Design Results for Igf1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size1000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 1 To Exon 2 (Pair 1)
Forward (92,23)CGCAATGGAATAAAGTCCTCAAAAmplicon SizecDNA: 239 bpgenomic: 1,906
Reverse (330,23)GGGTTTGTGAAAGCATCTAGTTANr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.191 kcal/mol
Forward Dimers-0.328 kcal/mol
Reverse Loops0.894 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.856 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceCGCAATGGAATAAAGTCCTCAAAATTGAAATGTGACATTGCTCTCAACATCTCCCATCTC
TCTGGATTTCTTTTTGCTTCATTATTCCTGCTAACCAATTCATTTTCAGACTTTGTACTT
CAGAAGCAATGGGAAAAATCAGCAGTCTTCCAACCCAATTATTTAAGTGCTGCTTTTGTG
ATTTCTTGAAGGCATACCTGCCTGGGTGTCCAAATGTAACTAGATGCTTTCACAAACCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 2)
Forward (92,23)CGCAATGGAATAAAGTCCTCAAAAmplicon SizecDNA: 237 bpgenomic: 1,904
Reverse (328,24)GTTTGTGAAAGCATCTAGTTACATNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.191 kcal/mol
Forward Dimers-0.328 kcal/mol
Reverse Loops0.894 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.856 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceCGCAATGGAATAAAGTCCTCAAAATTGAAATGTGACATTGCTCTCAACATCTCCCATCTC
TCTGGATTTCTTTTTGCTTCATTATTCCTGCTAACCAATTCATTTTCAGACTTTGTACTT
CAGAAGCAATGGGAAAAATCAGCAGTCTTCCAACCCAATTATTTAAGTGCTGCTTTTGTG
ATTTCTTGAAGGCATACCTGCCTGGGTGTCCAAATGTAACTAGATGCTTTCACAAAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 3)
Forward (68,23)TAAATTCAGAGCAGATAGAGCCTAmplicon SizecDNA: 261 bpgenomic: 1,928
Reverse (328,24)GTTTGTGAAAGCATCTAGTTACATNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.67 kcal/mol in 3' area
Forward Dimers-1.026 kcal/mol
Reverse Loops0.894 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.826 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceTAAATTCAGAGCAGATAGAGCCTGCGCAATGGAATAAAGTCCTCAAAATTGAAATGTGAC
ATTGCTCTCAACATCTCCCATCTCTCTGGATTTCTTTTTGCTTCATTATTCCTGCTAACC
AATTCATTTTCAGACTTTGTACTTCAGAAGCAATGGGAAAAATCAGCAGTCTTCCAACCC
AATTATTTAAGTGCTGCTTTTGTGATTTCTTGAAGGCATACCTGCCTGGGTGTCCAAATG
TAACTAGATGCTTTCACAAAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 10)
Forward (126,22)ACATTGCTCTCAACATCTCCCAAmplicon SizecDNA: 205 bpgenomic: 1,872
Reverse (330,23)GGGTTTGTGAAAGCATCTAGTTANr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops0.894 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.522 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceACATTGCTCTCAACATCTCCCATCTCTCTGGATTTCTTTTTGCTTCATTATTCCTGCTAA
CCAATTCATTTTCAGACTTTGTACTTCAGAAGCAATGGGAAAAATCAGCAGTCTTCCAAC
CCAATTATTTAAGTGCTGCTTTTGTGATTTCTTGAAGGCATACCTGCCTGGGTGTCCAAA
TGTAACTAGATGCTTTCACAAACCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 11)
Forward (92,23)CGCAATGGAATAAAGTCCTCAAAAmplicon SizecDNA: 238 bpgenomic: 1,905
Reverse (329,23)GGTTTGTGAAAGCATCTAGTTACNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.191 kcal/mol
Forward Dimers-0.328 kcal/mol
Reverse Loops0.894 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.856 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceCGCAATGGAATAAAGTCCTCAAAATTGAAATGTGACATTGCTCTCAACATCTCCCATCTC
TCTGGATTTCTTTTTGCTTCATTATTCCTGCTAACCAATTCATTTTCAGACTTTGTACTT
CAGAAGCAATGGGAAAAATCAGCAGTCTTCCAACCCAATTATTTAAGTGCTGCTTTTGTG
ATTTCTTGAAGGCATACCTGCCTGGGTGTCCAAATGTAACTAGATGCTTTCACAAACC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 14)
Forward (126,22)ACATTGCTCTCAACATCTCCCAAmplicon SizecDNA: 200 bpgenomic: 1,867
Reverse (325,24)TGTGAAAGCATCTAGTTACATTTGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops0.965 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.522 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceACATTGCTCTCAACATCTCCCATCTCTCTGGATTTCTTTTTGCTTCATTATTCCTGCTAA
CCAATTCATTTTCAGACTTTGTACTTCAGAAGCAATGGGAAAAATCAGCAGTCTTCCAAC
CCAATTATTTAAGTGCTGCTTTTGTGATTTCTTGAAGGCATACCTGCCTGGGTGTCCAAA
TGTAACTAGATGCTTTCACA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 16)
Forward (70,22)AATTCAGAGCAGATAGAGCCTGAmplicon SizecDNA: 259 bpgenomic: 1,926
Reverse (328,24)GTTTGTGAAAGCATCTAGTTACATNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.67 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.894 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.826 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceAATTCAGAGCAGATAGAGCCTGCGCAATGGAATAAAGTCCTCAAAATTGAAATGTGACAT
TGCTCTCAACATCTCCCATCTCTCTGGATTTCTTTTTGCTTCATTATTCCTGCTAACCAA
TTCATTTTCAGACTTTGTACTTCAGAAGCAATGGGAAAAATCAGCAGTCTTCCAACCCAA
TTATTTAAGTGCTGCTTTTGTGATTTCTTGAAGGCATACCTGCCTGGGTGTCCAAATGTA
ACTAGATGCTTTCACAAAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 19)
Forward (70,22)AATTCAGAGCAGATAGAGCCTGAmplicon SizecDNA: 256 bpgenomic: 1,923
Reverse (325,24)TGTGAAAGCATCTAGTTACATTTGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.67 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.965 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.826 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceAATTCAGAGCAGATAGAGCCTGCGCAATGGAATAAAGTCCTCAAAATTGAAATGTGACAT
TGCTCTCAACATCTCCCATCTCTCTGGATTTCTTTTTGCTTCATTATTCCTGCTAACCAA
TTCATTTTCAGACTTTGTACTTCAGAAGCAATGGGAAAAATCAGCAGTCTTCCAACCCAA
TTATTTAAGTGCTGCTTTTGTGATTTCTTGAAGGCATACCTGCCTGGGTGTCCAAATGTA
ACTAGATGCTTTCACA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 20)
Forward (121,23)ATGTGACATTGCTCTCAACATCTAmplicon SizecDNA: 209 bpgenomic: 1,876
Reverse (329,23)GGTTTGTGAAAGCATCTAGTTACNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-2.128 kcal/mol
Reverse Loops0.894 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.522 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceATGTGACATTGCTCTCAACATCTCCCATCTCTCTGGATTTCTTTTTGCTTCATTATTCCT
GCTAACCAATTCATTTTCAGACTTTGTACTTCAGAAGCAATGGGAAAAATCAGCAGTCTT
CCAACCCAATTATTTAAGTGCTGCTTTTGTGATTTCTTGAAGGCATACCTGCCTGGGTGT
CCAAATGTAACTAGATGCTTTCACAAACC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 21)
Forward (121,23)ATGTGACATTGCTCTCAACATCTAmplicon SizecDNA: 210 bpgenomic: 1,877
Reverse (330,23)GGGTTTGTGAAAGCATCTAGTTANr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-2.128 kcal/mol
Reverse Loops0.894 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.522 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceATGTGACATTGCTCTCAACATCTCCCATCTCTCTGGATTTCTTTTTGCTTCATTATTCCT
GCTAACCAATTCATTTTCAGACTTTGTACTTCAGAAGCAATGGGAAAAATCAGCAGTCTT
CCAACCCAATTATTTAAGTGCTGCTTTTGTGATTTCTTGAAGGCATACCTGCCTGGGTGT
CCAAATGTAACTAGATGCTTTCACAAACCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 25)
Forward (65,23)TGCTAAATTCAGAGCAGATAGAGAmplicon SizecDNA: 266 bpgenomic: 1,933
Reverse (330,23)GGGTTTGTGAAAGCATCTAGTTANr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.877 kcal/mol
Forward Dimers-1.947 kcal/mol
Reverse Loops0.894 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.384 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceTGCTAAATTCAGAGCAGATAGAGCCTGCGCAATGGAATAAAGTCCTCAAAATTGAAATGT
GACATTGCTCTCAACATCTCCCATCTCTCTGGATTTCTTTTTGCTTCATTATTCCTGCTA
