGACCTCTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAA
AAGTCTTGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGG
ATTTGGCTCATTTGTGGAAAAGACTGTGATGCCTTACATTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)282445 - 726
NM_033668 (ITGB1)282309 - 590
NM_002211 (ITGB1)282530 - 811
Exon 5 To Exon 7 (Pair 23)
Forward (678,22)GCCAGAGGATATTACTCAGATCAmplicon SizecDNA: 270 bpgenomic: 3,811
Reverse (947,23)CTAATGTAAGGCATCACAGTCTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.235 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops0.501 kcal/mol
Reverse Dimers-0.65 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAGATCAGGGGA
GCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGACCTCTACTA
CCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAGTCTTGGAAC
AGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATTTGGCTCATT
TGTGGAAAAGACTGTGATGCCTTACATTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)270457 - 726
NM_033668 (ITGB1)270321 - 590
NM_002211 (ITGB1)270542 - 811
Exon 5 To Exon 7 (Pair 24)
Forward (672,22)GCTCAAGCCAGAGGATATTACTAmplicon SizecDNA: 276 bpgenomic: 3,817
Reverse (947,23)CTAATGTAAGGCATCACAGTCTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.235 kcal/mol
Forward Dimers-1.118 kcal/mol
Reverse Loops0.501 kcal/mol
Reverse Dimers-0.65 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAGATC
AGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGACCT
CTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAGTCT
TGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATTTGG
CTCATTTGTGGAAAAGACTGTGATGCCTTACATTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)276451 - 726
NM_033668 (ITGB1)276315 - 590
NM_002211 (ITGB1)276536 - 811
Exon 5 To Exon 7 (Pair 25)
Forward (666,21)AGAGAAGCTCAAGCCAGAGGAAmplicon SizecDNA: 293 bpgenomic: 3,834
Reverse (958,22)CTGGTGTTGTGCTAATGTAAGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.049 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops2.432 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceAGAGAAGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATT
AAGATCAGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCAT
TGACCTCTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAA
AAGTCTTGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGG
ATTTGGCTCATTTGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)293445 - 737
NM_033668 (ITGB1)293309 - 601
NM_002211 (ITGB1)293530 - 822
Exon 5 To Exon 7 (Pair 26)
Forward (671,22)AGCTCAAGCCAGAGGATATTACAmplicon SizecDNA: 287 bpgenomic: 3,828
Reverse (957,22)TGGTGTTGTGCTAATGTAAGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.049 kcal/mol
Forward Dimers-1.83 kcal/mol
Reverse Loops2.083 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceAGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAGAT
CAGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGACC
TCTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAGTC
TTGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATTTG
GCTCATTTGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)287450 - 736
NM_033668 (ITGB1)287314 - 600
NM_002211 (ITGB1)287535 - 821
Exon 5 To Exon 7 (Pair 27)
Forward (671,22)AGCTCAAGCCAGAGGATATTACAmplicon SizecDNA: 277 bpgenomic: 3,818
Reverse (947,23)CTAATGTAAGGCATCACAGTCTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.049 kcal/mol
Forward Dimers-1.83 kcal/mol
Reverse Loops0.501 kcal/mol
Reverse Dimers-0.65 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceAGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAGAT
CAGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGACC
TCTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAGTC
TTGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATTTG
GCTCATTTGTGGAAAAGACTGTGATGCCTTACATTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)277450 - 726
NM_033668 (ITGB1)277314 - 590
NM_002211 (ITGB1)277535 - 811
Exon 5 To Exon 7 (Pair 28)
Forward (667,21)GAGAAGCTCAAGCCAGAGGATAmplicon SizecDNA: 281 bpgenomic: 3,822
Reverse (947,23)CTAATGTAAGGCATCACAGTCTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.049 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops0.501 kcal/mol
Reverse Dimers-0.65 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceGAGAAGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTA
AGATCAGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATT
GACCTCTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAA
AGTCTTGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGA
TTTGGCTCATTTGTGGAAAAGACTGTGATGCCTTACATTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)281446 - 726
NM_033668 (ITGB1)281310 - 590
NM_002211 (ITGB1)281531 - 811
Exon 5 To Exon 7 (Pair 29)
Forward (663,21)AGCAGAGAAGCTCAAGCCAGAAmplicon SizecDNA: 285 bpgenomic: 3,826
Reverse (947,23)CTAATGTAAGGCATCACAGTCTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.422 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops0.501 kcal/mol
Reverse Dimers-0.65 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceAGCAGAGAAGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCG
ATTAAGATCAGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCC
CATTGACCTCTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGT
AAAAAGTCTTGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAAT
TGGATTTGGCTCATTTGTGGAAAAGACTGTGATGCCTTACATTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)285442 - 726
NM_033668 (ITGB1)285306 - 590
NM_002211 (ITGB1)285527 - 811
Exon 5 To Exon 7 (Pair 30)
Forward (666,21)AGAGAAGCTCAAGCCAGAGGAAmplicon SizecDNA: 292 bpgenomic: 3,833
Reverse (957,22)TGGTGTTGTGCTAATGTAAGGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.049 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops2.083 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceAGAGAAGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATT
AAGATCAGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCAT
TGACCTCTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAA
AAGTCTTGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGG
ATTTGGCTCATTTGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)292445 - 736
NM_033668 (ITGB1)292309 - 600
NM_002211 (ITGB1)292530 - 821
Exon 5 To Exon 7 (Pair 31)
Forward (667,21)GAGAAGCTCAAGCCAGAGGATAmplicon SizecDNA: 292 bpgenomic: 3,833
Reverse (958,22)CTGGTGTTGTGCTAATGTAAGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.049 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops2.432 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceGAGAAGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTA
AGATCAGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATT
GACCTCTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAA
AGTCTTGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGA
TTTGGCTCATTTGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)292446 - 737
NM_033668 (ITGB1)292310 - 601
NM_002211 (ITGB1)292531 - 822
Exon 5 To Exon 7 (Pair 32)
