Design Results for Igf1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 3 To Exon 4 (Pair 1)
Forward (559,21)GTGGATGCTCTTCAGTTCGTGAmplicon SizecDNA: 75 bpgenomic: 56,027
Reverse (633,20)ACTGCTGGAGCCATACCCTGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.744 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops1.106 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-1.892 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGTGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGG
TATGGCTCCAGCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111284 (IGF1)75277 - 351
NM_001111285 (IGF1)75394 - 468
NM_001111283 (IGF1)75394 - 468
NM_000618 (IGF1)75394 - 468
Exon 3 To Exon 4 (Pair 2)
Forward (561,21)GGATGCTCTTCAGTTCGTGTGAmplicon SizecDNA: 74 bpgenomic: 56,026
Reverse (634,20)GACTGCTGGAGCCATACCCTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.744 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops1.106 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-2.455 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGGTA
TGGCTCCAGCAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000618 (IGF1)74396 - 469
NM_001111285 (IGF1)74396 - 469
NM_001111283 (IGF1)74396 - 469
NM_001111284 (IGF1)74279 - 352
Exon 3 To Exon 4 (Pair 3)
Forward (559,21)GTGGATGCTCTTCAGTTCGTGAmplicon SizecDNA: 74 bpgenomic: 56,026
Reverse (632,20)CTGCTGGAGCCATACCCTGTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.744 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops1.106 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-1.892 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGTGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGG
TATGGCTCCAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111283 (IGF1)74394 - 467
NM_001111285 (IGF1)74394 - 467
NM_001111284 (IGF1)74277 - 350
NM_000618 (IGF1)74394 - 467
Exon 3 To Exon 4 (Pair 4)
Forward (561,21)GGATGCTCTTCAGTTCGTGTGAmplicon SizecDNA: 77 bpgenomic: 56,029
Reverse (637,20)TCCGACTGCTGGAGCCATACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.744 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops0.716 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-2.455 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGGTA
TGGCTCCAGCAGTCGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000618 (IGF1)77396 - 472
NM_001111284 (IGF1)77279 - 355
NM_001111285 (IGF1)77396 - 472
NM_001111283 (IGF1)77396 - 472
Exon 3 To Exon 4 (Pair 5)
Forward (559,21)GTGGATGCTCTTCAGTTCGTGAmplicon SizecDNA: 79 bpgenomic: 56,031
Reverse (637,20)TCCGACTGCTGGAGCCATACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.744 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops0.716 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-2.455 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGTGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGG
TATGGCTCCAGCAGTCGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000618 (IGF1)79394 - 472
NM_001111285 (IGF1)79394 - 472
NM_001111283 (IGF1)79394 - 472
NM_001111284 (IGF1)79277 - 355
Exon 3 To Exon 4 (Pair 6)
Forward (561,21)GGATGCTCTTCAGTTCGTGTGAmplicon SizecDNA: 73 bpgenomic: 56,025
Reverse (633,20)ACTGCTGGAGCCATACCCTGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.744 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops1.106 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-1.892 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGGTA
TGGCTCCAGCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000618 (IGF1)73396 - 468
NM_001111285 (IGF1)73396 - 468
NM_001111283 (IGF1)73396 - 468
NM_001111284 (IGF1)73279 - 351
Exon 3 To Exon 4 (Pair 7)
Forward (565,21)GCTCTTCAGTTCGTGTGTGGAAmplicon SizecDNA: 73 bpgenomic: 56,025
Reverse (637,20)TCCGACTGCTGGAGCCATACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.995 kcal/mol
Forward Dimers0.151 kcal/mol
Reverse Loops0.716 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-2.185 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGGTATGGC
TCCAGCAGTCGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111283 (IGF1)73400 - 472
NM_001111285 (IGF1)73400 - 472
NM_001111284 (IGF1)73283 - 355
NM_000618 (IGF1)73400 - 472
Exon 3 To Exon 4 (Pair 8)
Forward (559,21)GTGGATGCTCTTCAGTTCGTGAmplicon SizecDNA: 76 bpgenomic: 56,028
Reverse (634,20)GACTGCTGGAGCCATACCCTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.744 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops1.106 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-2.455 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGTGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGG
TATGGCTCCAGCAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000618 (IGF1)76394 - 469
NM_001111284 (IGF1)76277 - 352
NM_001111285 (IGF1)76394 - 469
NM_001111283 (IGF1)76394 - 469
Exon 3 To Exon 4 (Pair 9)
Forward (566,21)CTCTTCAGTTCGTGTGTGGAGAmplicon SizecDNA: 72 bpgenomic: 56,024
Reverse (637,20)TCCGACTGCTGGAGCCATACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.995 kcal/mol
Forward Dimers0.314 kcal/mol in 3' area
Reverse Loops0.716 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-2.121 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGGTATGGCT
CCAGCAGTCGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000618 (IGF1)72401 - 472
NM_001111284 (IGF1)72284 - 355
NM_001111285 (IGF1)72401 - 472
NM_001111283 (IGF1)72401 - 472
Exon 3 To Exon 4 (Pair 10)
Forward (561,21)GGATGCTCTTCAGTTCGTGTGAmplicon SizecDNA: 72 bpgenomic: 56,024
Reverse (632,20)CTGCTGGAGCCATACCCTGTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.744 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops1.106 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-1.892 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGGTA
TGGCTCCAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001111284 (IGF1)72279 - 350
NM_001111283 (IGF1)72396 - 467
NM_001111285 (IGF1)72396 - 467
NM_000618 (IGF1)72396 - 467
Exon 3 To Exon 4 (Pair 11)
Forward (564,21)TGCTCTTCAGTTCGTGTGTGGAmplicon SizecDNA: 74 bpgenomic: 56,026
Reverse (637,20)TCCGACTGCTGGAGCCATACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.995 kcal/mol
Forward Dimers0.07 kcal/mol
Reverse Loops0.716 kcal/mol
Reverse Dimers-1.298 kcal/mol
Forward-Reverse Dimers-2.455 kcal/mol
Amplicon Folding-1.827 kcal/mol outside primersite
Amplicon SequenceTGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGGTATGG
CTCCAGCAGTCGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000618 (IGF1)74399 - 472
NM_001111284 (IGF1)74282 - 355
NM_001111285 (IGF1)74399 - 472
NM_001111283 (IGF1)74399 - 472
 

See below for some more details.

Program Output:

Loading ...