ACCAATTCATTTTCAGACTTTGTACTTCAGAAGCAATGGGAAAAATCAGCAGTCTTCCAA
CCCAATTATTTAAGTGCTGCTTTTGTGATTTCTTGAAGGCATACCTGCCTGGGTGTCCAA
ATGTAACTAGATGCTTTCACAAACCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 26)
Forward (65,23)TGCTAAATTCAGAGCAGATAGAGAmplicon SizecDNA: 265 bpgenomic: 1,932
Reverse (329,23)GGTTTGTGAAAGCATCTAGTTACNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.877 kcal/mol
Forward Dimers-1.947 kcal/mol
Reverse Loops0.894 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.384 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceTGCTAAATTCAGAGCAGATAGAGCCTGCGCAATGGAATAAAGTCCTCAAAATTGAAATGT
GACATTGCTCTCAACATCTCCCATCTCTCTGGATTTCTTTTTGCTTCATTATTCCTGCTA
ACCAATTCATTTTCAGACTTTGTACTTCAGAAGCAATGGGAAAAATCAGCAGTCTTCCAA
CCCAATTATTTAAGTGCTGCTTTTGTGATTTCTTGAAGGCATACCTGCCTGGGTGTCCAA
ATGTAACTAGATGCTTTCACAAACC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 27)
Forward (121,23)ATGTGACATTGCTCTCAACATCTAmplicon SizecDNA: 205 bpgenomic: 1,872
Reverse (325,24)TGTGAAAGCATCTAGTTACATTTGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-2.128 kcal/mol
Reverse Loops0.965 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.522 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceATGTGACATTGCTCTCAACATCTCCCATCTCTCTGGATTTCTTTTTGCTTCATTATTCCT
GCTAACCAATTCATTTTCAGACTTTGTACTTCAGAAGCAATGGGAAAAATCAGCAGTCTT
CCAACCCAATTATTTAAGTGCTGCTTTTGTGATTTCTTGAAGGCATACCTGCCTGGGTGT
CCAAATGTAACTAGATGCTTTCACA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 28)
Forward (127,22)CATTGCTCTCAACATCTCCCATAmplicon SizecDNA: 199 bpgenomic: 1,866
Reverse (325,24)TGTGAAAGCATCTAGTTACATTTGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops0.965 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.522 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceCATTGCTCTCAACATCTCCCATCTCTCTGGATTTCTTTTTGCTTCATTATTCCTGCTAAC
CAATTCATTTTCAGACTTTGTACTTCAGAAGCAATGGGAAAAATCAGCAGTCTTCCAACC
CAATTATTTAAGTGCTGCTTTTGTGATTTCTTGAAGGCATACCTGCCTGGGTGTCCAAAT
GTAACTAGATGCTTTCACA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 35)
Forward (68,23)TAAATTCAGAGCAGATAGAGCCTAmplicon SizecDNA: 263 bpgenomic: 1,930
Reverse (330,23)GGGTTTGTGAAAGCATCTAGTTANr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.67 kcal/mol in 3' area
Forward Dimers-1.026 kcal/mol
Reverse Loops0.894 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.826 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceTAAATTCAGAGCAGATAGAGCCTGCGCAATGGAATAAAGTCCTCAAAATTGAAATGTGAC
ATTGCTCTCAACATCTCCCATCTCTCTGGATTTCTTTTTGCTTCATTATTCCTGCTAACC
AATTCATTTTCAGACTTTGTACTTCAGAAGCAATGGGAAAAATCAGCAGTCTTCCAACCC
AATTATTTAAGTGCTGCTTTTGTGATTTCTTGAAGGCATACCTGCCTGGGTGTCCAAATG
TAACTAGATGCTTTCACAAACCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 45)
Forward (70,22)AATTCAGAGCAGATAGAGCCTGAmplicon SizecDNA: 261 bpgenomic: 1,928
Reverse (330,23)GGGTTTGTGAAAGCATCTAGTTANr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.67 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.894 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.826 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceAATTCAGAGCAGATAGAGCCTGCGCAATGGAATAAAGTCCTCAAAATTGAAATGTGACAT
TGCTCTCAACATCTCCCATCTCTCTGGATTTCTTTTTGCTTCATTATTCCTGCTAACCAA
TTCATTTTCAGACTTTGTACTTCAGAAGCAATGGGAAAAATCAGCAGTCTTCCAACCCAA
TTATTTAAGTGCTGCTTTTGTGATTTCTTGAAGGCATACCTGCCTGGGTGTCCAAATGTA
ACTAGATGCTTTCACAAACCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 53)
Forward (127,22)CATTGCTCTCAACATCTCCCATAmplicon SizecDNA: 202 bpgenomic: 1,869
Reverse (328,24)GTTTGTGAAAGCATCTAGTTACATNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops0.894 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.522 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceCATTGCTCTCAACATCTCCCATCTCTCTGGATTTCTTTTTGCTTCATTATTCCTGCTAAC
CAATTCATTTTCAGACTTTGTACTTCAGAAGCAATGGGAAAAATCAGCAGTCTTCCAACC
CAATTATTTAAGTGCTGCTTTTGTGATTTCTTGAAGGCATACCTGCCTGGGTGTCCAAAT
GTAACTAGATGCTTTCACAAAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 60)
Forward (65,23)TGCTAAATTCAGAGCAGATAGAGAmplicon SizecDNA: 264 bpgenomic: 1,931
Reverse (328,24)GTTTGTGAAAGCATCTAGTTACATNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.877 kcal/mol
Forward Dimers-1.947 kcal/mol
Reverse Loops0.894 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.384 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceTGCTAAATTCAGAGCAGATAGAGCCTGCGCAATGGAATAAAGTCCTCAAAATTGAAATGT
GACATTGCTCTCAACATCTCCCATCTCTCTGGATTTCTTTTTGCTTCATTATTCCTGCTA
ACCAATTCATTTTCAGACTTTGTACTTCAGAAGCAATGGGAAAAATCAGCAGTCTTCCAA
CCCAATTATTTAAGTGCTGCTTTTGTGATTTCTTGAAGGCATACCTGCCTGGGTGTCCAA
ATGTAACTAGATGCTTTCACAAAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 61)
Forward (70,22)AATTCAGAGCAGATAGAGCCTGAmplicon SizecDNA: 260 bpgenomic: 1,927
Reverse (329,23)GGTTTGTGAAAGCATCTAGTTACNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.67 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.894 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.826 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceAATTCAGAGCAGATAGAGCCTGCGCAATGGAATAAAGTCCTCAAAATTGAAATGTGACAT
TGCTCTCAACATCTCCCATCTCTCTGGATTTCTTTTTGCTTCATTATTCCTGCTAACCAA
TTCATTTTCAGACTTTGTACTTCAGAAGCAATGGGAAAAATCAGCAGTCTTCCAACCCAA
TTATTTAAGTGCTGCTTTTGTGATTTCTTGAAGGCATACCTGCCTGGGTGTCCAAATGTA
ACTAGATGCTTTCACAAACC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 66)
Forward (68,23)TAAATTCAGAGCAGATAGAGCCTAmplicon SizecDNA: 262 bpgenomic: 1,929
Reverse (329,23)GGTTTGTGAAAGCATCTAGTTACNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.67 kcal/mol in 3' area
Forward Dimers-1.026 kcal/mol
Reverse Loops0.894 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.826 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceTAAATTCAGAGCAGATAGAGCCTGCGCAATGGAATAAAGTCCTCAAAATTGAAATGTGAC
ATTGCTCTCAACATCTCCCATCTCTCTGGATTTCTTTTTGCTTCATTATTCCTGCTAACC
AATTCATTTTCAGACTTTGTACTTCAGAAGCAATGGGAAAAATCAGCAGTCTTCCAACCC
AATTATTTAAGTGCTGCTTTTGTGATTTCTTGAAGGCATACCTGCCTGGGTGTCCAAATG
TAACTAGATGCTTTCACAAACC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 67)
Forward (121,23)ATGTGACATTGCTCTCAACATCTAmplicon SizecDNA: 208 bpgenomic: 1,875
Reverse (328,24)GTTTGTGAAAGCATCTAGTTACATNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-2.128 kcal/mol
Reverse Loops0.894 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.522 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceATGTGACATTGCTCTCAACATCTCCCATCTCTCTGGATTTCTTTTTGCTTCATTATTCCT
GCTAACCAATTCATTTTCAGACTTTGTACTTCAGAAGCAATGGGAAAAATCAGCAGTCTT
CCAACCCAATTATTTAAGTGCTGCTTTTGTGATTTCTTGAAGGCATACCTGCCTGGGTGT
CCAAATGTAACTAGATGCTTTCACAAAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 68)
Forward (68,23)TAAATTCAGAGCAGATAGAGCCTAmplicon SizecDNA: 258 bpgenomic: 1,925
Reverse (325,24)TGTGAAAGCATCTAGTTACATTTGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.67 kcal/mol in 3' area
Forward Dimers-1.026 kcal/mol