Forward (668,22)AGAAGCTCAAGCCAGAGGATATAmplicon SizecDNA: 280 bpgenomic: 3,821
Reverse (947,23)CTAATGTAAGGCATCACAGTCTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.049 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops0.501 kcal/mol
Reverse Dimers-0.65 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceAGAAGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAA
GATCAGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTG
ACCTCTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAA
GTCTTGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGAT
TTGGCTCATTTGTGGAAAAGACTGTGATGCCTTACATTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)280447 - 726
NM_033668 (ITGB1)280311 - 590
NM_002211 (ITGB1)280532 - 811
Exon 5 To Exon 7 (Pair 33)
Forward (675,22)CAAGCCAGAGGATATTACTCAGAmplicon SizecDNA: 273 bpgenomic: 3,814
Reverse (947,23)CTAATGTAAGGCATCACAGTCTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.235 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops0.501 kcal/mol
Reverse Dimers-0.65 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.252 kcal/mol outside primersite
Amplicon SequenceCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAGATCAGG
GGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGACCTCTA
CTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAGTCTTGG
AACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATTTGGCTC
ATTTGTGGAAAAGACTGTGATGCCTTACATTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_133376 (ITGB1)273454 - 726
NM_033668 (ITGB1)273318 - 590
NM_002211 (ITGB1)273539 - 811
Exon 16 To Exon 18 (Pair 1)
Forward (2584,22)ATTGGCCTTGCATTACTGCTGAAmplicon SizecDNA: 301 bpgenomic: 6,952
Reverse (2884,23)GGAAATTGCTACTTTGCATTCAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.703 kcal/mol in 3' area
Forward Dimers-2.61 kcal/mol
Reverse Loops1.023 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAG
TTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCGATT
TACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTCTAA
ATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAACTGTGGTCAATCCGAAGTAT
GAGGGAAAATGAGTACTGCCCGTGCAAATCCCACAACACTGAATGCAAAGTAGCAATTTC
C
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)3012227 - 2527
NM_133376 (ITGB1)2202363 - 2582
NM_002211 (ITGB1)2202448 - 2667
Exon 16 To Exon 18 (Pair 2)
Forward (2589,22)CCTTGCATTACTGCTGATATGGAmplicon SizecDNA: 213 bpgenomic: 6,864
Reverse (2801,23)GTTACGGCACTCTTATAAATAGGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.703 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops2.512 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAGTTTGC
TAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCGATTTACAA
GAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTCTAAATTGC
CGGTGAAAATCCTATTTATAAGAGTGCCGTAAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2132232 - 2444
NM_133376 (ITGB1)1322368 - 2499
NM_002211 (ITGB1)1322453 - 2584
Exon 16 To Exon 18 (Pair 3)
Forward (2563,23)GTGGTTGCTGGAATTGTTCTTATAmplicon SizecDNA: 250 bpgenomic: 6,901
Reverse (2812,21)TGACCACAGTTGTTACGGCACNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.745 kcal/mol in 3' area
Forward Dimers-0.846 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceGTGGTTGCTGGAATTGTTCTTATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATG
ATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGG
GACACGCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTAC
GGACGTAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACA
ACTGTGGTCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2502206 - 2455
NM_133376 (ITGB1)1692342 - 2510
NM_002211 (ITGB1)1692427 - 2595
Exon 16 To Exon 18 (Pair 4)
Forward (2584,22)ATTGGCCTTGCATTACTGCTGAAmplicon SizecDNA: 217 bpgenomic: 6,868
Reverse (2800,24)TTACGGCACTCTTATAAATAGGATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.703 kcal/mol in 3' area
Forward Dimers-2.61 kcal/mol
Reverse Loops2.428 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAG
TTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCGATT
TACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTCTAA
ATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2172227 - 2443
NM_133376 (ITGB1)1362363 - 2498
NM_002211 (ITGB1)1362448 - 2583
Exon 16 To Exon 18 (Pair 5)
Forward (2573,23)GAATTGTTCTTATTGGCCTTGCAAmplicon SizecDNA: 231 bpgenomic: 6,882
Reverse (2803,24)TTGTTACGGCACTCTTATAAATAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol in 3' area
Forward Dimers-2.61 kcal/mol
Reverse Loops2.016 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceGAATTGTTCTTATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATG
ACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAG
AAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAG
CTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2312216 - 2446
NM_133376 (ITGB1)1502352 - 2501
NM_002211 (ITGB1)1502437 - 2586
Exon 16 To Exon 18 (Pair 6)
Forward (2562,23)TGTGGTTGCTGGAATTGTTCTTAAmplicon SizecDNA: 246 bpgenomic: 6,897
Reverse (2807,23)ACAGTTGTTACGGCACTCTTATANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.745 kcal/mol in 3' area
Forward Dimers-0.846 kcal/mol
Reverse Loops1.636 kcal/mol
Reverse Dimers-1.265 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceTGTGGTTGCTGGAATTGTTCTTATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAAT
GATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATG
GGACACGCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTA
CGGACGTAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAAC
AACTGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2462205 - 2450
NM_133376 (ITGB1)1652341 - 2505
NM_002211 (ITGB1)1652426 - 2590
Exon 16 To Exon 18 (Pair 7)
Forward (2555,21)TAGCTGGTGTGGTTGCTGGAAAmplicon SizecDNA: 250 bpgenomic: 6,901
Reverse (2804,24)GTTGTTACGGCACTCTTATAAATANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.92 kcal/mol in 3' area
Forward Dimers-2.064 kcal/mol
Reverse Loops2.016 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceTAGCTGGTGTGGTTGCTGGAATTGTTCTTATTGGCCTTGCATTACTGCTGATATGGAAGC
TTTTAATGATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATG
CCAAATGGGACACGCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATC
CAAACTACGGACGTAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTG
CCGTAACAAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2502198 - 2447
NM_133376 (ITGB1)1692334 - 2502
NM_002211 (ITGB1)1692419 - 2587
Exon 16 To Exon 18 (Pair 8)
Forward (2554,20)GTAGCTGGTGTGGTTGCTGGAmplicon SizecDNA: 254 bpgenomic: 6,905
Reverse (2807,23)ACAGTTGTTACGGCACTCTTATANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.92 kcal/mol in 3' area
Forward Dimers-2.064 kcal/mol
Reverse Loops1.636 kcal/mol
Reverse Dimers-1.265 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceGTAGCTGGTGTGGTTGCTGGAATTGTTCTTATTGGCCTTGCATTACTGCTGATATGGAAG
CTTTTAATGATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAAT
GCCAAATGGGACACGCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAAT
CCAAACTACGGACGTAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGT
GCCGTAACAACTGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2542197 - 2450
NM_133376 (ITGB1)1732333 - 2505
NM_002211 (ITGB1)1732418 - 2590
Exon 16 To Exon 18 (Pair 9)
Forward (2627,22)TTCATGACAGAAGGGAGTTTGCAmplicon SizecDNA: 258 bpgenomic: 6,909
Reverse (2884,23)GGAAATTGCTACTTTGCATTCAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.59 kcal/mol in 3' area
Forward Dimers-1.818 kcal/mol
Reverse Loops1.023 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.276 kcal/mol outside primersite
Amplicon SequenceTTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACA
CGCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGAC
GTAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAACTG
TGGTCAATCCGAAGTATGAGGGAAAATGAGTACTGCCCGTGCAAATCCCACAACACTGAA
TGCAAAGTAGCAATTTCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2582270 - 2527
NM_133376 (ITGB1)1772406 - 2582
NM_002211 (ITGB1)1772491 - 2667
Exon 16 To Exon 18 (Pair 10)
Forward (2623,24)ATAATTCATGACAGAAGGGAGTTTAmplicon SizecDNA: 190 bpgenomic: 6,841
Reverse (2812,21)TGACCACAGTTGTTACGGCACNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.59 kcal/mol in 3' area
Forward Dimers-1.818 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.276 kcal/mol outside primersite
Amplicon SequenceATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGG
GACACGCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTAC
GGACGTAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACA
ACTGTGGTCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)1902266 - 2455
NM_133376 (ITGB1)1092402 - 2510
NM_002211 (ITGB1)1092487 - 2595
Exon 16 To Exon 18 (Pair 11)
Forward (2619,24)AATGATAATTCATGACAGAAGGGAAmplicon SizecDNA: 194 bpgenomic: 6,845
Reverse (2812,21)TGACCACAGTTGTTACGGCACNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.818 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.133 kcal/mol inside primersite
Amplicon SequenceAATGATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAA
ATGGGACACGCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAA
CTACGGACGTAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGT
AACAACTGTGGTCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)1942262 - 2455
NM_133376 (ITGB1)1132398 - 2510
NM_002211 (ITGB1)1132483 - 2595
Exon 16 To Exon 18 (Pair 12)
Forward (2583,22)TATTGGCCTTGCATTACTGCTGAmplicon SizecDNA: 224 bpgenomic: 6,875
Reverse (2806,23)CAGTTGTTACGGCACTCTTATAANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.703 kcal/mol in 3' area
Forward Dimers-2.61 kcal/mol
Reverse Loops1.674 kcal/mol
Reverse Dimers-1.265 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceTATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGA
GTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCGAT
TTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTCTA
AATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAACTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2242226 - 2449
NM_133376 (ITGB1)1432362 - 2504
NM_002211 (ITGB1)1432447 - 2589
Exon 16 To Exon 18 (Pair 13)
Forward (2621,23)TGATAATTCATGACAGAAGGGAGAmplicon SizecDNA: 258 bpgenomic: 6,909
Reverse (2878,23)TGCTACTTTGCATTCAGTGTTGTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.77 kcal/mol
Forward Dimers-1.818 kcal/mol
Reverse Loops1.094 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.276 kcal/mol outside primersite
Amplicon SequenceTGATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAAT
GGGACACGCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACT
ACGGACGTAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAA
CAACTGTGGTCAATCCGAAGTATGAGGGAAAATGAGTACTGCCCGTGCAAATCCCACAAC
ACTGAATGCAAAGTAGCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2582264 - 2521
NM_133376 (ITGB1)1772400 - 2576
NM_002211 (ITGB1)1772485 - 2661
Exon 16 To Exon 18 (Pair 14)
Forward (2590,23)CTTGCATTACTGCTGATATGGAAAmplicon SizecDNA: 225 bpgenomic: 6,876
Reverse (2814,22)ATTGACCACAGTTGTTACGGCANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.703 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAGTTTGCT
AAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCGATTTACAAG
AGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTCTAAATTGCC
GGTGAAAATCCTATTTATAAGAGTGCCGTAACAACTGTGGTCAAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2252233 - 2457
NM_133376 (ITGB1)1442369 - 2512
NM_002211 (ITGB1)1442454 - 2597
Exon 16 To Exon 18 (Pair 15)
Forward (2561,22)GTGTGGTTGCTGGAATTGTTCTAmplicon SizecDNA: 252 bpgenomic: 6,903
Reverse (2812,21)TGACCACAGTTGTTACGGCACNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.762 kcal/mol in 3' area
Forward Dimers-0.846 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceGTGTGGTTGCTGGAATTGTTCTTATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAA
TGATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAAT
GGGACACGCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACT
ACGGACGTAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAA
CAACTGTGGTCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2522204 - 2455
NM_133376 (ITGB1)1712340 - 2510
NM_002211 (ITGB1)1712425 - 2595
Exon 16 To Exon 18 (Pair 16)
Forward (2566,23)GTTGCTGGAATTGTTCTTATTGGAmplicon SizecDNA: 242 bpgenomic: 6,893
Reverse (2807,23)ACAGTTGTTACGGCACTCTTATANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.745 kcal/mol
Forward Dimers-0.846 kcal/mol
Reverse Loops1.636 kcal/mol
Reverse Dimers-1.265 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceGTTGCTGGAATTGTTCTTATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATA
ATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGAC
ACGCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGA
CGTAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAACT
GT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2422209 - 2450
NM_133376 (ITGB1)1612345 - 2505
NM_002211 (ITGB1)1612430 - 2590
Exon 16 To Exon 18 (Pair 17)
Forward (2583,22)TATTGGCCTTGCATTACTGCTGAmplicon SizecDNA: 218 bpgenomic: 6,869
Reverse (2800,24)TTACGGCACTCTTATAAATAGGATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.703 kcal/mol in 3' area
Forward Dimers-2.61 kcal/mol
Reverse Loops2.428 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceTATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGA
GTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCGAT
TTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTCTA
AATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2182226 - 2443
NM_133376 (ITGB1)1372362 - 2498
NM_002211 (ITGB1)1372447 - 2583
Exon 16 To Exon 18 (Pair 18)
Forward (2579,23)TTCTTATTGGCCTTGCATTACTGAmplicon SizecDNA: 223 bpgenomic: 6,874
Reverse (2801,23)GTTACGGCACTCTTATAAATAGGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops2.512 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceTTCTTATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAA
GGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATC
CGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTC
TCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2232222 - 2444
NM_133376 (ITGB1)1422358 - 2499
NM_002211 (ITGB1)1422443 - 2584
Exon 16 To Exon 18 (Pair 19)
Forward (2629,22)CATGACAGAAGGGAGTTTGCTAAmplicon SizecDNA: 175 bpgenomic: 6,826
Reverse (2803,24)TTGTTACGGCACTCTTATAAATAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.259 kcal/mol in 3' area
Forward Dimers-1.208 kcal/mol
Reverse Loops2.016 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.276 kcal/mol outside primersite
Amplicon SequenceCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACG
CAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGT
AAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)1752272 - 2446
NM_133376 (ITGB1)942408 - 2501
NM_002211 (ITGB1)942493 - 2586
Exon 16 To Exon 18 (Pair 20)
Forward (2621,23)TGATAATTCATGACAGAAGGGAGAmplicon SizecDNA: 273 bpgenomic: 6,924
Reverse (2893,24)TGTGACTATGGAAATTGCTACTTTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.77 kcal/mol
Forward Dimers-1.818 kcal/mol
Reverse Loops0.944 kcal/mol
Reverse Dimers-0.802 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.276 kcal/mol outside primersite
Amplicon SequenceTGATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAAT
GGGACACGCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACT
ACGGACGTAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAA
CAACTGTGGTCAATCCGAAGTATGAGGGAAAATGAGTACTGCCCGTGCAAATCCCACAAC
ACTGAATGCAAAGTAGCAATTTCCATAGTCACA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2732264 - 2536
NM_133376 (ITGB1)1922400 - 2591
NM_002211 (ITGB1)1922485 - 2676
Exon 16 To Exon 18 (Pair 21)
Forward (2591,23)TTGCATTACTGCTGATATGGAAGAmplicon SizecDNA: 210 bpgenomic: 6,861
Reverse (2800,24)TTACGGCACTCTTATAAATAGGATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.703 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops2.428 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAGTTTGCTA
AATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCGATTTACAAGA
GTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTCTAAATTGCCG
GTGAAAATCCTATTTATAAGAGTGCCGTAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2102234 - 2443
NM_133376 (ITGB1)1292370 - 2498
NM_002211 (ITGB1)1292455 - 2583
Exon 16 To Exon 18 (Pair 22)
Forward (2578,23)GTTCTTATTGGCCTTGCATTACTAmplicon SizecDNA: 230 bpgenomic: 6,881
Reverse (2807,23)ACAGTTGTTACGGCACTCTTATANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops1.636 kcal/mol
Reverse Dimers-1.265 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceGTTCTTATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGA
AGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAAT
CCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGT
CTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAACTGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2302221 - 2450
NM_133376 (ITGB1)1492357 - 2505
NM_002211 (ITGB1)1492442 - 2590
Exon 16 To Exon 18 (Pair 23)
Forward (2619,24)AATGATAATTCATGACAGAAGGGAAmplicon SizecDNA: 272 bpgenomic: 6,923
Reverse (2890,23)GACTATGGAAATTGCTACTTTGCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.818 kcal/mol
Reverse Loops0.944 kcal/mol
Reverse Dimers-0.802 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.133 kcal/mol inside primersite
Amplicon SequenceAATGATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAA
ATGGGACACGCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAA
CTACGGACGTAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGT
AACAACTGTGGTCAATCCGAAGTATGAGGGAAAATGAGTACTGCCCGTGCAAATCCCACA
ACACTGAATGCAAAGTAGCAATTTCCATAGTC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2722262 - 2533
NM_133376 (ITGB1)1912398 - 2588
NM_002211 (ITGB1)1912483 - 2673
Exon 16 To Exon 18 (Pair 24)
Forward (2563,23)GTGGTTGCTGGAATTGTTCTTATAmplicon SizecDNA: 252 bpgenomic: 6,903
Reverse (2814,22)ATTGACCACAGTTGTTACGGCANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.745 kcal/mol in 3' area
Forward Dimers-0.846 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceGTGGTTGCTGGAATTGTTCTTATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATG
ATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGG
GACACGCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTAC
GGACGTAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACA
ACTGTGGTCAAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2522206 - 2457
NM_133376 (ITGB1)1712342 - 2512
NM_002211 (ITGB1)1712427 - 2597
Exon 16 To Exon 18 (Pair 25)
Forward (2627,22)TTCATGACAGAAGGGAGTTTGCAmplicon SizecDNA: 178 bpgenomic: 6,829
Reverse (2804,24)GTTGTTACGGCACTCTTATAAATANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.59 kcal/mol in 3' area
Forward Dimers-1.818 kcal/mol
Reverse Loops2.016 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.276 kcal/mol outside primersite
Amplicon SequenceTTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACA
CGCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGAC
GTAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)1782270 - 2447
NM_133376 (ITGB1)972406 - 2502
NM_002211 (ITGB1)972491 - 2587
Exon 16 To Exon 18 (Pair 26)
Forward (2584,22)ATTGGCCTTGCATTACTGCTGAAmplicon SizecDNA: 298 bpgenomic: 6,949
Reverse (2881,24)AATTGCTACTTTGCATTCAGTGTTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.703 kcal/mol in 3' area
Forward Dimers-2.61 kcal/mol
Reverse Loops1.023 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAG
TTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCGATT
TACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTCTAA
ATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAACTGTGGTCAATCCGAAGTAT
GAGGGAAAATGAGTACTGCCCGTGCAAATCCCACAACACTGAATGCAAAGTAGCAATT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2982227 - 2524
NM_133376 (ITGB1)2172363 - 2579
NM_002211 (ITGB1)2172448 - 2664
Exon 16 To Exon 18 (Pair 27)
Forward (2591,23)TTGCATTACTGCTGATATGGAAGAmplicon SizecDNA: 224 bpgenomic: 6,875
Reverse (2814,22)ATTGACCACAGTTGTTACGGCANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.703 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAGTTTGCTA
AATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCGATTTACAAGA
GTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTCTAAATTGCCG
GTGAAAATCCTATTTATAAGAGTGCCGTAACAACTGTGGTCAAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2242234 - 2457
NM_133376 (ITGB1)1432370 - 2512
NM_002211 (ITGB1)1432455 - 2597
Exon 16 To Exon 18 (Pair 28)
Forward (2632,23)GACAGAAGGGAGTTTGCTAAATTAmplicon SizecDNA: 253 bpgenomic: 6,904
Reverse (2884,23)GGAAATTGCTACTTTGCATTCAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.259 kcal/mol
Forward Dimers-0.414 kcal/mol
Reverse Loops1.023 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.276 kcal/mol outside primersite
Amplicon SequenceGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAA
GAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAA
GCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAACTGTGGTC
AATCCGAAGTATGAGGGAAAATGAGTACTGCCCGTGCAAATCCCACAACACTGAATGCAA
AGTAGCAATTTCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2532275 - 2527
NM_133376 (ITGB1)1722411 - 2582
NM_002211 (ITGB1)1722496 - 2667
Exon 16 To Exon 18 (Pair 29)
Forward (2554,20)GTAGCTGGTGTGGTTGCTGGAmplicon SizecDNA: 246 bpgenomic: 6,897
Reverse (2799,24)TACGGCACTCTTATAAATAGGATTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.92 kcal/mol in 3' area
Forward Dimers-2.064 kcal/mol
Reverse Loops1.923 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceGTAGCTGGTGTGGTTGCTGGAATTGTTCTTATTGGCCTTGCATTACTGCTGATATGGAAG
CTTTTAATGATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAAT
GCCAAATGGGACACGCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAAT
CCAAACTACGGACGTAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGT
GCCGTA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2462197 - 2442
NM_133376 (ITGB1)1652333 - 2497
NM_002211 (ITGB1)1652418 - 2582
Exon 16 To Exon 18 (Pair 30)
Forward (2554,20)GTAGCTGGTGTGGTTGCTGGAmplicon SizecDNA: 247 bpgenomic: 6,898
Reverse (2800,24)TTACGGCACTCTTATAAATAGGATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.92 kcal/mol in 3' area
Forward Dimers-2.064 kcal/mol
Reverse Loops2.428 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceGTAGCTGGTGTGGTTGCTGGAATTGTTCTTATTGGCCTTGCATTACTGCTGATATGGAAG
CTTTTAATGATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAAT
GCCAAATGGGACACGCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAAT
CCAAACTACGGACGTAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGT
GCCGTAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2472197 - 2443
NM_133376 (ITGB1)1662333 - 2498
NM_002211 (ITGB1)1662418 - 2583
Exon 16 To Exon 18 (Pair 31)
Forward (2623,24)ATAATTCATGACAGAAGGGAGTTTAmplicon SizecDNA: 272 bpgenomic: 6,923
Reverse (2894,23)CTGTGACTATGGAAATTGCTACTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.59 kcal/mol in 3' area
Forward Dimers-1.818 kcal/mol
Reverse Loops0.944 kcal/mol
Reverse Dimers-0.802 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.276 kcal/mol outside primersite
Amplicon SequenceATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGG
GACACGCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTAC
GGACGTAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACA
ACTGTGGTCAATCCGAAGTATGAGGGAAAATGAGTACTGCCCGTGCAAATCCCACAACAC
TGAATGCAAAGTAGCAATTTCCATAGTCACAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2722266 - 2537
NM_133376 (ITGB1)1912402 - 2592
NM_002211 (ITGB1)1912487 - 2677
Exon 16 To Exon 18 (Pair 32)
Forward (2585,22)TTGGCCTTGCATTACTGCTGATAmplicon SizecDNA: 216 bpgenomic: 6,867
Reverse (2800,24)TTACGGCACTCTTATAAATAGGATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.703 kcal/mol in 3' area
Forward Dimers-2.61 kcal/mol
Reverse Loops2.428 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceTTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAGT
TTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCGATTT
ACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTCTAAA
TTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2162228 - 2443
NM_133376 (ITGB1)1352364 - 2498
NM_002211 (ITGB1)1352449 - 2583
Exon 16 To Exon 18 (Pair 33)
Forward (2621,23)TGATAATTCATGACAGAAGGGAGAmplicon SizecDNA: 262 bpgenomic: 6,913
Reverse (2882,24)AAATTGCTACTTTGCATTCAGTGTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.77 kcal/mol
Forward Dimers-1.818 kcal/mol
Reverse Loops1.023 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.276 kcal/mol outside primersite
Amplicon SequenceTGATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAAT
GGGACACGCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACT
ACGGACGTAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAA
CAACTGTGGTCAATCCGAAGTATGAGGGAAAATGAGTACTGCCCGTGCAAATCCCACAAC
ACTGAATGCAAAGTAGCAATTT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2622264 - 2525
NM_133376 (ITGB1)1812400 - 2580
NM_002211 (ITGB1)1812485 - 2665
Exon 16 To Exon 18 (Pair 34)
Forward (2556,21)AGCTGGTGTGGTTGCTGGAATAmplicon SizecDNA: 246 bpgenomic: 6,897
Reverse (2801,23)GTTACGGCACTCTTATAAATAGGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.149 kcal/mol
Forward Dimers-1.606 kcal/mol
Reverse Loops2.512 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceAGCTGGTGTGGTTGCTGGAATTGTTCTTATTGGCCTTGCATTACTGCTGATATGGAAGCT
TTTAATGATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGC
CAAATGGGACACGCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCC
AAACTACGGACGTAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGC
CGTAAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2462199 - 2444
NM_133376 (ITGB1)1652335 - 2499
NM_002211 (ITGB1)1652420 - 2584
Exon 16 To Exon 18 (Pair 35)
Forward (2584,22)ATTGGCCTTGCATTACTGCTGAAmplicon SizecDNA: 295 bpgenomic: 6,946
Reverse (2878,23)TGCTACTTTGCATTCAGTGTTGTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.703 kcal/mol in 3' area
Forward Dimers-2.61 kcal/mol
Reverse Loops1.094 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAG
TTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCGATT
TACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTCTAA
ATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAACTGTGGTCAATCCGAAGTAT
GAGGGAAAATGAGTACTGCCCGTGCAAATCCCACAACACTGAATGCAAAGTAGCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2952227 - 2521
NM_133376 (ITGB1)2142363 - 2576
NM_002211 (ITGB1)2142448 - 2661
Exon 16 To Exon 18 (Pair 36)
Forward (2574,24)AATTGTTCTTATTGGCCTTGCATTAmplicon SizecDNA: 226 bpgenomic: 6,877
Reverse (2799,24)TACGGCACTCTTATAAATAGGATTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol in 3' area
Forward Dimers-2.61 kcal/mol
Reverse Loops1.923 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceAATTGTTCTTATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGA
CAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGA
AAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGC
TGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2262217 - 2442
NM_133376 (ITGB1)1452353 - 2497
NM_002211 (ITGB1)1452438 - 2582
Exon 16 To Exon 18 (Pair 37)
Forward (2590,23)CTTGCATTACTGCTGATATGGAAAmplicon SizecDNA: 214 bpgenomic: 6,865
Reverse (2803,24)TTGTTACGGCACTCTTATAAATAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.703 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops2.016 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAGTTTGCT
AAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCGATTTACAAG
AGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTCTAAATTGCC
GGTGAAAATCCTATTTATAAGAGTGCCGTAACAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2142233 - 2446
NM_133376 (ITGB1)1332369 - 2501
NM_002211 (ITGB1)1332454 - 2586
Exon 16 To Exon 18 (Pair 38)
Forward (2632,23)GACAGAAGGGAGTTTGCTAAATTAmplicon SizecDNA: 250 bpgenomic: 6,901
Reverse (2881,24)AATTGCTACTTTGCATTCAGTGTTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.259 kcal/mol