Reverse Loops0.965 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.826 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceTAAATTCAGAGCAGATAGAGCCTGCGCAATGGAATAAAGTCCTCAAAATTGAAATGTGAC
ATTGCTCTCAACATCTCCCATCTCTCTGGATTTCTTTTTGCTTCATTATTCCTGCTAACC
AATTCATTTTCAGACTTTGTACTTCAGAAGCAATGGGAAAAATCAGCAGTCTTCCAACCC
AATTATTTAAGTGCTGCTTTTGTGATTTCTTGAAGGCATACCTGCCTGGGTGTCCAAATG
TAACTAGATGCTTTCACA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 74)
Forward (127,22)CATTGCTCTCAACATCTCCCATAmplicon SizecDNA: 204 bpgenomic: 1,871
Reverse (330,23)GGGTTTGTGAAAGCATCTAGTTANr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops0.894 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.522 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceCATTGCTCTCAACATCTCCCATCTCTCTGGATTTCTTTTTGCTTCATTATTCCTGCTAAC
CAATTCATTTTCAGACTTTGTACTTCAGAAGCAATGGGAAAAATCAGCAGTCTTCCAACC
CAATTATTTAAGTGCTGCTTTTGTGATTTCTTGAAGGCATACCTGCCTGGGTGTCCAAAT
GTAACTAGATGCTTTCACAAACCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 81)
Forward (126,22)ACATTGCTCTCAACATCTCCCAAmplicon SizecDNA: 204 bpgenomic: 1,871
Reverse (329,23)GGTTTGTGAAAGCATCTAGTTACNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops0.894 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.522 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceACATTGCTCTCAACATCTCCCATCTCTCTGGATTTCTTTTTGCTTCATTATTCCTGCTAA
CCAATTCATTTTCAGACTTTGTACTTCAGAAGCAATGGGAAAAATCAGCAGTCTTCCAAC
CCAATTATTTAAGTGCTGCTTTTGTGATTTCTTGAAGGCATACCTGCCTGGGTGTCCAAA
TGTAACTAGATGCTTTCACAAACC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 86)
Forward (126,22)ACATTGCTCTCAACATCTCCCAAmplicon SizecDNA: 203 bpgenomic: 1,870
Reverse (328,24)GTTTGTGAAAGCATCTAGTTACATNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops0.894 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.522 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceACATTGCTCTCAACATCTCCCATCTCTCTGGATTTCTTTTTGCTTCATTATTCCTGCTAA
CCAATTCATTTTCAGACTTTGTACTTCAGAAGCAATGGGAAAAATCAGCAGTCTTCCAAC
CCAATTATTTAAGTGCTGCTTTTGTGATTTCTTGAAGGCATACCTGCCTGGGTGTCCAAA
TGTAACTAGATGCTTTCACAAAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 88)
Forward (127,22)CATTGCTCTCAACATCTCCCATAmplicon SizecDNA: 203 bpgenomic: 1,870
Reverse (329,23)GGTTTGTGAAAGCATCTAGTTACNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.488 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops0.894 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.522 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceCATTGCTCTCAACATCTCCCATCTCTCTGGATTTCTTTTTGCTTCATTATTCCTGCTAAC
CAATTCATTTTCAGACTTTGTACTTCAGAAGCAATGGGAAAAATCAGCAGTCTTCCAACC
CAATTATTTAAGTGCTGCTTTTGTGATTTCTTGAAGGCATACCTGCCTGGGTGTCCAAAT
GTAACTAGATGCTTTCACAAACC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 1 To Exon 2 (Pair 90)
Forward (65,23)TGCTAAATTCAGAGCAGATAGAGAmplicon SizecDNA: 261 bpgenomic: 1,928
Reverse (325,24)TGTGAAAGCATCTAGTTACATTTGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.877 kcal/mol
Forward Dimers-1.947 kcal/mol
Reverse Loops0.965 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.384 kcal/mol
Amplicon Folding-2.016 kcal/mol outside primersite
Amplicon SequenceTGCTAAATTCAGAGCAGATAGAGCCTGCGCAATGGAATAAAGTCCTCAAAATTGAAATGT
GACATTGCTCTCAACATCTCCCATCTCTCTGGATTTCTTTTTGCTTCATTATTCCTGCTA
ACCAATTCATTTTCAGACTTTGTACTTCAGAAGCAATGGGAAAAATCAGCAGTCTTCCAA
CCCAATTATTTAAGTGCTGCTTTTGTGATTTCTTGAAGGCATACCTGCCTGGGTGTCCAA
ATGTAACTAGATGCTTTCACA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 3 (Pair 1)
Forward (308,23)TAACTAGATGCTTTCACAAACCCAmplicon SizecDNA: 217 bpgenomic: 2,904
Reverse (524,20)GTGGCAGAGCTGGTGAAGGTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.799 kcal/mol
Forward Dimers-1.712 kcal/mol
Reverse Loops0.656 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.898 kcal/mol
Amplicon Folding-1.813 kcal/mol outside primersite
Amplicon SequenceTAACTAGATGCTTTCACAAACCCCACCCACAAAGCAGCACATGTTTTTAAGACTTCAGTT
TTCTATTCACATCGGCCTCATAATACCCACCCTGACCTGCTGTAAAAGACCTGGAACAAA
CAAAAATGATTACACCTACAGTGAAGATGCACACCATGTCCTCCTCGCATCTCTTCTACC
TGGCGCTGTGCCTGCTCACCTTCACCAGCTCTGCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111284 (IGF1)21726 - 242
Exon 2 To Exon 3 (Pair 2)
Forward (367,23)TTTCTATTCACATCGGCCTCATAAmplicon SizecDNA: 158 bpgenomic: 2,845
Reverse (524,20)GTGGCAGAGCTGGTGAAGGTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.327 kcal/mol
Forward Dimers-2.164 kcal/mol
Reverse Loops0.656 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.292 kcal/mol
Amplicon Folding-1.813 kcal/mol outside primersite
Amplicon SequenceTTTCTATTCACATCGGCCTCATAATACCCACCCTGACCTGCTGTAAAAGACCTGGAACAA
ACAAAAATGATTACACCTACAGTGAAGATGCACACCATGTCCTCCTCGCATCTCTTCTAC
CTGGCGCTGTGCCTGCTCACCTTCACCAGCTCTGCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111284 (IGF1)15885 - 242
Exon 2 To Exon 3 (Pair 3)
Forward (377,21)CATCGGCCTCATAATACCCACAmplicon SizecDNA: 148 bpgenomic: 2,835
Reverse (524,20)GTGGCAGAGCTGGTGAAGGTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.246 kcal/mol in 3' area
Forward Dimers-2.164 kcal/mol
Reverse Loops0.656 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding-1.813 kcal/mol outside primersite
Amplicon SequenceCATCGGCCTCATAATACCCACCCTGACCTGCTGTAAAAGACCTGGAACAAACAAAAATGA
TTACACCTACAGTGAAGATGCACACCATGTCCTCCTCGCATCTCTTCTACCTGGCGCTGT
GCCTGCTCACCTTCACCAGCTCTGCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111284 (IGF1)14895 - 242
Exon 2 To Exon 3 (Pair 4)
Forward (383,21)CCTCATAATACCCACCCTGACAmplicon SizecDNA: 142 bpgenomic: 2,829
Reverse (524,20)GTGGCAGAGCTGGTGAAGGTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.745 kcal/mol in 3' area
Forward Dimers-0.002 kcal/mol
Reverse Loops0.656 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.425 kcal/mol
Amplicon Folding-1.813 kcal/mol outside primersite
Amplicon SequenceCCTCATAATACCCACCCTGACCTGCTGTAAAAGACCTGGAACAAACAAAAATGATTACAC
CTACAGTGAAGATGCACACCATGTCCTCCTCGCATCTCTTCTACCTGGCGCTGTGCCTGC
TCACCTTCACCAGCTCTGCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111284 (IGF1)142101 - 242
Exon 2 To Exon 3 (Pair 5)
Forward (369,23)TCTATTCACATCGGCCTCATAATAmplicon SizecDNA: 156 bpgenomic: 2,843
Reverse (524,20)GTGGCAGAGCTGGTGAAGGTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.327 kcal/mol
Forward Dimers-2.164 kcal/mol
Reverse Loops0.656 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.292 kcal/mol
Amplicon Folding-1.813 kcal/mol outside primersite
Amplicon SequenceTCTATTCACATCGGCCTCATAATACCCACCCTGACCTGCTGTAAAAGACCTGGAACAAAC
AAAAATGATTACACCTACAGTGAAGATGCACACCATGTCCTCCTCGCATCTCTTCTACCT
GGCGCTGTGCCTGCTCACCTTCACCAGCTCTGCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111284 (IGF1)15687 - 242
Exon 2 To Exon 3 (Pair 6)
Forward (302,24)CAAATGTAACTAGATGCTTTCACAAmplicon SizecDNA: 223 bpgenomic: 2,910
Reverse (524,20)GTGGCAGAGCTGGTGAAGGTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.799 kcal/mol in 3' area
Forward Dimers-1.712 kcal/mol
Reverse Loops0.656 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.898 kcal/mol
Amplicon Folding-1.813 kcal/mol outside primersite
Amplicon SequenceCAAATGTAACTAGATGCTTTCACAAACCCCACCCACAAAGCAGCACATGTTTTTAAGACT
TCAGTTTTCTATTCACATCGGCCTCATAATACCCACCCTGACCTGCTGTAAAAGACCTGG
AACAAACAAAAATGATTACACCTACAGTGAAGATGCACACCATGTCCTCCTCGCATCTCT
TCTACCTGGCGCTGTGCCTGCTCACCTTCACCAGCTCTGCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111284 (IGF1)22320 - 242
Exon 2 To Exon 3 (Pair 7)
Forward (370,23)CTATTCACATCGGCCTCATAATAAmplicon SizecDNA: 155 bpgenomic: 2,842
Reverse (524,20)GTGGCAGAGCTGGTGAAGGTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.327 kcal/mol
Forward Dimers-2.164 kcal/mol
Reverse Loops0.656 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.292 kcal/mol
Amplicon Folding-1.813 kcal/mol outside primersite
Amplicon SequenceCTATTCACATCGGCCTCATAATACCCACCCTGACCTGCTGTAAAAGACCTGGAACAAACA
AAAATGATTACACCTACAGTGAAGATGCACACCATGTCCTCCTCGCATCTCTTCTACCTG
GCGCTGTGCCTGCTCACCTTCACCAGCTCTGCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111284 (IGF1)15588 - 242
Exon 2 To Exon 3 (Pair 8)
Forward (384,21)CTCATAATACCCACCCTGACCAmplicon SizecDNA: 141 bpgenomic: 2,828
Reverse (524,20)GTGGCAGAGCTGGTGAAGGTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.745 kcal/mol in 3' area
Forward Dimers-0.002 kcal/mol
Reverse Loops0.656 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.425 kcal/mol
Amplicon Folding-1.813 kcal/mol outside primersite
Amplicon SequenceCTCATAATACCCACCCTGACCTGCTGTAAAAGACCTGGAACAAACAAAAATGATTACACC
TACAGTGAAGATGCACACCATGTCCTCCTCGCATCTCTTCTACCTGGCGCTGTGCCTGCT
CACCTTCACCAGCTCTGCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111284 (IGF1)141102 - 242
Exon 2 To Exon 3 (Pair 9)
Forward (375,21)CACATCGGCCTCATAATACCCAmplicon SizecDNA: 150 bpgenomic: 2,837
Reverse (524,20)GTGGCAGAGCTGGTGAAGGTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.246 kcal/mol in 3' area
Forward Dimers-2.164 kcal/mol
Reverse Loops0.656 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.292 kcal/mol
Amplicon Folding-1.813 kcal/mol outside primersite
Amplicon SequenceCACATCGGCCTCATAATACCCACCCTGACCTGCTGTAAAAGACCTGGAACAAACAAAAAT
GATTACACCTACAGTGAAGATGCACACCATGTCCTCCTCGCATCTCTTCTACCTGGCGCT
GTGCCTGCTCACCTTCACCAGCTCTGCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111284 (IGF1)15093 - 242
Exon 2 To Exon 3 (Pair 10)
Forward (368,23)TTCTATTCACATCGGCCTCATAAAmplicon SizecDNA: 157 bpgenomic: 2,844
Reverse (524,20)GTGGCAGAGCTGGTGAAGGTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.327 kcal/mol
Forward Dimers-2.164 kcal/mol
Reverse Loops0.656 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.292 kcal/mol
Amplicon Folding-1.813 kcal/mol outside primersite
Amplicon SequenceTTCTATTCACATCGGCCTCATAATACCCACCCTGACCTGCTGTAAAAGACCTGGAACAAA
CAAAAATGATTACACCTACAGTGAAGATGCACACCATGTCCTCCTCGCATCTCTTCTACC
TGGCGCTGTGCCTGCTCACCTTCACCAGCTCTGCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111284 (IGF1)15786 - 242
Exon 2 To Exon 3 (Pair 11)
Forward (305,24)ATGTAACTAGATGCTTTCACAAACAmplicon SizecDNA: 220 bpgenomic: 2,907
Reverse (524,20)GTGGCAGAGCTGGTGAAGGTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.799 kcal/mol
Forward Dimers-1.712 kcal/mol
Reverse Loops0.656 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.898 kcal/mol
Amplicon Folding-1.813 kcal/mol outside primersite
Amplicon SequenceATGTAACTAGATGCTTTCACAAACCCCACCCACAAAGCAGCACATGTTTTTAAGACTTCA
GTTTTCTATTCACATCGGCCTCATAATACCCACCCTGACCTGCTGTAAAAGACCTGGAAC
AAACAAAAATGATTACACCTACAGTGAAGATGCACACCATGTCCTCCTCGCATCTCTTCT
ACCTGGCGCTGTGCCTGCTCACCTTCACCAGCTCTGCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111284 (IGF1)22023 - 242
Exon 2 To Exon 3 (Pair 12)
Forward (371,23)TATTCACATCGGCCTCATAATACAmplicon SizecDNA: 154 bpgenomic: 2,841
Reverse (524,20)GTGGCAGAGCTGGTGAAGGTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.327 kcal/mol
Forward Dimers-2.164 kcal/mol
Reverse Loops0.656 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.292 kcal/mol
Amplicon Folding-1.813 kcal/mol outside primersite
Amplicon SequenceTATTCACATCGGCCTCATAATACCCACCCTGACCTGCTGTAAAAGACCTGGAACAAACAA
AAATGATTACACCTACAGTGAAGATGCACACCATGTCCTCCTCGCATCTCTTCTACCTGG
CGCTGTGCCTGCTCACCTTCACCAGCTCTGCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111284 (IGF1)15489 - 242
Exon 2 To Exon 3 (Pair 13)
Forward (307,23)GTAACTAGATGCTTTCACAAACCAmplicon SizecDNA: 218 bpgenomic: 2,905
Reverse (524,20)GTGGCAGAGCTGGTGAAGGTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.799 kcal/mol
Forward Dimers-1.712 kcal/mol
Reverse Loops0.656 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.898 kcal/mol
Amplicon Folding-1.813 kcal/mol outside primersite
Amplicon SequenceGTAACTAGATGCTTTCACAAACCCCACCCACAAAGCAGCACATGTTTTTAAGACTTCAGT
TTTCTATTCACATCGGCCTCATAATACCCACCCTGACCTGCTGTAAAAGACCTGGAACAA
ACAAAAATGATTACACCTACAGTGAAGATGCACACCATGTCCTCCTCGCATCTCTTCTAC
CTGGCGCTGTGCCTGCTCACCTTCACCAGCTCTGCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111284 (IGF1)21825 - 242
Exon 2 To Exon 3 (Pair 14)
Forward (373,22)TTCACATCGGCCTCATAATACCAmplicon SizecDNA: 152 bpgenomic: 2,839
Reverse (524,20)GTGGCAGAGCTGGTGAAGGTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.352 kcal/mol
Forward Dimers-2.164 kcal/mol
Reverse Loops0.656 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.292 kcal/mol
Amplicon Folding-1.813 kcal/mol outside primersite
Amplicon SequenceTTCACATCGGCCTCATAATACCCACCCTGACCTGCTGTAAAAGACCTGGAACAAACAAAA
ATGATTACACCTACAGTGAAGATGCACACCATGTCCTCCTCGCATCTCTTCTACCTGGCG
CTGTGCCTGCTCACCTTCACCAGCTCTGCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111284 (IGF1)15291 - 242
Exon 3 To Exon 4 (Pair 1)
Forward (559,21)GTGGATGCTCTTCAGTTCGTGAmplicon SizecDNA: 76 bpgenomic: 56,028
Reverse (634,20)GACTGCTGGAGCCATACCCTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.744 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops1.106 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-2.455 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGTGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGG
TATGGCTCCAGCAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111283 (IGF1)76394 - 469
NM_000618 (IGF1)76394 - 469
NM_001111285 (IGF1)76394 - 469
NM_001111284 (IGF1)76277 - 352
Exon 3 To Exon 4 (Pair 2)
Forward (564,21)TGCTCTTCAGTTCGTGTGTGGAmplicon SizecDNA: 74 bpgenomic: 56,026
Reverse (637,20)TCCGACTGCTGGAGCCATACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.995 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops0.716 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-2.455 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceTGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGGTATGG
CTCCAGCAGTCGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)74399 - 472
NM_000618 (IGF1)74399 - 472
NM_001111283 (IGF1)74399 - 472
NM_001111284 (IGF1)74282 - 355
Exon 3 To Exon 4 (Pair 3)
Forward (559,21)GTGGATGCTCTTCAGTTCGTGAmplicon SizecDNA: 79 bpgenomic: 56,031