Forward Dimers-0.414 kcal/mol
Reverse Loops1.023 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.276 kcal/mol outside primersite
Amplicon SequenceGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAA
GAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAA
GCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAACTGTGGTC
AATCCGAAGTATGAGGGAAAATGAGTACTGCCCGTGCAAATCCCACAACACTGAATGCAA
AGTAGCAATT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2502275 - 2524
NM_133376 (ITGB1)1692411 - 2579
NM_002211 (ITGB1)1692496 - 2664
Exon 16 To Exon 18 (Pair 39)
Forward (2588,22)GCCTTGCATTACTGCTGATATGAmplicon SizecDNA: 225 bpgenomic: 6,876
Reverse (2812,21)TGACCACAGTTGTTACGGCACNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.703 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAGTTTG
CTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCGATTTACA
AGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTCTAAATTG
CCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAACTGTGGTCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2252231 - 2455
NM_133376 (ITGB1)1442367 - 2510
NM_002211 (ITGB1)1442452 - 2595
Exon 16 To Exon 18 (Pair 40)
Forward (2588,22)GCCTTGCATTACTGCTGATATGAmplicon SizecDNA: 217 bpgenomic: 6,868
Reverse (2804,24)GTTGTTACGGCACTCTTATAAATANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.703 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops2.016 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAGTTTG
CTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCGATTTACA
AGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTCTAAATTG
CCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2172231 - 2447
NM_133376 (ITGB1)1362367 - 2502
NM_002211 (ITGB1)1362452 - 2587
Exon 16 To Exon 18 (Pair 41)
Forward (2587,22)GGCCTTGCATTACTGCTGATATAmplicon SizecDNA: 215 bpgenomic: 6,866
Reverse (2801,23)GTTACGGCACTCTTATAAATAGGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.703 kcal/mol
Forward Dimers-2.068 kcal/mol
Reverse Loops2.512 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAGTTT
GCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCGATTTAC
AAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTCTAAATT
GCCGGTGAAAATCCTATTTATAAGAGTGCCGTAAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2152230 - 2444
NM_133376 (ITGB1)1342366 - 2499
NM_002211 (ITGB1)1342451 - 2584
Exon 16 To Exon 18 (Pair 42)
Forward (2625,23)AATTCATGACAGAAGGGAGTTTGAmplicon SizecDNA: 266 bpgenomic: 6,917
Reverse (2890,23)GACTATGGAAATTGCTACTTTGCNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.59 kcal/mol in 3' area
Forward Dimers-1.818 kcal/mol
Reverse Loops0.944 kcal/mol
Reverse Dimers-0.802 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.276 kcal/mol outside primersite
Amplicon SequenceAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGA
CACGCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGG
ACGTAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAAC
TGTGGTCAATCCGAAGTATGAGGGAAAATGAGTACTGCCCGTGCAAATCCCACAACACTG
AATGCAAAGTAGCAATTTCCATAGTC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2662268 - 2533
NM_133376 (ITGB1)1852404 - 2588
NM_002211 (ITGB1)1852489 - 2673
Exon 16 To Exon 18 (Pair 43)
Forward (2581,22)CTTATTGGCCTTGCATTACTGCAmplicon SizecDNA: 225 bpgenomic: 6,876
Reverse (2805,24)AGTTGTTACGGCACTCTTATAAATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.855 kcal/mol in 3' area
Forward Dimers-2.61 kcal/mol
Reverse Loops2.016 kcal/mol
Reverse Dimers-0.791 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceCTTATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGG
GAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCG
ATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTC
TAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAACT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2252224 - 2448
NM_133376 (ITGB1)1442360 - 2503
NM_002211 (ITGB1)1442445 - 2588
Exon 16 To Exon 18 (Pair 44)
Forward (2579,23)TTCTTATTGGCCTTGCATTACTGAmplicon SizecDNA: 221 bpgenomic: 6,872
Reverse (2799,24)TACGGCACTCTTATAAATAGGATTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops1.923 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceTTCTTATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAA
GGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATC
CGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTC
TCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2212222 - 2442
NM_133376 (ITGB1)1402358 - 2497
NM_002211 (ITGB1)1402443 - 2582
Exon 16 To Exon 18 (Pair 45)
Forward (2590,23)CTTGCATTACTGCTGATATGGAAAmplicon SizecDNA: 210 bpgenomic: 6,861
Reverse (2799,24)TACGGCACTCTTATAAATAGGATTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.703 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.923 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAGTTTGCT
AAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCGATTTACAAG
AGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTCTAAATTGCC
GGTGAAAATCCTATTTATAAGAGTGCCGTA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2102233 - 2442
NM_133376 (ITGB1)1292369 - 2497
NM_002211 (ITGB1)1292454 - 2582
Exon 16 To Exon 18 (Pair 46)
Forward (2555,21)TAGCTGGTGTGGTTGCTGGAAAmplicon SizecDNA: 258 bpgenomic: 6,909
Reverse (2812,21)TGACCACAGTTGTTACGGCACNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.92 kcal/mol in 3' area
Forward Dimers-2.064 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceTAGCTGGTGTGGTTGCTGGAATTGTTCTTATTGGCCTTGCATTACTGCTGATATGGAAGC
TTTTAATGATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATG
CCAAATGGGACACGCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATC
CAAACTACGGACGTAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTG
CCGTAACAACTGTGGTCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2582198 - 2455
NM_133376 (ITGB1)1772334 - 2510
NM_002211 (ITGB1)1772419 - 2595
Exon 16 To Exon 18 (Pair 47)
Forward (2575,24)ATTGTTCTTATTGGCCTTGCATTAAmplicon SizecDNA: 226 bpgenomic: 6,877
Reverse (2800,24)TTACGGCACTCTTATAAATAGGATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol in 3' area
Forward Dimers-2.61 kcal/mol
Reverse Loops2.428 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceATTGTTCTTATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGAC
AGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAA
AATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCT
GGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2262218 - 2443
NM_133376 (ITGB1)1452354 - 2498
NM_002211 (ITGB1)1452439 - 2583
Exon 16 To Exon 18 (Pair 48)
Forward (2577,23)TGTTCTTATTGGCCTTGCATTACAmplicon SizecDNA: 227 bpgenomic: 6,878
Reverse (2803,24)TTGTTACGGCACTCTTATAAATAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops2.016 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceTGTTCTTATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAG
AAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAA
TCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGG
TCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2272220 - 2446
NM_133376 (ITGB1)1462356 - 2501
NM_002211 (ITGB1)1462441 - 2586
Exon 16 To Exon 18 (Pair 49)
Forward (2625,23)AATTCATGACAGAAGGGAGTTTGAmplicon SizecDNA: 188 bpgenomic: 6,839
Reverse (2812,21)TGACCACAGTTGTTACGGCACNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.59 kcal/mol in 3' area
Forward Dimers-1.818 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.276 kcal/mol outside primersite
Amplicon SequenceAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGA
CACGCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGG
ACGTAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAAC
TGTGGTCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)1882268 - 2455
NM_133376 (ITGB1)1072404 - 2510
NM_002211 (ITGB1)1072489 - 2595
Exon 16 To Exon 18 (Pair 50)
Forward (2587,22)GGCCTTGCATTACTGCTGATATAmplicon SizecDNA: 293 bpgenomic: 6,944
Reverse (2879,23)TTGCTACTTTGCATTCAGTGTTGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.703 kcal/mol
Forward Dimers-2.068 kcal/mol
Reverse Loops1.023 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAGTTT
GCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCGATTTAC
AAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTCTAAATT
GCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAACTGTGGTCAATCCGAAGTATGAG
GGAAAATGAGTACTGCCCGTGCAAATCCCACAACACTGAATGCAAAGTAGCAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2932230 - 2522
NM_133376 (ITGB1)2122366 - 2577
NM_002211 (ITGB1)2122451 - 2662
Exon 16 To Exon 18 (Pair 51)
Forward (2574,24)AATTGTTCTTATTGGCCTTGCATTAmplicon SizecDNA: 232 bpgenomic: 6,883
Reverse (2805,24)AGTTGTTACGGCACTCTTATAAATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol in 3' area
Forward Dimers-2.61 kcal/mol
Reverse Loops2.016 kcal/mol
Reverse Dimers-0.791 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceAATTGTTCTTATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGA
CAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGA
AAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGC
TGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAACT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2322217 - 2448
NM_133376 (ITGB1)1512353 - 2503
NM_002211 (ITGB1)1512438 - 2588
Exon 16 To Exon 18 (Pair 52)
Forward (2628,22)TCATGACAGAAGGGAGTTTGCTAmplicon SizecDNA: 252 bpgenomic: 6,903
Reverse (2879,23)TTGCTACTTTGCATTCAGTGTTGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.59 kcal/mol in 3' area
Forward Dimers-1.818 kcal/mol
Reverse Loops1.023 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.276 kcal/mol outside primersite
Amplicon SequenceTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACAC
GCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACG
TAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAACTGT
GGTCAATCCGAAGTATGAGGGAAAATGAGTACTGCCCGTGCAAATCCCACAACACTGAAT
GCAAAGTAGCAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2522271 - 2522
NM_133376 (ITGB1)1712407 - 2577
NM_002211 (ITGB1)1712492 - 2662
Exon 16 To Exon 18 (Pair 53)
Forward (2587,22)GGCCTTGCATTACTGCTGATATAmplicon SizecDNA: 298 bpgenomic: 6,949
Reverse (2884,23)GGAAATTGCTACTTTGCATTCAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.703 kcal/mol
Forward Dimers-2.068 kcal/mol
Reverse Loops1.023 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAGTTT
GCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCGATTTAC
AAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTCTAAATT
GCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAACTGTGGTCAATCCGAAGTATGAG
GGAAAATGAGTACTGCCCGTGCAAATCCCACAACACTGAATGCAAAGTAGCAATTTCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2982230 - 2527
NM_133376 (ITGB1)2172366 - 2582
NM_002211 (ITGB1)2172451 - 2667
Exon 16 To Exon 18 (Pair 54)
Forward (2628,22)TCATGACAGAAGGGAGTTTGCTAmplicon SizecDNA: 180 bpgenomic: 6,831
Reverse (2807,23)ACAGTTGTTACGGCACTCTTATANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.59 kcal/mol in 3' area
Forward Dimers-1.818 kcal/mol
Reverse Loops1.636 kcal/mol
Reverse Dimers-1.265 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.276 kcal/mol outside primersite
Amplicon SequenceTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACAC
GCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACG
TAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAACTGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)1802271 - 2450
NM_133376 (ITGB1)992407 - 2505
NM_002211 (ITGB1)992492 - 2590
Exon 16 To Exon 18 (Pair 55)
Forward (2587,22)GGCCTTGCATTACTGCTGATATAmplicon SizecDNA: 213 bpgenomic: 6,864
Reverse (2799,24)TACGGCACTCTTATAAATAGGATTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.703 kcal/mol
Forward Dimers-2.068 kcal/mol
Reverse Loops1.923 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAGTTT
GCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCGATTTAC
AAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTCTAAATT
GCCGGTGAAAATCCTATTTATAAGAGTGCCGTA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2132230 - 2442
NM_133376 (ITGB1)1322366 - 2497
NM_002211 (ITGB1)1322451 - 2582
Exon 16 To Exon 18 (Pair 56)
Forward (2590,23)CTTGCATTACTGCTGATATGGAAAmplicon SizecDNA: 295 bpgenomic: 6,946
Reverse (2884,23)GGAAATTGCTACTTTGCATTCAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.703 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.023 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAGTTTGCT
AAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCGATTTACAAG
AGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTCTAAATTGCC
GGTGAAAATCCTATTTATAAGAGTGCCGTAACAACTGTGGTCAATCCGAAGTATGAGGGA
AAATGAGTACTGCCCGTGCAAATCCCACAACACTGAATGCAAAGTAGCAATTTCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2952233 - 2527
NM_133376 (ITGB1)2142369 - 2582
NM_002211 (ITGB1)2142454 - 2667
Exon 16 To Exon 18 (Pair 57)
Forward (2584,22)ATTGGCCTTGCATTACTGCTGAAmplicon SizecDNA: 222 bpgenomic: 6,873
Reverse (2805,24)AGTTGTTACGGCACTCTTATAAATNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.703 kcal/mol in 3' area
Forward Dimers-2.61 kcal/mol
Reverse Loops2.016 kcal/mol
Reverse Dimers-0.791 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAG
TTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCGATT
TACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTCTAA
ATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAACT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2222227 - 2448
NM_133376 (ITGB1)1412363 - 2503
NM_002211 (ITGB1)1412448 - 2588
Exon 16 To Exon 18 (Pair 58)
Forward (2585,22)TTGGCCTTGCATTACTGCTGATAmplicon SizecDNA: 222 bpgenomic: 6,873
Reverse (2806,23)CAGTTGTTACGGCACTCTTATAANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.703 kcal/mol in 3' area
Forward Dimers-2.61 kcal/mol
Reverse Loops1.674 kcal/mol
Reverse Dimers-1.265 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceTTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAGT
TTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCGATTT
ACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTCTAAA
TTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAACTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2222228 - 2449
NM_133376 (ITGB1)1412364 - 2504
NM_002211 (ITGB1)1412449 - 2589
Exon 16 To Exon 18 (Pair 59)
Forward (2586,22)TGGCCTTGCATTACTGCTGATAAmplicon SizecDNA: 299 bpgenomic: 6,950
Reverse (2884,23)GGAAATTGCTACTTTGCATTCAGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.703 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops1.023 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAGTT
TGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCGATTTA
CAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTCTAAAT
TGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAACTGTGGTCAATCCGAAGTATGA
GGGAAAATGAGTACTGCCCGTGCAAATCCCACAACACTGAATGCAAAGTAGCAATTTCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2992229 - 2527
NM_133376 (ITGB1)2182365 - 2582
NM_002211 (ITGB1)2182450 - 2667
Exon 16 To Exon 18 (Pair 60)
Forward (2591,23)TTGCATTACTGCTGATATGGAAGAmplicon SizecDNA: 289 bpgenomic: 6,940
Reverse (2879,23)TTGCTACTTTGCATTCAGTGTTGNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.703 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.023 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAGTTTGCTA
AATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCGATTTACAAGA
GTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTCTAAATTGCCG
GTGAAAATCCTATTTATAAGAGTGCCGTAACAACTGTGGTCAATCCGAAGTATGAGGGAA
AATGAGTACTGCCCGTGCAAATCCCACAACACTGAATGCAAAGTAGCAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2892234 - 2522
NM_133376 (ITGB1)2082370 - 2577
NM_002211 (ITGB1)2082455 - 2662
Exon 16 To Exon 18 (Pair 61)
Forward (2621,23)TGATAATTCATGACAGAAGGGAGAmplicon SizecDNA: 179 bpgenomic: 6,830
Reverse (2799,24)TACGGCACTCTTATAAATAGGATTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.77 kcal/mol
Forward Dimers-1.818 kcal/mol
Reverse Loops1.923 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.276 kcal/mol outside primersite
Amplicon SequenceTGATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAAT
GGGACACGCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACT
ACGGACGTAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)1792264 - 2442
NM_133376 (ITGB1)982400 - 2497
NM_002211 (ITGB1)982485 - 2582
Exon 16 To Exon 18 (Pair 62)
Forward (2588,22)GCCTTGCATTACTGCTGATATGAmplicon SizecDNA: 295 bpgenomic: 6,946
Reverse (2882,24)AAATTGCTACTTTGCATTCAGTGTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.703 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.023 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAGTTTG
CTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCGATTTACA
AGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTCTAAATTG
CCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAACTGTGGTCAATCCGAAGTATGAGG
GAAAATGAGTACTGCCCGTGCAAATCCCACAACACTGAATGCAAAGTAGCAATTT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2952231 - 2525
NM_133376 (ITGB1)2142367 - 2580
NM_002211 (ITGB1)2142452 - 2665
Exon 16 To Exon 18 (Pair 63)
Forward (2623,24)ATAATTCATGACAGAAGGGAGTTTAmplicon SizecDNA: 192 bpgenomic: 6,843
Reverse (2814,22)ATTGACCACAGTTGTTACGGCANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.59 kcal/mol in 3' area
Forward Dimers-1.818 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.276 kcal/mol outside primersite
Amplicon SequenceATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGG
GACACGCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTAC
GGACGTAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACA
ACTGTGGTCAAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)1922266 - 2457
NM_133376 (ITGB1)1112402 - 2512
NM_002211 (ITGB1)1112487 - 2597
Exon 16 To Exon 18 (Pair 64)
Forward (2583,22)TATTGGCCTTGCATTACTGCTGAmplicon SizecDNA: 217 bpgenomic: 6,868
Reverse (2799,24)TACGGCACTCTTATAAATAGGATTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.703 kcal/mol in 3' area
Forward Dimers-2.61 kcal/mol
Reverse Loops1.923 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceTATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGA
GTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATCCGAT
TTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTCTCTA
AATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2172226 - 2442
NM_133376 (ITGB1)1362362 - 2497
NM_002211 (ITGB1)1362447 - 2582
Exon 16 To Exon 18 (Pair 65)
Forward (2579,23)TTCTTATTGGCCTTGCATTACTGAmplicon SizecDNA: 229 bpgenomic: 6,880
Reverse (2807,23)ACAGTTGTTACGGCACTCTTATANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.411 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops1.636 kcal/mol
Reverse Dimers-1.265 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceTTCTTATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAA
GGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGCAAGAAAATC
CGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTACGGACGTAAAGCTGGTC
TCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAACAACTGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2292222 - 2450
NM_133376 (ITGB1)1482358 - 2505
NM_002211 (ITGB1)1482443 - 2590
Exon 16 To Exon 18 (Pair 66)
Forward (2562,23)TGTGGTTGCTGGAATTGTTCTTAAmplicon SizecDNA: 253 bpgenomic: 6,904
Reverse (2814,22)ATTGACCACAGTTGTTACGGCANr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.745 kcal/mol in 3' area
Forward Dimers-0.846 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-0.004 kcal/mol outside primersite
Amplicon SequenceTGTGGTTGCTGGAATTGTTCTTATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAAT
GATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATG
GGACACGCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAACTA
CGGACGTAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGTAAC
AACTGTGGTCAAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2532205 - 2457
NM_133376 (ITGB1)1722341 - 2512
NM_002211 (ITGB1)1722426 - 2597
Exon 16 To Exon 18 (Pair 67)
Forward (2619,24)AATGATAATTCATGACAGAAGGGAAmplicon SizecDNA: 263 bpgenomic: 6,914
Reverse (2881,24)AATTGCTACTTTGCATTCAGTGTTNr. of Isoforms 1 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.133 kcal/mol
Forward Dimers-1.818 kcal/mol
Reverse Loops1.023 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding0.133 kcal/mol inside primersite
Amplicon SequenceAATGATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAA
ATGGGACACGCAAGAAAATCCGATTTACAAGAGTCCTATTAATAATTTCAAGAATCCAAA
CTACGGACGTAAAGCTGGTCTCTAAATTGCCGGTGAAAATCCTATTTATAAGAGTGCCGT
AACAACTGTGGTCAATCCGAAGTATGAGGGAAAATGAGTACTGCCCGTGCAAATCCCACA
ACACTGAATGCAAAGTAGCAATT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_033668 (ITGB1)2632262 - 2524
NM_133376 (ITGB1)1822398 - 2579
NM_002211 (ITGB1)1822483 - 2664
 

See below for some more details.

Program Output:

Loading ...