Reverse (637,20)TCCGACTGCTGGAGCCATACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.744 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops0.716 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-2.455 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGTGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGG
TATGGCTCCAGCAGTCGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000618 (IGF1)79394 - 472
NM_001111283 (IGF1)79394 - 472
NM_001111285 (IGF1)79394 - 472
NM_001111284 (IGF1)79277 - 355
Exon 3 To Exon 4 (Pair 4)
Forward (561,21)GGATGCTCTTCAGTTCGTGTGAmplicon SizecDNA: 73 bpgenomic: 56,025
Reverse (633,20)ACTGCTGGAGCCATACCCTGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.744 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops1.106 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-1.892 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGGTA
TGGCTCCAGCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111284 (IGF1)73279 - 351
NM_001111283 (IGF1)73396 - 468
NM_000618 (IGF1)73396 - 468
NM_001111285 (IGF1)73396 - 468
Exon 3 To Exon 4 (Pair 5)
Forward (561,21)GGATGCTCTTCAGTTCGTGTGAmplicon SizecDNA: 72 bpgenomic: 56,024
Reverse (632,20)CTGCTGGAGCCATACCCTGTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.744 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops1.106 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-1.892 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGGTA
TGGCTCCAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111283 (IGF1)72396 - 467
NM_000618 (IGF1)72396 - 467
NM_001111285 (IGF1)72396 - 467
NM_001111284 (IGF1)72279 - 350
Exon 3 To Exon 4 (Pair 6)
Forward (566,21)CTCTTCAGTTCGTGTGTGGAGAmplicon SizecDNA: 72 bpgenomic: 56,024
Reverse (637,20)TCCGACTGCTGGAGCCATACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.995 kcal/mol
Forward Dimers0.314 kcal/mol in 3' area
Reverse Loops0.716 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-2.121 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGGTATGGCT
CCAGCAGTCGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)72401 - 472
NM_001111283 (IGF1)72401 - 472
NM_000618 (IGF1)72401 - 472
NM_001111284 (IGF1)72284 - 355
Exon 3 To Exon 4 (Pair 7)
Forward (565,21)GCTCTTCAGTTCGTGTGTGGAAmplicon SizecDNA: 73 bpgenomic: 56,025
Reverse (637,20)TCCGACTGCTGGAGCCATACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.995 kcal/mol
Forward Dimers0.151 kcal/mol
Reverse Loops0.716 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-2.185 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGGTATGGC
TCCAGCAGTCGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)73400 - 472
NM_001111283 (IGF1)73400 - 472
NM_000618 (IGF1)73400 - 472
NM_001111284 (IGF1)73283 - 355
Exon 3 To Exon 4 (Pair 8)
Forward (561,21)GGATGCTCTTCAGTTCGTGTGAmplicon SizecDNA: 77 bpgenomic: 56,029
Reverse (637,20)TCCGACTGCTGGAGCCATACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.744 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops0.716 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-2.455 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGGTA
TGGCTCCAGCAGTCGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111284 (IGF1)77279 - 355
NM_001111283 (IGF1)77396 - 472
NM_000618 (IGF1)77396 - 472
NM_001111285 (IGF1)77396 - 472
Exon 3 To Exon 4 (Pair 9)
Forward (559,21)GTGGATGCTCTTCAGTTCGTGAmplicon SizecDNA: 74 bpgenomic: 56,026
Reverse (632,20)CTGCTGGAGCCATACCCTGTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.744 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops1.106 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-1.892 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGTGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGG
TATGGCTCCAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111284 (IGF1)74277 - 350
NM_001111285 (IGF1)74394 - 467
NM_000618 (IGF1)74394 - 467
NM_001111283 (IGF1)74394 - 467
Exon 3 To Exon 4 (Pair 10)
Forward (559,21)GTGGATGCTCTTCAGTTCGTGAmplicon SizecDNA: 75 bpgenomic: 56,027
Reverse (633,20)ACTGCTGGAGCCATACCCTGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.744 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops1.106 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-1.892 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGTGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGG
TATGGCTCCAGCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111283 (IGF1)75394 - 468
NM_000618 (IGF1)75394 - 468
NM_001111285 (IGF1)75394 - 468
NM_001111284 (IGF1)75277 - 351
Exon 3 To Exon 4 (Pair 11)
Forward (561,21)GGATGCTCTTCAGTTCGTGTGAmplicon SizecDNA: 74 bpgenomic: 56,026
Reverse (634,20)GACTGCTGGAGCCATACCCTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.744 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops1.106 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-2.455 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGGTA
TGGCTCCAGCAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)74396 - 469
NM_000618 (IGF1)74396 - 469
NM_001111283 (IGF1)74396 - 469
NM_001111284 (IGF1)74279 - 352
Exon 3 To Exon 4 (Pair 1)
Forward (559,21)GTGGATGCTCTTCAGTTCGTGAmplicon SizecDNA: 76 bpgenomic: 56,028
Reverse (634,20)GACTGCTGGAGCCATACCCTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.744 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops1.106 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-2.455 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGTGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGG
TATGGCTCCAGCAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111284 (IGF1)76277 - 352
NM_001111285 (IGF1)76394 - 469
NM_000618 (IGF1)76394 - 469
NM_001111283 (IGF1)76394 - 469
Exon 3 To Exon 4 (Pair 2)
Forward (564,21)TGCTCTTCAGTTCGTGTGTGGAmplicon SizecDNA: 74 bpgenomic: 56,026
Reverse (637,20)TCCGACTGCTGGAGCCATACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.995 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops0.716 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-2.455 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceTGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGGTATGG
CTCCAGCAGTCGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111283 (IGF1)74399 - 472
NM_000618 (IGF1)74399 - 472
NM_001111285 (IGF1)74399 - 472
NM_001111284 (IGF1)74282 - 355
Exon 3 To Exon 4 (Pair 3)
Forward (559,21)GTGGATGCTCTTCAGTTCGTGAmplicon SizecDNA: 79 bpgenomic: 56,031
Reverse (637,20)TCCGACTGCTGGAGCCATACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.744 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops0.716 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-2.455 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGTGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGG
TATGGCTCCAGCAGTCGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111284 (IGF1)79277 - 355
NM_001111285 (IGF1)79394 - 472
NM_001111283 (IGF1)79394 - 472
NM_000618 (IGF1)79394 - 472
Exon 3 To Exon 4 (Pair 4)
Forward (561,21)GGATGCTCTTCAGTTCGTGTGAmplicon SizecDNA: 73 bpgenomic: 56,025
Reverse (633,20)ACTGCTGGAGCCATACCCTGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.744 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops1.106 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-1.892 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGGTA
TGGCTCCAGCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111283 (IGF1)73396 - 468
NM_000618 (IGF1)73396 - 468
NM_001111285 (IGF1)73396 - 468
NM_001111284 (IGF1)73279 - 351
Exon 3 To Exon 4 (Pair 5)
Forward (561,21)GGATGCTCTTCAGTTCGTGTGAmplicon SizecDNA: 72 bpgenomic: 56,024
Reverse (632,20)CTGCTGGAGCCATACCCTGTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.744 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops1.106 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-1.892 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGGTA
TGGCTCCAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111284 (IGF1)72279 - 350
NM_001111285 (IGF1)72396 - 467
NM_000618 (IGF1)72396 - 467
NM_001111283 (IGF1)72396 - 467
Exon 3 To Exon 4 (Pair 6)
Forward (566,21)CTCTTCAGTTCGTGTGTGGAGAmplicon SizecDNA: 72 bpgenomic: 56,024
Reverse (637,20)TCCGACTGCTGGAGCCATACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.995 kcal/mol
Forward Dimers0.314 kcal/mol in 3' area
Reverse Loops0.716 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-2.121 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGGTATGGCT
CCAGCAGTCGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)72401 - 472
NM_001111283 (IGF1)72401 - 472
NM_000618 (IGF1)72401 - 472
NM_001111284 (IGF1)72284 - 355
Exon 3 To Exon 4 (Pair 7)
Forward (565,21)GCTCTTCAGTTCGTGTGTGGAAmplicon SizecDNA: 73 bpgenomic: 56,025
Reverse (637,20)TCCGACTGCTGGAGCCATACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.995 kcal/mol
Forward Dimers0.151 kcal/mol
Reverse Loops0.716 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-2.185 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGGTATGGC
TCCAGCAGTCGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)73400 - 472
NM_001111283 (IGF1)73400 - 472
NM_000618 (IGF1)73400 - 472
NM_001111284 (IGF1)73283 - 355
Exon 3 To Exon 4 (Pair 8)
Forward (561,21)GGATGCTCTTCAGTTCGTGTGAmplicon SizecDNA: 77 bpgenomic: 56,029
Reverse (637,20)TCCGACTGCTGGAGCCATACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.744 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops0.716 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-2.455 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGGTA
TGGCTCCAGCAGTCGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111284 (IGF1)77279 - 355
NM_001111285 (IGF1)77396 - 472
NM_000618 (IGF1)77396 - 472
NM_001111283 (IGF1)77396 - 472
Exon 3 To Exon 4 (Pair 9)
Forward (559,21)GTGGATGCTCTTCAGTTCGTGAmplicon SizecDNA: 74 bpgenomic: 56,026
Reverse (632,20)CTGCTGGAGCCATACCCTGTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.744 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops1.106 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-1.892 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGTGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGG
TATGGCTCCAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111284 (IGF1)74277 - 350
NM_001111285 (IGF1)74394 - 467
NM_000618 (IGF1)74394 - 467
NM_001111283 (IGF1)74394 - 467
Exon 3 To Exon 4 (Pair 10)
Forward (559,21)GTGGATGCTCTTCAGTTCGTGAmplicon SizecDNA: 75 bpgenomic: 56,027
Reverse (633,20)ACTGCTGGAGCCATACCCTGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.744 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops1.106 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-1.892 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGTGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGG
TATGGCTCCAGCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000618 (IGF1)75394 - 468
NM_001111283 (IGF1)75394 - 468
NM_001111285 (IGF1)75394 - 468
NM_001111284 (IGF1)75277 - 351
Exon 3 To Exon 4 (Pair 11)
Forward (561,21)GGATGCTCTTCAGTTCGTGTGAmplicon SizecDNA: 74 bpgenomic: 56,026
Reverse (634,20)GACTGCTGGAGCCATACCCTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.744 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops1.106 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-2.455 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGGTA
TGGCTCCAGCAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111284 (IGF1)74279 - 352
NM_001111285 (IGF1)74396 - 469
NM_001111283 (IGF1)74396 - 469
NM_000618 (IGF1)74396 - 469
Exon 4 To Exon 5 (Pair 1)
Forward (765,20)CGACATGCCCAAGACCCAGAAmplicon SizecDNA: 232 bpgenomic: 1,737
Reverse (996,22)CTGTCTGTTTAATCCTCCTGTCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.475 kcal/mol
Forward Dimers-1.092 kcal/mol
Reverse Loops2.901 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-1.725 kcal/mol
Amplicon Folding-0.213 kcal/mol outside primersite
Amplicon SequenceCGACATGCCCAAGACCCAGAAGTATCAGCCCCCATCTACCAACAAGAACACGAAGTCTCA
GAGAAGGAAAGGTTGGCCAAAGACACATCCAGGAGGGGAACAGAAGGAGGGGACAGAAGC
AAGTCTGCAGATCAGAGGAAAGAAGAAAGAGCAGAGGAGGGAGATTGGAAGTAGAAATGC
TGAATGCAGAGGCAAAAAAGGAAAATGAAGGACAGGAGGATTAAACAGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)232600 - 831
Exon 4 To Exon 5 (Pair 2)
Forward (765,20)CGACATGCCCAAGACCCAGAAmplicon SizecDNA: 243 bpgenomic: 1,748
Reverse (1007,22)CATCCTTGCCTCTGTCTGTTTANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.475 kcal/mol
Forward Dimers-1.092 kcal/mol
Reverse Loops2.413 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.725 kcal/mol
Amplicon Folding-0.213 kcal/mol outside primersite
Amplicon SequenceCGACATGCCCAAGACCCAGAAGTATCAGCCCCCATCTACCAACAAGAACACGAAGTCTCA
GAGAAGGAAAGGTTGGCCAAAGACACATCCAGGAGGGGAACAGAAGGAGGGGACAGAAGC
AAGTCTGCAGATCAGAGGAAAGAAGAAAGAGCAGAGGAGGGAGATTGGAAGTAGAAATGC
TGAATGCAGAGGCAAAAAAGGAAAATGAAGGACAGGAGGATTAAACAGACAGAGGCAAGG
ATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)243600 - 842
Exon 4 To Exon 5 (Pair 3)
Forward (765,20)CGACATGCCCAAGACCCAGAAmplicon SizecDNA: 250 bpgenomic: 1,755
Reverse (1014,21)CTCTCATCATCCTTGCCTCTGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.475 kcal/mol
Forward Dimers-1.092 kcal/mol
Reverse Loops2.108 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.436 kcal/mol
Amplicon Folding-0.213 kcal/mol outside primersite
Amplicon SequenceCGACATGCCCAAGACCCAGAAGTATCAGCCCCCATCTACCAACAAGAACACGAAGTCTCA
GAGAAGGAAAGGTTGGCCAAAGACACATCCAGGAGGGGAACAGAAGGAGGGGACAGAAGC
AAGTCTGCAGATCAGAGGAAAGAAGAAAGAGCAGAGGAGGGAGATTGGAAGTAGAAATGC
TGAATGCAGAGGCAAAAAAGGAAAATGAAGGACAGGAGGATTAAACAGACAGAGGCAAGG
ATGATGAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)250600 - 849
Exon 4 To Exon 5 (Pair 4)
Forward (765,20)CGACATGCCCAAGACCCAGAAmplicon SizecDNA: 234 bpgenomic: 1,739
Reverse (998,22)CTCTGTCTGTTTAATCCTCCTGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.475 kcal/mol
Forward Dimers-1.092 kcal/mol
Reverse Loops2.901 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-1.725 kcal/mol
Amplicon Folding-0.213 kcal/mol outside primersite
Amplicon SequenceCGACATGCCCAAGACCCAGAAGTATCAGCCCCCATCTACCAACAAGAACACGAAGTCTCA
GAGAAGGAAAGGTTGGCCAAAGACACATCCAGGAGGGGAACAGAAGGAGGGGACAGAAGC
AAGTCTGCAGATCAGAGGAAAGAAGAAAGAGCAGAGGAGGGAGATTGGAAGTAGAAATGC
TGAATGCAGAGGCAAAAAAGGAAAATGAAGGACAGGAGGATTAAACAGACAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)234600 - 833
Exon 4 To Exon 5 (Pair 5)
Forward (765,20)CGACATGCCCAAGACCCAGAAmplicon SizecDNA: 230 bpgenomic: 1,735
Reverse (994,22)GTCTGTTTAATCCTCCTGTCCTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.475 kcal/mol
Forward Dimers-1.092 kcal/mol
Reverse Loops2.901 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-1.455 kcal/mol
Amplicon Folding-0.213 kcal/mol outside primersite
Amplicon SequenceCGACATGCCCAAGACCCAGAAGTATCAGCCCCCATCTACCAACAAGAACACGAAGTCTCA
GAGAAGGAAAGGTTGGCCAAAGACACATCCAGGAGGGGAACAGAAGGAGGGGACAGAAGC
AAGTCTGCAGATCAGAGGAAAGAAGAAAGAGCAGAGGAGGGAGATTGGAAGTAGAAATGC
TGAATGCAGAGGCAAAAAAGGAAAATGAAGGACAGGAGGATTAAACAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)230600 - 829
Exon 4 To Exon 5 (Pair 6)
Forward (763,20)ACCGACATGCCCAAGACCCAAmplicon SizecDNA: 250 bpgenomic: 1,755
Reverse (1012,21)CTCATCATCCTTGCCTCTGTCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.264 kcal/mol
Forward Dimers-1.092 kcal/mol
Reverse Loops2.108 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.436 kcal/mol
Amplicon Folding-0.213 kcal/mol outside primersite
Amplicon SequenceACCGACATGCCCAAGACCCAGAAGTATCAGCCCCCATCTACCAACAAGAACACGAAGTCT
CAGAGAAGGAAAGGTTGGCCAAAGACACATCCAGGAGGGGAACAGAAGGAGGGGACAGAA
GCAAGTCTGCAGATCAGAGGAAAGAAGAAAGAGCAGAGGAGGGAGATTGGAAGTAGAAAT
GCTGAATGCAGAGGCAAAAAAGGAAAATGAAGGACAGGAGGATTAAACAGACAGAGGCAA
GGATGATGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)250598 - 847
Exon 4 To Exon 5 (Pair 7)
Forward (761,20)ACACCGACATGCCCAAGACCAmplicon SizecDNA: 82 bpgenomic: 1,587
Reverse (842,21)GGCCAACCTTTCCTTCTCTGANr. of Isoforms 2 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.179 kcal/mol
Forward Dimers-1.092 kcal/mol
Reverse Loops1.402 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-1.393 kcal/mol
Amplicon Folding-0.213 kcal/mol outside primersite
Amplicon SequenceACACCGACATGCCCAAGACCCAGAAGTATCAGCCCCCATCTACCAACAAGAACACGAAGT
CTCAGAGAAGGAAAGGTTGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111283 (IGF1)76596 - 671
NM_001111285 (IGF1)82596 - 677
Exon 4 To Exon 5 (Pair 8)
Forward (763,20)ACCGACATGCCCAAGACCCAAmplicon SizecDNA: 252 bpgenomic: 1,757
Reverse (1014,21)CTCTCATCATCCTTGCCTCTGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.264 kcal/mol
Forward Dimers-1.092 kcal/mol
Reverse Loops2.108 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.436 kcal/mol
Amplicon Folding-0.213 kcal/mol outside primersite
Amplicon SequenceACCGACATGCCCAAGACCCAGAAGTATCAGCCCCCATCTACCAACAAGAACACGAAGTCT
CAGAGAAGGAAAGGTTGGCCAAAGACACATCCAGGAGGGGAACAGAAGGAGGGGACAGAA
GCAAGTCTGCAGATCAGAGGAAAGAAGAAAGAGCAGAGGAGGGAGATTGGAAGTAGAAAT
GCTGAATGCAGAGGCAAAAAAGGAAAATGAAGGACAGGAGGATTAAACAGACAGAGGCAA
GGATGATGAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)252598 - 849
Exon 4 To Exon 5 (Pair 9)
Forward (765,20)CGACATGCCCAAGACCCAGAAmplicon SizecDNA: 154 bpgenomic: 1,659
Reverse (918,22)CTGCTCTTTCTTCTTTCCTCTGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.475 kcal/mol
Forward Dimers-1.092 kcal/mol
Reverse Loops4.682 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.316 kcal/mol
Amplicon Folding-0.213 kcal/mol outside primersite
Amplicon SequenceCGACATGCCCAAGACCCAGAAGTATCAGCCCCCATCTACCAACAAGAACACGAAGTCTCA
GAGAAGGAAAGGTTGGCCAAAGACACATCCAGGAGGGGAACAGAAGGAGGGGACAGAAGC
AAGTCTGCAGATCAGAGGAAAGAAGAAAGAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)154600 - 753
Exon 4 To Exon 5 (Pair 10)
Forward (765,20)CGACATGCCCAAGACCCAGAAmplicon SizecDNA: 177 bpgenomic: 1,682
Reverse (941,22)TTTCTACTTCCAATCTCCCTCCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.475 kcal/mol
Forward Dimers-1.092 kcal/mol
Reverse Loops3.816 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-1.554 kcal/mol
Amplicon Folding-0.213 kcal/mol outside primersite
Amplicon SequenceCGACATGCCCAAGACCCAGAAGTATCAGCCCCCATCTACCAACAAGAACACGAAGTCTCA
GAGAAGGAAAGGTTGGCCAAAGACACATCCAGGAGGGGAACAGAAGGAGGGGACAGAAGC
AAGTCTGCAGATCAGAGGAAAGAAGAAAGAGCAGAGGAGGGAGATTGGAAGTAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)177600 - 776
Exon 4 To Exon 5 (Pair 11)
Forward (763,20)ACCGACATGCCCAAGACCCAAmplicon SizecDNA: 179 bpgenomic: 1,684
Reverse (941,22)TTTCTACTTCCAATCTCCCTCCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.264 kcal/mol
Forward Dimers-1.092 kcal/mol
Reverse Loops3.816 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-1.554 kcal/mol
Amplicon Folding-0.213 kcal/mol outside primersite
Amplicon SequenceACCGACATGCCCAAGACCCAGAAGTATCAGCCCCCATCTACCAACAAGAACACGAAGTCT
CAGAGAAGGAAAGGTTGGCCAAAGACACATCCAGGAGGGGAACAGAAGGAGGGGACAGAA
GCAAGTCTGCAGATCAGAGGAAAGAAGAAAGAGCAGAGGAGGGAGATTGGAAGTAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)179598 - 776
Exon 4 To Exon 5 (Pair 12)
Forward (759,20)CCACACCGACATGCCCAAGAAmplicon SizecDNA: 241 bpgenomic: 1,746
Reverse (999,22)CCTCTGTCTGTTTAATCCTCCTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.179 kcal/mol
Forward Dimers-1.092 kcal/mol
Reverse Loops2.901 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-1.145 kcal/mol
Amplicon Folding-0.213 kcal/mol outside primersite
Amplicon SequenceCCACACCGACATGCCCAAGACCCAGAAGTATCAGCCCCCATCTACCAACAAGAACACGAA
GTCTCAGAGAAGGAAAGGTTGGCCAAAGACACATCCAGGAGGGGAACAGAAGGAGGGGAC
AGAAGCAAGTCTGCAGATCAGAGGAAAGAAGAAAGAGCAGAGGAGGGAGATTGGAAGTAG
AAATGCTGAATGCAGAGGCAAAAAAGGAAAATGAAGGACAGGAGGATTAAACAGACAGAG
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)241594 - 834
Exon 4 To Exon 5 (Pair 13)
Forward (759,20)CCACACCGACATGCCCAAGAAmplicon SizecDNA: 237 bpgenomic: 1,742
Reverse (995,22)TGTCTGTTTAATCCTCCTGTCCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.179 kcal/mol
Forward Dimers-1.092 kcal/mol
Reverse Loops2.901 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-1.145 kcal/mol
Amplicon Folding-0.213 kcal/mol outside primersite
Amplicon SequenceCCACACCGACATGCCCAAGACCCAGAAGTATCAGCCCCCATCTACCAACAAGAACACGAA
GTCTCAGAGAAGGAAAGGTTGGCCAAAGACACATCCAGGAGGGGAACAGAAGGAGGGGAC
AGAAGCAAGTCTGCAGATCAGAGGAAAGAAGAAAGAGCAGAGGAGGGAGATTGGAAGTAG
AAATGCTGAATGCAGAGGCAAAAAAGGAAAATGAAGGACAGGAGGATTAAACAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)237594 - 830
Exon 4 To Exon 5 (Pair 14)
Forward (759,20)CCACACCGACATGCCCAAGAAmplicon SizecDNA: 238 bpgenomic: 1,743
Reverse (996,22)CTGTCTGTTTAATCCTCCTGTCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.179 kcal/mol
Forward Dimers-1.092 kcal/mol
Reverse Loops2.901 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-1.145 kcal/mol
Amplicon Folding-0.213 kcal/mol outside primersite
Amplicon SequenceCCACACCGACATGCCCAAGACCCAGAAGTATCAGCCCCCATCTACCAACAAGAACACGAA
GTCTCAGAGAAGGAAAGGTTGGCCAAAGACACATCCAGGAGGGGAACAGAAGGAGGGGAC
AGAAGCAAGTCTGCAGATCAGAGGAAAGAAGAAAGAGCAGAGGAGGGAGATTGGAAGTAG
AAATGCTGAATGCAGAGGCAAAAAAGGAAAATGAAGGACAGGAGGATTAAACAGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)238594 - 831
Exon 4 To Exon 5 (Pair 15)
Forward (763,20)ACCGACATGCCCAAGACCCAAmplicon SizecDNA: 155 bpgenomic: 1,660
Reverse (917,23)TGCTCTTTCTTCTTTCCTCTGATNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.264 kcal/mol
Forward Dimers-1.092 kcal/mol
Reverse Loops2.07 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.316 kcal/mol
Amplicon Folding-0.213 kcal/mol outside primersite
Amplicon SequenceACCGACATGCCCAAGACCCAGAAGTATCAGCCCCCATCTACCAACAAGAACACGAAGTCT
CAGAGAAGGAAAGGTTGGCCAAAGACACATCCAGGAGGGGAACAGAAGGAGGGGACAGAA
GCAAGTCTGCAGATCAGAGGAAAGAAGAAAGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)155598 - 752
Exon 4 To Exon 5 (Pair 16)
Forward (765,20)CGACATGCCCAAGACCCAGAAmplicon SizecDNA: 248 bpgenomic: 1,753
Reverse (1012,21)CTCATCATCCTTGCCTCTGTCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.475 kcal/mol
Forward Dimers-1.092 kcal/mol
Reverse Loops2.108 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.436 kcal/mol
Amplicon Folding-0.213 kcal/mol outside primersite
Amplicon SequenceCGACATGCCCAAGACCCAGAAGTATCAGCCCCCATCTACCAACAAGAACACGAAGTCTCA
GAGAAGGAAAGGTTGGCCAAAGACACATCCAGGAGGGGAACAGAAGGAGGGGACAGAAGC
AAGTCTGCAGATCAGAGGAAAGAAGAAAGAGCAGAGGAGGGAGATTGGAAGTAGAAATGC
TGAATGCAGAGGCAAAAAAGGAAAATGAAGGACAGGAGGATTAAACAGACAGAGGCAAGG
ATGATGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)248600 - 847
Exon 4 To Exon 5 (Pair 17)
Forward (763,20)ACCGACATGCCCAAGACCCAAmplicon SizecDNA: 80 bpgenomic: 1,585
Reverse (842,21)GGCCAACCTTTCCTTCTCTGANr. of Isoforms 2 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.264 kcal/mol
Forward Dimers-1.092 kcal/mol
Reverse Loops1.402 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-1.393 kcal/mol
Amplicon Folding-0.213 kcal/mol outside primersite
Amplicon SequenceACCGACATGCCCAAGACCCAGAAGTATCAGCCCCCATCTACCAACAAGAACACGAAGTCT
CAGAGAAGGAAAGGTTGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111283 (IGF1)74598 - 671
NM_001111285 (IGF1)80598 - 677
Exon 4 To Exon 5 (Pair 18)
Forward (760,20)CACACCGACATGCCCAAGACAmplicon SizecDNA: 83 bpgenomic: 1,588
Reverse (842,21)GGCCAACCTTTCCTTCTCTGANr. of Isoforms 2 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.179 kcal/mol
Forward Dimers-1.092 kcal/mol
Reverse Loops1.402 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-1.393 kcal/mol
Amplicon Folding-0.213 kcal/mol outside primersite
Amplicon SequenceCACACCGACATGCCCAAGACCCAGAAGTATCAGCCCCCATCTACCAACAAGAACACGAAG
TCTCAGAGAAGGAAAGGTTGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)83595 - 677
NM_001111283 (IGF1)77595 - 671
Exon 4 To Exon 5 (Pair 19)
Forward (765,20)CGACATGCCCAAGACCCAGAAmplicon SizecDNA: 242 bpgenomic: 1,747
Reverse (1006,23)ATCCTTGCCTCTGTCTGTTTAATNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.475 kcal/mol
Forward Dimers-1.092 kcal/mol
Reverse Loops2.555 kcal/mol
Reverse Dimers0.136 kcal/mol
Forward-Reverse Dimers-1.725 kcal/mol
Amplicon Folding-0.213 kcal/mol outside primersite
Amplicon SequenceCGACATGCCCAAGACCCAGAAGTATCAGCCCCCATCTACCAACAAGAACACGAAGTCTCA
GAGAAGGAAAGGTTGGCCAAAGACACATCCAGGAGGGGAACAGAAGGAGGGGACAGAAGC
AAGTCTGCAGATCAGAGGAAAGAAGAAAGAGCAGAGGAGGGAGATTGGAAGTAGAAATGC
TGAATGCAGAGGCAAAAAAGGAAAATGAAGGACAGGAGGATTAAACAGACAGAGGCAAGG
AT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)242600 - 841
Exon 4 To Exon 5 (Pair 20)
Forward (765,20)CGACATGCCCAAGACCCAGAAmplicon SizecDNA: 231 bpgenomic: 1,736
Reverse (995,22)TGTCTGTTTAATCCTCCTGTCCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.475 kcal/mol
Forward Dimers-1.092 kcal/mol
Reverse Loops2.901 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-1.725 kcal/mol
Amplicon Folding-0.213 kcal/mol outside primersite
Amplicon SequenceCGACATGCCCAAGACCCAGAAGTATCAGCCCCCATCTACCAACAAGAACACGAAGTCTCA
GAGAAGGAAAGGTTGGCCAAAGACACATCCAGGAGGGGAACAGAAGGAGGGGACAGAAGC
AAGTCTGCAGATCAGAGGAAAGAAGAAAGAGCAGAGGAGGGAGATTGGAAGTAGAAATGC
TGAATGCAGAGGCAAAAAAGGAAAATGAAGGACAGGAGGATTAAACAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)231600 - 830
Exon 4 To Exon 5 (Pair 21)
Forward (759,20)CCACACCGACATGCCCAAGAAmplicon SizecDNA: 240 bpgenomic: 1,745
Reverse (998,22)CTCTGTCTGTTTAATCCTCCTGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.179 kcal/mol
Forward Dimers-1.092 kcal/mol
Reverse Loops2.901 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-1.145 kcal/mol
Amplicon Folding-0.213 kcal/mol outside primersite
Amplicon SequenceCCACACCGACATGCCCAAGACCCAGAAGTATCAGCCCCCATCTACCAACAAGAACACGAA
GTCTCAGAGAAGGAAAGGTTGGCCAAAGACACATCCAGGAGGGGAACAGAAGGAGGGGAC
AGAAGCAAGTCTGCAGATCAGAGGAAAGAAGAAAGAGCAGAGGAGGGAGATTGGAAGTAG
AAATGCTGAATGCAGAGGCAAAAAAGGAAAATGAAGGACAGGAGGATTAAACAGACAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)240594 - 833
Exon 4 To Exon 5 (Pair 22)
Forward (765,20)CGACATGCCCAAGACCCAGAAmplicon SizecDNA: 235 bpgenomic: 1,740
Reverse (999,22)CCTCTGTCTGTTTAATCCTCCTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.475 kcal/mol
Forward Dimers-1.092 kcal/mol
Reverse Loops2.901 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-1.725 kcal/mol
Amplicon Folding-0.213 kcal/mol outside primersite
Amplicon SequenceCGACATGCCCAAGACCCAGAAGTATCAGCCCCCATCTACCAACAAGAACACGAAGTCTCA
GAGAAGGAAAGGTTGGCCAAAGACACATCCAGGAGGGGAACAGAAGGAGGGGACAGAAGC
AAGTCTGCAGATCAGAGGAAAGAAGAAAGAGCAGAGGAGGGAGATTGGAAGTAGAAATGC
TGAATGCAGAGGCAAAAAAGGAAAATGAAGGACAGGAGGATTAAACAGACAGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)235600 - 834
Exon 4 To Exon 5 (Pair 23)
Forward (763,20)ACCGACATGCCCAAGACCCAAmplicon SizecDNA: 156 bpgenomic: 1,661
Reverse (918,22)CTGCTCTTTCTTCTTTCCTCTGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.264 kcal/mol
Forward Dimers-1.092 kcal/mol
Reverse Loops4.682 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.316 kcal/mol
Amplicon Folding-0.213 kcal/mol outside primersite
Amplicon SequenceACCGACATGCCCAAGACCCAGAAGTATCAGCCCCCATCTACCAACAAGAACACGAAGTCT
CAGAGAAGGAAAGGTTGGCCAAAGACACATCCAGGAGGGGAACAGAAGGAGGGGACAGAA
GCAAGTCTGCAGATCAGAGGAAAGAAGAAAGAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)156598 - 753
Exon 4 To Exon 5 (Pair 24)
Forward (759,20)CCACACCGACATGCCCAAGAAmplicon SizecDNA: 84 bpgenomic: 1,589
Reverse (842,21)GGCCAACCTTTCCTTCTCTGANr. of Isoforms 2 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.179 kcal/mol
Forward Dimers-1.092 kcal/mol
Reverse Loops1.402 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-1.393 kcal/mol
Amplicon Folding-0.213 kcal/mol outside primersite
Amplicon SequenceCCACACCGACATGCCCAAGACCCAGAAGTATCAGCCCCCATCTACCAACAAGAACACGAA
GTCTCAGAGAAGGAAAGGTTGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111285 (IGF1)84594 - 677
NM_001111283 (IGF1)78594 - 671
 

See below for some more details.

Program Output:

Loading ...